ID: 961919628

View in Genome Browser
Species Human (GRCh38)
Location 3:130412390-130412412
Sequence GCTGCTAACCACACTGGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 117}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961919624_961919628 -9 Left 961919624 3:130412376-130412398 CCTCCAGAGTCTGGGCTGCTAAC 0: 1
1: 0
2: 2
3: 24
4: 177
Right 961919628 3:130412390-130412412 GCTGCTAACCACACTGGGTGAGG 0: 1
1: 0
2: 0
3: 11
4: 117
961919623_961919628 -8 Left 961919623 3:130412375-130412397 CCCTCCAGAGTCTGGGCTGCTAA 0: 1
1: 0
2: 1
3: 22
4: 178
Right 961919628 3:130412390-130412412 GCTGCTAACCACACTGGGTGAGG 0: 1
1: 0
2: 0
3: 11
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961919628 Original CRISPR GCTGCTAACCACACTGGGTG AGG Intronic
900659290 1:3774746-3774768 GCTGCAACCCACACAGGCTGAGG + Intronic
904034515 1:27551588-27551610 GCTGTTGGCCAAACTGGGTGAGG + Exonic
914919484 1:151837975-151837997 GCTGCTGCCCCCGCTGGGTGGGG - Exonic
920374419 1:205499849-205499871 GCTGCAGGCCACACTGGCTGGGG - Intergenic
923216611 1:231854017-231854039 GCTGCTCACCCACCTGGGTGGGG + Intronic
1063923431 10:10954146-10954168 GCTCCTATCCACAGTGGGAGAGG - Intergenic
1066437427 10:35407210-35407232 ACTGTAAACCAGACTGGGTGTGG + Intronic
1069833897 10:71296771-71296793 GCTGCACACCACACTGGCGGAGG + Intronic
1070326691 10:75394402-75394424 GCTGCTAGCCACATTCGGTGAGG + Intergenic
1071836653 10:89424934-89424956 TTTGCTCTCCACACTGGGTGAGG - Intergenic
1074275728 10:112000122-112000144 GCTGCCAGCCTCACTGGCTGAGG + Intergenic
1075601509 10:123772751-123772773 GCTGATAACCACAATGAGGGAGG - Intronic
1075601581 10:123773129-123773151 GCTGATAACCACAATGAGGGAGG - Intronic
1076413949 10:130271625-130271647 GCTTCTGTCCACACGGGGTGGGG - Intergenic
1076992556 11:283037-283059 GCAGCTAAGCACACTGAGGGAGG + Intronic
1077164074 11:1127297-1127319 GCTGCACCCCACGCTGGGTGAGG + Intergenic
1079335836 11:19569793-19569815 GCCCCTAACCACCCTGGATGGGG + Intronic
1081936264 11:46905941-46905963 GCTGCTAACCACACACAGTAGGG + Intronic
1084591100 11:70091119-70091141 TCTGCTAACCACGCTGGCAGGGG - Intronic
1085462842 11:76705341-76705363 GGTGCAAACCACACTGGGTAAGG - Intergenic
1088571616 11:111228693-111228715 CCTCCTAACCAGTCTGGGTGGGG + Intergenic
1088674491 11:112179357-112179379 GCTGCTGACCACAGTGGAAGAGG + Exonic
1090403070 11:126461262-126461284 GCTGCTCACCACACAGGAGGAGG + Intronic
1100117322 12:91323014-91323036 GCTGCTAATCAATCAGGGTGGGG + Intergenic
1101197208 12:102396431-102396453 GCTGCTAAACACACTGCAGGAGG - Intronic
1101858640 12:108464635-108464657 GCTACAAACAACACTGGCTGTGG - Intergenic
1102511344 12:113417668-113417690 GCTTCTAGCCTCACTGGCTGCGG - Intronic
1102511349 12:113417701-113417723 GCTTCTAGCCTCACTGGCTGCGG - Intronic
1104117025 12:125759612-125759634 GCTGCCCACCACACTGGGTTTGG - Intergenic
1105019830 12:132808678-132808700 GCCCCTCACCACACAGGGTGCGG + Intronic
1106298403 13:28439629-28439651 GATGCTAATCACATTGGATGAGG - Intronic
1112008001 13:95270722-95270744 TCTGCAAACCACACTGAGTAGGG + Intronic
1113559986 13:111271127-111271149 GCTCCAAACATCACTGGGTGGGG - Intronic
1114322803 14:21561065-21561087 AATGCTAACCACATCGGGTGCGG - Intergenic
1116798088 14:49413205-49413227 GCTGCTCCCCACCCTGAGTGAGG - Intergenic
