ID: 961925384

View in Genome Browser
Species Human (GRCh38)
Location 3:130473956-130473978
Sequence ACTGCTTGAGACCATCATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 108}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961925384 Original CRISPR ACTGCTTGAGACCATCATTG TGG (reversed) Intronic
903330742 1:22595898-22595920 AGTGCTTGTGACCATCATGGCGG + Intronic
905314613 1:37074026-37074048 ACTGCATGTCACCATCAGTGGGG - Intergenic
906841484 1:49144315-49144337 ACTGAGTGAGCCCATCATTGAGG + Intronic
907358998 1:53899759-53899781 ACTGCTTGAGCCCAGGAATGAGG - Intronic
907933489 1:59021160-59021182 ACTGCTTGAGACCAGAAGTTTGG - Intergenic
910951623 1:92654035-92654057 TCTGCTTGTGCTCATCATTGGGG + Intronic
911229084 1:95341041-95341063 ACTTCATGAGACACTCATTGAGG - Intergenic
917301304 1:173577201-173577223 CCTGCTGGAGACCATCACTGAGG + Intronic
917767775 1:178242511-178242533 ACTGCTTGAGCCCAGGAGTGGGG - Intronic
918125591 1:181580677-181580699 ACTGGGTGATCCCATCATTGGGG - Exonic
918377456 1:183923465-183923487 ACAACTTGAGACCATCTTTTAGG - Intronic
920176270 1:204103916-204103938 ACTGCTTGAAAGCGCCATTGAGG - Intronic
922665377 1:227464597-227464619 ACTGCTTGGGGCCAGCACTGGGG - Intergenic
1062831686 10:609969-609991 GCTGCTTGAGAACATCAAAGTGG + Intronic
1063060497 10:2546234-2546256 TCTTCTTGATACCATCATTTTGG + Intergenic
1064383781 10:14872215-14872237 ACTGCTTGAGACCAGCAGTTTGG - Intergenic
1066442944 10:35455902-35455924 ACTGCTTGAGCCCAGGATTTTGG - Intronic
1067781571 10:49211259-49211281 ACTGCTTGAGACCAGGAGTTTGG + Intergenic
1067858291 10:49817155-49817177 AAAGGTGGAGACCATCATTGTGG - Intergenic
1070070490 10:73084532-73084554 ACTGCTTGAGACTAGCCTGGAGG - Intronic
1074497274 10:113991216-113991238 ACTGCTGAAAACCATAATTGTGG + Intergenic
1077674325 11:4183443-4183465 ACAGGTTGAGAGCATCGTTGAGG - Intergenic
1077998548 11:7474761-7474783 ACTGCTTGTGCCCAGCACTGAGG + Intergenic
1079270901 11:18984909-18984931 ACTACTTGAGACCGTCATTACGG - Intergenic
1079587529 11:22144425-22144447 TCTGATTGAGACCATTATTAAGG + Intergenic
1090986713 11:131773326-131773348 ACTGCTTAATACCATTATTTTGG + Intronic
1104533408 12:129594598-129594620 ACTGCTTGCTACCATCATTTTGG - Intronic
1106901577 13:34359438-34359460 ACTGAATGAGACCATCCTTCAGG + Intergenic
1108855777 13:54791115-54791137 ATGGCTTGATACCATCCTTGTGG - Intergenic
1115210062 14:30958225-30958247 ACTGCTTGAGCCCAGGAGTGAGG + Intronic
1115367535 14:32575455-32575477 ACTGATTGACAACATCATTGAGG - Intronic
1118533198 14:66729920-66729942 ACTGCTTTATACAATCATAGTGG - Intronic
1119181121 14:72605885-72605907 ACAGTTTGAAACCATCTTTGGGG - Intergenic
1119748290 14:77059844-77059866 ACTGTGTGTGACCATCATGGAGG + Intergenic
1126758214 15:51945194-51945216 ACTGCTTGAGCCCATGAATTCGG + Intronic
1127346376 15:58104780-58104802 GCTGCTTTTTACCATCATTGTGG + Intronic
1127412844 15:58726777-58726799 ACTGCTTGAGCCCAAGTTTGGGG + Intronic
1130856242 15:87842115-87842137 GCTCCTTGAGGCCATCATTGGGG - Intergenic
1132736212 16:1387407-1387429 CCTGCTTCAGACCCTCAGTGTGG + Intronic
