ID: 961935333

View in Genome Browser
Species Human (GRCh38)
Location 3:130576850-130576872
Sequence CAAGGAAATCAGACAGTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 405
Summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 368}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961935329_961935333 7 Left 961935329 3:130576820-130576842 CCAGTTCTTTTTAAACTATAAAT 0: 1
1: 2
2: 4
3: 73
4: 741
Right 961935333 3:130576850-130576872 CAAGGAAATCAGACAGTAGCTGG 0: 1
1: 0
2: 4
3: 32
4: 368

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961935333 Original CRISPR CAAGGAAATCAGACAGTAGC TGG Intronic
900456495 1:2777457-2777479 CCAGGAATTCAGACACTAACCGG - Intronic
901117302 1:6857537-6857559 CAAAGAAGCCAGAAAGTAGCAGG + Intronic
902142480 1:14368184-14368206 CAAGGAAAGAAAACAGGAGCAGG + Intergenic
902191453 1:14766097-14766119 AGAGGAAAACAGACAGTAGGGGG + Intronic
902919108 1:19656121-19656143 CAAGGAAATCAGAGTCTAGTGGG - Intronic
905841202 1:41180362-41180384 CAGGGCAATCAGACAGGAGAAGG + Intronic
906047986 1:42847111-42847133 CAAGGAAGTCAGAGGGTCGCAGG - Intronic
906295652 1:44647487-44647509 CCAGGGAATCAGCCAGTACCAGG + Intronic
906852048 1:49261306-49261328 CAAGGAAATTAGGCAGGAGAAGG + Intronic
908482663 1:64557675-64557697 CAAAGAAATTAGACAGCAGTTGG - Intronic
909372447 1:74899681-74899703 CAAGGCAATCAGGCAGGAGAAGG - Intergenic
909676629 1:78245543-78245565 CAGGGCAATCAGACAGGAGAAGG - Intergenic
910433534 1:87181937-87181959 CAAGGAGATGAGACAGGAGTAGG - Intergenic
910488135 1:87738349-87738371 GAAGGAGATCAGAAAGGAGCTGG + Intergenic
910924405 1:92383758-92383780 CAGGGAAATCAGGCAGGAGAAGG - Intronic
911873822 1:103133446-103133468 CAGGGAAATCAGGCAGGAGAAGG + Intergenic
912405463 1:109434109-109434131 CCAGGAAAGCAGCCAGGAGCAGG - Intergenic
913024358 1:114821280-114821302 CAAGGAAATCCCAGAGAAGCAGG + Intergenic
914907213 1:151756473-151756495 CAAGGAAATGAGTCATTATCAGG + Intergenic
916505563 1:165425356-165425378 CATGGCAATCACACAATAGCAGG - Intronic
916660299 1:166917311-166917333 CAATGAAATAAGAAAGTGGCTGG - Exonic
916677379 1:167075279-167075301 CAAGGAAATCAGGCAAGAGTTGG + Intronic
916855659 1:168746642-168746664 CAAGGCAATCAGGCAGGAGAAGG - Intergenic
917836039 1:178942256-178942278 CGAGGAAGTCAGACAGCAGTGGG - Intergenic
920194188 1:204215376-204215398 CAAGAAAATGAAAGAGTAGCAGG + Intergenic
920267734 1:204736955-204736977 CAAGAGAACCAGACTGTAGCAGG + Intergenic
921244087 1:213218021-213218043 CAAGGCAATCAGGCAGGAGAAGG + Intronic
921344838 1:214172465-214172487 CAAGGAAAGCAAACATTTGCAGG - Intergenic
922151857 1:223013130-223013152 CCAGTAACTGAGACAGTAGCTGG - Intergenic
922342376 1:224668417-224668439 AAAGCAAGGCAGACAGTAGCTGG - Intronic
924496492 1:244595468-244595490 CAAGTAAAACAGACAGTTGGAGG + Intronic
924606277 1:245538308-245538330 CAAGGAAGTAGAACAGTAGCTGG + Intronic
1064057631 10:12111114-12111136 CAAGAAAATGAGACAGTAGCTGG + Intronic
1064900767 10:20293405-20293427 CAAGGAAATTAGGCAGGAGAAGG - Intergenic
1066750596 10:38652511-38652533 CAAGAAAATAAGAAATTAGCCGG + Intergenic
1067135317 10:43602444-43602466 CAAGGAGTTCAGACAGTCGAGGG + Intergenic
1067144444 10:43684022-43684044 CAAGCAAATGACTCAGTAGCAGG + Intergenic
1067383274 10:45794837-45794859 CAAAGAAAACAGAAAGAAGCTGG - Intergenic