1118631149 14:67704500-67704522 GCTTATAACCACCCTGGGTTAGG + Intronic
1119194752 14:72709114-72709136 GATACTACCCCCACTGGGTGTGG + Intronic
1120940612 14:89945117-89945139 ACTACTACCCACACTGAGTGGGG - Intronic
1129297700 15:74608952-74608974 GCTGCTAGCAGCACTGGGTGTGG - Intronic
1130742392 15:86614907-86614929 GGTGACAACCAAACTGGGTGTGG + Intronic
1131194607 15:90345557-90345579 GCTACCATCCACCCTGGGTGAGG - Intergenic
1134452188 16:14370340-14370362 GCTGCTGACCAGGCTGGGCGTGG + Intergenic
1136084873 16:27877642-27877664 GCTGCCAGCAACACTGAGTGGGG + Intronic
1137912007 16:52387257-52387279 GCTGCTCAGCTCCCTGGGTGAGG + Intergenic
1138944155 16:61827721-61827743 GCTGCTTACCTCAATGGGGGAGG - Intronic
1142232500 16:88906364-88906386 GCTGCGAACCACACAGGAAGAGG + Intronic
1203141956 16_KI270728v1_random:1772513-1772535 CGTCCCAACCACACTGGGTGTGG - Intergenic
1144136507 17:12300466-12300488 CCTCATAACCACAATGGGTGTGG + Intergenic
1144451483 17:15383498-15383520 GATGCCAACCTCACTGGGTCAGG - Intergenic
1148207809 17:45790686-45790708 GCTCCCAACCAGACTGGCTGGGG - Intronic
1148912597 17:50950858-50950880 GCCGCTCCCCACACTGGGCGGGG + Intergenic
1151827166 17:76529937-76529959 GCTGCTGACCACACTGGCCCCGG - Intronic
1154028240 18:10726753-10726775 GCTGCTGACCTCACTGGGCAAGG + Intronic
1156295276 18:35783925-35783947 GCTGGTCACCACAGTGGTTGTGG - Intergenic
1158597046 18:58825757-58825779 TCTGCTAACTCCACTGGCTGCGG - Intergenic
1159556617 18:69952480-69952502 GGTGCCAACCCCACTGAGTGGGG + Intronic
1164160477 19:22623074-22623096 GCTGCGAGCCACACAGGGTGCGG + Intergenic
1164308769 19:24028654-24028676 GCTGCAAATCAAACTGGGGGCGG + Intergenic
1168687461 19:58357446-58357468 GCAGCAAGCCACACTGGGGGCGG - Exonic
925005578 2:440863-440885 GCTGTAAACAGCACTGGGTGTGG - Intergenic
925151323 2:1617539-1617561 GCAGCCAACCACTCTGGCTGAGG - Intergenic
925876520 2:8315985-8316007 CCTGCTAAGCCCAGTGGGTGTGG - Intergenic
925899173 2:8496199-8496221 GAAGCTAACCAGACTGGGAGGGG - Intergenic
926627193 2:15102068-15102090 GCTACTAACCACAGAGGCTGAGG - Intergenic
940979182 2:159982366-159982388 GCTGCTCATCACACTTGGTCGGG - Intronic
941379261 2:164772137-164772159 GCTGCTAACCACACACTGTGAGG - Intronic
944906699 2:204269085-204269107 GCTGCTCACAACCCTGGGAGGGG + Intergenic
944908959 2:204290580-204290602 GCTGGGAACCAGAGTGGGTGTGG + Intergenic
946084242 2:217155067-217155089 GCTGCAGTCGACACTGGGTGTGG + Intergenic
1171561959 20:26134633-26134655 GCAGGAAACCACAGTGGGTGTGG + Intergenic
1173651905 20:44671751-44671773 ACTGAAAACCAGACTGGGTGTGG - Intergenic
1173949942 20:46983610-46983632 GCTGATATCCAAGCTGGGTGCGG - Intronic
1179787971 21:43740542-43740564 GCAGCCATCCACACAGGGTGGGG - Intronic
1179928183 21:44550078-44550100 GCTTCTACCCACAGTGCGTGGGG + Intronic
1179939500 21:44628636-44628658 GCTTCTACCCACAGTGAGTGGGG - Intronic
1181938181 22:26453889-26453911 TCTGCTCTCCACACTGGGGGTGG + Intronic
1183188225 22:36304697-36304719 CCTGCTCACCACACTGGATGTGG + Intronic
1183217546 22:36490578-36490600 GCAGGCAACCACACTGGGGGCGG + Intronic
949660565 3:6273688-6273710 GCAGCTAATCACACTTGCTGTGG + Intergenic
950562861 3:13745505-13745527 GCTGCTCACCACAAAGGTTGTGG + Intergenic
951889655 3:27556394-27556416 GCTTCTAACCACACTGGAGATGG + Intergenic
954875792 3:53802477-53802499 GCTGCCAGCCACACAGGCTGAGG - Intronic