1138700417 16:58856850-58856872 CCCGCTTGAGATCATCACTGTGG - Intergenic
1140594535 16:76393407-76393429 ATTGCTTAAGACTATCATTTTGG + Intronic
1140654740 16:77127965-77127987 AATGATTGAGCCCATCATTCAGG - Intergenic
1146947303 17:36882763-36882785 AGTGCTTCAGACCAGCCTTGAGG - Intergenic
1149879294 17:60272033-60272055 ACTGCTTGAGACCAGGAGTTTGG - Intronic
1151132517 17:71912325-71912347 ACTCCTTGAGATAATCAATGGGG - Intergenic
1155149447 18:23111402-23111424 ACATCTTGAAACGATCATTGTGG + Intergenic
1156805947 18:41181798-41181820 ACTACTTGAGACCGTCATTACGG - Intergenic
1157096726 18:44692291-44692313 ACTTCTTGAAACAATCCTTGAGG + Intronic
1157767228 18:50308722-50308744 ACTACTTGAGACCGTCAGTGGGG + Intergenic
1158369610 18:56785274-56785296 AATGTTTGAGATGATCATTGTGG + Intronic
1158605091 18:58888944-58888966 AATGCTTGGGACCAGCATTTAGG + Intronic
1161310075 19:3589134-3589156 ACTGCTTGGGACCCTCCTTGTGG - Intronic
1161490456 19:4558241-4558263 ACTGCTTGAGTCCCCCAGTGGGG + Intronic
925436915 2:3846339-3846361 GATGCTTGAGACTGTCATTGTGG - Intronic
925595003 2:5546593-5546615 ACTTCTTGAGACCTCCAATGAGG - Intergenic
928688479 2:33775071-33775093 ACTTCTTGCTGCCATCATTGTGG + Intergenic
929323593 2:40577828-40577850 ACTGGTTGAGACAATCCTTTAGG + Intronic
935525517 2:104162125-104162147 CCTGCTTGAGATTATAATTGGGG + Intergenic
937981392 2:127618188-127618210 ACTACTTGAGATCGTCATTACGG + Intronic
942094300 2:172523174-172523196 ACTGCTTGGGACCTACAGTGGGG + Intergenic
942229656 2:173848513-173848535 AATGCTTGGTACCATCCTTGTGG - Intergenic
943502372 2:188707940-188707962 AATGTTTGAGACCATTTTTGAGG + Intergenic
945408155 2:209476166-209476188 CCTTCTCGAGACCATGATTGTGG + Intronic
946508065 2:220322924-220322946 ACGGCATGAGACGATCATTCAGG + Intergenic
947238766 2:227971779-227971801 ACTGTTTGAGAGCATCCCTGGGG - Intergenic
1173089747 20:39959115-39959137 ACTGCCTCAGAGCTTCATTGTGG - Intergenic
1174642839 20:52059993-52060015 ATTGCTTGAGACCAGGAGTGAGG + Intronic
1177498462 21:21918942-21918964 ACTTCTTAACACCATCATAGTGG + Intergenic
1178189689 21:30266111-30266133 ACTACTTGAGACTATCACTACGG - Intergenic
1181614809 22:24046484-24046506 ACAGTTTGGGACCATCTTTGGGG + Intronic
1182950629 22:34372368-34372390 TCTGATTGAGACCATTAATGTGG + Intergenic
950733379 3:14982148-14982170 ACTGCTTGAGCCCAAGAGTGAGG - Intronic
953710760 3:45268342-45268364 ACAGCTTGAGATCATCTTTAGGG - Intergenic
954032656 3:47830813-47830835 ACTGCTTGAGACCAGGAGTTTGG - Intronic
956210525 3:66797462-66797484 ACAGCTTGAGACAATCAATGTGG + Intergenic
956210691 3:66798567-66798589 ACAGCTTGAGACAGTCAGTGTGG + Intergenic
957119062 3:76065217-76065239 AATGCTTTAAACAATCATTGTGG + Intronic
959046835 3:101484356-101484378 ACAGCTTGAAATCATCATGGTGG + Intronic
961925384 3:130473956-130473978 ACTGCTTGAGACCATCATTGTGG - Intronic
962355286 3:134688774-134688796 AATGGCTGAGACCATCATTTTGG + Intronic
963546071 3:146659885-146659907 CCTGCTTGAGAAAATAATTGAGG + Intergenic
964035968 3:152196513-152196535 AATACTTGAGACCCTAATTGGGG + Intergenic