1067890980 10:50135385-50135407 CAAAGAAAACAGAAAGAAGCTGG - Intergenic
1070756825 10:78998500-78998522 AGAGGAAATCAGAAAGTGGCAGG + Intergenic
1071586727 10:86830200-86830222 CAAGGTGATCAGACATCAGCTGG + Intronic
1072311607 10:94161649-94161671 CAGGGTAATCAGACAGGAGAAGG - Intronic
1072408270 10:95175240-95175262 CAAGGCAATCAGGCAGGAGAAGG - Intergenic
1073531548 10:104237150-104237172 CAAGGTAATCAGACATCACCTGG - Intronic
1075236849 10:120738359-120738381 AATGGAAATCAAACAGTACCTGG - Intergenic
1077683227 11:4266505-4266527 CAGGGAAATCAGGCAGGAGAAGG + Intergenic
1077686808 11:4300256-4300278 CAGGGAAATCAGGCAGGAGAAGG - Intergenic
1077691967 11:4351446-4351468 CAGGGAAATCAGGCAGGAGAAGG - Intergenic
1077710906 11:4535885-4535907 CAGGGAAATCAGGCAGGAGAAGG + Intergenic
1077880119 11:6342553-6342575 CAAGGAAAGCAGAATGGAGCAGG - Intergenic
1078419389 11:11196469-11196491 CAAGGCAATCAGGCAGGAGAAGG - Intergenic
1078889651 11:15542934-15542956 CAAGGAAGTCAGTAGGTAGCTGG + Intergenic
1079137162 11:17782043-17782065 CAGGGTAATCATACAGTTGCAGG - Exonic
1080083038 11:28244196-28244218 CAAGGAAATCAGATTGCAGAAGG + Intronic
1080169994 11:29289089-29289111 CAGGGAAATCAGGCAGGAGAAGG + Intergenic
1080181076 11:29426775-29426797 CAAGATAAGCAGACGGTAGCAGG + Intergenic
1080398160 11:31908972-31908994 CAGGGAAATCAGGCAGGAGAAGG + Intronic
1082102811 11:48187744-48187766 CAAGGCAATCAGGCAGGAGAAGG - Intergenic
1082124097 11:48412048-48412070 CAGGGAAATCAGGCAGGAGAAGG - Intergenic
1082137261 11:48563570-48563592 CAGGGCAATCAGGCAGTAGAAGG - Intergenic
1082140193 11:48599949-48599971 CAGGGCAATCAGACAGGAGAAGG + Intergenic
1082150945 11:48738025-48738047 CAGGGAAATCAGGCAGGAGAAGG + Intergenic
1082618370 11:55390620-55390642 CCAGGAATTCAGGCAGTTGCTGG + Intergenic
1082620337 11:55412843-55412865 CTAGGAATTCAGGCAGTTGCTGG + Intergenic
1085077370 11:73603416-73603438 CAAGTTAATCAGATAGTAACAGG - Intergenic
1086738654 11:90339817-90339839 TAAGAAAATCAGATAGTAGATGG + Intergenic
1088379663 11:109179491-109179513 CAGGGAAATCAGGCAGGAGAAGG - Intergenic
1089389022 11:118087331-118087353 CAAGGGAGGCAGACAGGAGCTGG + Intronic
1092010529 12:5106956-5106978 CTAGGAAATCTGCCAGTAGCAGG - Intergenic
1092214531 12:6671920-6671942 AAATAAAATCAGACATTAGCTGG - Intronic
1092796586 12:12115981-12116003 CAAGAAATTAAGACAGTAGCTGG - Intronic
1094087754 12:26612430-26612452 CAATGGAAACAGCCAGTAGCAGG - Intronic
1094264752 12:28544031-28544053 CGTGGAAAACAGACTGTAGCGGG - Intronic
1094579469 12:31721143-31721165 CAATCAAATCAGACTGTCGCAGG - Intronic
1094728119 12:33143758-33143780 CAGGGCAATCAGACAGGAGAAGG - Intergenic
1096226163 12:49868137-49868159 CAAGGCTATCTGACAGTGGCAGG + Exonic
1096579375 12:52574604-52574626 CTAGGAAGTCAGGCAGGAGCTGG + Intergenic
1097072394 12:56364674-56364696 CAAGGAAACCAGAAAGTTGATGG + Intergenic
1097299491 12:58003188-58003210 CAAGGAAGTCATCCAGTACCAGG + Intergenic
1097589869 12:61561567-61561589 GAAAGAAATGAAACAGTAGCTGG + Intergenic
1097963042 12:65551408-65551430 CAGGGCAATCAGACAGGAGAAGG - Intergenic
1098034505 12:66288356-66288378 CAAGGAAATGAGAAGGTAGCTGG + Intergenic
1098491101 12:71079851-71079873 CAAGGAAATCAGGAAGTATTAGG - Intronic
1098657189 12:73046982-73047004 AAAGGTAAACAGACAGTAACTGG - Intergenic