955252199 3:57295067-57295089 GTTGCTAGCCACATGGGGTGGGG - Intronic
957431043 3:80107059-80107081 GAAGGTAATCACACTGGGTGAGG - Intergenic
961919628 3:130412390-130412412 GCTGCTAACCACACTGGGTGAGG + Intronic
962382640 3:134909984-134910006 GCAGCCAACCACACTGTGTGGGG - Intronic
966912259 3:184566152-184566174 GATGCTGGCCACACTGGGTCTGG - Intronic
967410903 3:189165701-189165723 GCTGCTCACTGCACTGGGGGTGG + Intronic
967852828 3:194094977-194094999 GTGGCTAACCAGGCTGGGTGTGG - Intergenic
968248572 3:197181857-197181879 GCTCTGAACCAAACTGGGTGGGG + Intronic
968461717 4:729485-729507 GCTGCTGACCACACATGGCGTGG - Intronic
968915184 4:3494161-3494183 CCTGCTGACCCCACTGGGAGAGG + Exonic
969937881 4:10700720-10700742 GCTGCTAACAAGCATGGGTGGGG + Intergenic
970635993 4:18009921-18009943 GTAGGTATCCACACTGGGTGGGG - Intronic
971356995 4:25904023-25904045 GGTGCCACCCACACTGTGTGAGG + Intronic
980676053 4:136082903-136082925 GCTTCTAAGCACATTAGGTGGGG - Intergenic
985415000 4:189726940-189726962 GCAGGTAACCATACTTGGTGAGG - Intergenic
986587345 5:9332295-9332317 GCTGCTACTCACATTGGGTCAGG + Intronic
986587381 5:9332565-9332587 GCTGCTACTCACATTGGGTCAGG + Intronic
986587386 5:9332610-9332632 GCTGCTACTCACATTGGGTCAGG + Intronic
997510062 5:134447911-134447933 GCTGGGAGGCACACTGGGTGGGG + Intergenic
1001605241 5:172955024-172955046 GTTGCAAACAACACTGGTTGGGG + Intergenic
1004600960 6:17149639-17149661 GCTGGTCACCAAAATGGGTGAGG + Intergenic
1005893665 6:30160579-30160601 GCTGGTGTCCACACTGGGTTTGG - Exonic
1006269180 6:32950803-32950825 GCTGCAAAGGACACAGGGTGAGG + Exonic
1007649483 6:43409534-43409556 GCACATAAGCACACTGGGTGTGG + Intergenic
1007995744 6:46306061-46306083 GCTGTGTAGCACACTGGGTGTGG - Intronic
1012356038 6:98315754-98315776 GCTGCTAGCCACAGAGGGTCTGG + Intergenic
1016089504 6:139959494-139959516 ACTCCTAACCACACCGGGCGCGG + Intergenic
1017234807 6:152108303-152108325 GTTGCTGACCAAACTGGGGGAGG + Intronic
1020261957 7:6535841-6535863 GGTGCTAGCCATACAGGGTGAGG - Intronic
1024946655 7:54814649-54814671 GCTGCCAACCACCCTGTCTGTGG - Intergenic
1026928513 7:74210143-74210165 GCTCCTGGCCCCACTGGGTGGGG + Intronic
1029757913 7:102584518-102584540 GCTGCTGCCCACAGAGGGTGGGG - Intronic
1031963016 7:128006661-128006683 CCTGGTGACCACACTGGGTGTGG - Intronic
1034873149 7:154701290-154701312 GCTGATAACCACGCAGGCTGTGG + Intronic
1034946709 7:155267059-155267081 GGTGCTGACCACACTGCGGGGGG - Intergenic
1040662690 8:49594421-49594443 GCTGCTAAGAACAATGGCTGAGG + Intergenic
1041220650 8:55648148-55648170 GCTGGAAACTACAGTGGGTGTGG + Intergenic
1049454971 8:142682148-142682170 GCTGCAGCCCACACTGGGTGTGG + Exonic
1055082629 9:72281983-72282005 GGTTCTAGCCACATTGGGTGAGG - Intergenic
1056094927 9:83243083-83243105 GCTGCCGAGCCCACTGGGTGGGG + Intronic
1060052147 9:120385183-120385205 CTTGCTGACCACACTAGGTGTGG + Intergenic
1061178184 9:129009632-129009654 GCTGGAACCCACTCTGGGTGCGG - Intronic
1061312590 9:129773868-129773890 GGTGCTGACCTCACCGGGTGCGG - Intergenic
1062564397 9:137157498-137157520 GCTGCCAGCCACACAGGGAGAGG - Intronic
1062691448 9:137844126-137844148 ACTGTTAACCAGACTGGGTGTGG - Intronic
1195875613 X:109537188-109537210 ACTGCTAACCAGGCTGGGGGTGG - Intronic
1199695126 X:150338569-150338591 GCTGATACCCACACTGAGAGAGG - Intergenic