965411550 3:168338024-168338046 ACTACTCGGGATCATCATTGGGG - Intergenic
967268782 3:187715719-187715741 GCTGGATGAGACCATCAGTGGGG + Exonic
969600396 4:8172653-8172675 ACTGCTTGGGACCCTCATTAGGG - Intergenic
971111950 4:23595308-23595330 ACTGCTAGACACCATAAATGTGG + Intergenic
971989650 4:33875716-33875738 ACTGCTGGAGACCATCATTTAGG + Intergenic
974511874 4:62853829-62853851 ACTGCTGGAGAAAACCATTGAGG + Intergenic
976349520 4:84044949-84044971 CCTGCATGAGGACATCATTGGGG + Intergenic
977518486 4:98051762-98051784 ATTGCTTGAGAGCATCATAGAGG + Intronic
978479552 4:109173800-109173822 AATGCTTGAGACCATCAGTGAGG + Intronic
980610744 4:135159216-135159238 ATTGCTTGAAACCATCACTTTGG - Intergenic
983168732 4:164511700-164511722 AAGGCTTGAGAACATCATTGTGG + Intergenic
989785449 5:45322465-45322487 AATGCTTGAGACCAGAAATGTGG + Intronic
991430218 5:66536842-66536864 CCAGCCTGAGACCATCACTGAGG + Intergenic
1003803584 6:9700078-9700100 ACTACTTGAGACTGTCATTACGG + Intronic
1012586726 6:100932660-100932682 GCTGATTAAGACCATCACTGGGG + Intergenic
1016136760 6:140554177-140554199 CTTGTTTGAGACCATCATGGTGG - Intergenic
1017186986 6:151611580-151611602 ACTTCTTAATATCATCATTGTGG + Intronic
1021074114 7:16279594-16279616 AATGCTACAGAACATCATTGTGG + Intronic
1022599132 7:31739831-31739853 GCTGTTTGAGACCACCATTTTGG - Intergenic
1023610720 7:41967765-41967787 AATGGTTGAGTCCATGATTGGGG + Exonic
1031720786 7:125173076-125173098 ATTGCTTGAAATCAACATTGAGG - Intergenic
1035919649 8:3663098-3663120 ACTGCTTCAGGTCTTCATTGCGG - Intronic
1036285956 8:7444338-7444360 AGTGCTTGTGACAATCACTGTGG - Intronic
1036335517 8:7867191-7867213 AGTGCTTGTGACAATCACTGTGG + Intronic
1038403584 8:27305358-27305380 ACTGCTGGAGGCCATCACTCAGG + Intronic
1039613049 8:38934218-38934240 ACTGCTTGAGACCAGGACTCTGG - Intronic
1043681919 8:83038989-83039011 ACTGCTTGAGCCCAGGATTTTGG - Intergenic
1043851867 8:85225099-85225121 AGTGCTTGAGACTATCCCTGTGG + Intronic
1045400242 8:101808710-101808732 ACTGCTTGGGACCATGAGTATGG + Intronic
1046185977 8:110718888-110718910 GCTGCTTTAGGTCATCATTGTGG + Intergenic
1048369869 8:133767926-133767948 ACAACTTGAGCCAATCATTGTGG - Intergenic
1049823794 8:144654282-144654304 ACTGCTTGAGCCCAGGAGTGTGG + Intergenic
1050951434 9:11600714-11600736 ATTGCTTGATACCAGCAGTGGGG + Intergenic
1052393261 9:27906308-27906330 ACTGCTTAAGATCATGAATGAGG - Intergenic
1055311260 9:74983753-74983775 ATCACTTGAGACCATTATTGTGG + Exonic
1055425679 9:76193812-76193834 CATGCTTGAGTCCACCATTGGGG + Intronic
1055500297 9:76896243-76896265 AATGCTAGCTACCATCATTGAGG - Intronic
1058987621 9:110223032-110223054 ACTGCTTGAGCCCAGGAGTGTGG + Intergenic
1060284559 9:122237514-122237536 ACTGCTTAAGGCTATCAATGTGG - Intergenic
1187458596 X:19465400-19465422 GCAGCTGGAGACCATCCTTGTGG + Intronic
1192429186 X:71101127-71101149 ACAGCTCTAGACCTTCATTGAGG - Exonic
1196162257 X:112498991-112499013 ACTGCTTGAGACAATTTTTAAGG + Intergenic
1198156731 X:133968071-133968093 ACAGGTTGATACAATCATTGAGG + Intronic
1201910820 Y:19132084-19132106 ACTGCTTGACAACATCCTGGAGG - Intergenic