1099312886 12:81049853-81049875 CAAGGCAATCAGGCAGGAGAAGG - Intronic
1099702090 12:86097903-86097925 CTTGGAAATGAGACATTAGCTGG - Intronic
1100424191 12:94467566-94467588 GAATGAATTCAGAAAGTAGCAGG + Intergenic
1101347248 12:103897557-103897579 CAAGGAAACGAGACAGTGGGTGG - Intergenic
1101503713 12:105327827-105327849 TAAAGAAATCAGACATTGGCCGG - Intronic
1102589374 12:113945944-113945966 CAGGGAGATCAGACCGCAGCTGG + Intronic
1102649159 12:114425082-114425104 AAAGGAAATCAAACAGTACAGGG + Intergenic
1103219158 12:119229161-119229183 GAAGGAAGTCAGAGAGTATCAGG + Intergenic
1103405308 12:120670914-120670936 CAAGGAGTTCAGACTCTAGCAGG + Intergenic
1103451203 12:121030532-121030554 CAAGGGAATCAGACAGCAGAAGG - Intronic
1104512669 12:129394746-129394768 CAATGAAATCATACAGTATGTGG - Intronic
1104706255 12:130949721-130949743 AAAGGAAAGCCGACAGGAGCCGG + Intergenic
1105521909 13:21138925-21138947 CTAGGAACTCTGACAGTAGCAGG - Intergenic
1106321189 13:28641015-28641037 CAAGGAAATCAGACTGCTTCTGG + Intergenic
1107689330 13:42936277-42936299 CAATGAAATGAGGCAGTAACTGG - Intronic
1109013937 13:56983780-56983802 CAGGGCAATCAGGCAGCAGCAGG + Intergenic
1109586763 13:64414539-64414561 CAAGGCAATCAGTCAGTAGATGG + Intergenic
1110769027 13:79315527-79315549 CATGGAAATCAGACAGTGCCTGG + Intronic
1111104035 13:83622498-83622520 CAAGCAAACTAGACAGGAGCTGG - Intergenic
1112006845 13:95260815-95260837 CAAGGAAATCAGTCAGGAATTGG + Intronic
1112609357 13:100940745-100940767 CAGGGGAATCAGTCAGTACCAGG - Intergenic
1113421908 13:110177616-110177638 CAAGCAAATCAGAAAGAAGCTGG - Intronic
1113784102 13:112993435-112993457 CAAGGAAATCAGGGAGCAGGTGG + Intronic
1114595797 14:23910677-23910699 CAGAGAAATCACACAGTTGCTGG + Intergenic
1114807393 14:25853933-25853955 CAGGGCAATCAGGCAGTAGAAGG - Intergenic
1114926762 14:27411284-27411306 CAAGGCAATCCGCCAGTGGCAGG + Intergenic
1115070197 14:29312993-29313015 AAAGCAAATCAGATAGCAGCAGG + Intergenic
1115186876 14:30698754-30698776 CAAGGAAATGGGAAAGTACCAGG + Intronic
1115830035 14:37327447-37327469 CAAAAAAATCAAAAAGTAGCCGG - Intronic
1116716892 14:48439041-48439063 CAGGGCAATCAGACAGGAGATGG - Intergenic
1117069961 14:52047553-52047575 ACAGTAAATCAGACAGGAGCTGG + Intronic
1117213671 14:53527672-53527694 CAATGAAATCAGTCAGCAGCAGG + Intergenic
1119563722 14:75611183-75611205 CAAAGAAACCAAACTGTAGCTGG + Intronic
1120128893 14:80781611-80781633 AAAGGAAATCAGAGAGTATCCGG + Intronic
1120931326 14:89851515-89851537 CAAGGAAAACAGACACTATAGGG + Intronic
1123174804 14:106406555-106406577 CAGGGCAATGAGACAGTAGAAGG - Intergenic
1202854884 14_GL000225v1_random:43908-43930 CAAGGAGCTCATACAGCAGCAGG - Intergenic
1123822750 15:24047336-24047358 CAGGGAAATCAGGCAGGAGAAGG + Intergenic
1124060710 15:26291435-26291457 CAAGGAAAGCAGAGGTTAGCAGG - Intergenic
1124557708 15:30742567-30742589 CAAGGAAATCAGACAGGATTTGG + Intronic
1124569621 15:30850598-30850620 CAGGGAAATCAGGCAGGAGAAGG - Intergenic
1124673532 15:31663093-31663115 CAAGGAAATCGGACAGGATTTGG - Intronic
1125118949 15:36129883-36129905 CAAGGAAACCAGACGCTAGCTGG + Intergenic
1125369211 15:38952310-38952332 CAAAGAAGTTAGACTGTAGCTGG - Intergenic
1125975158 15:43944736-43944758 CAAGGAACCCAGCCGGTAGCGGG - Intronic
1127434068 15:58938977-58938999 AAAGGAAATCAGAAGATAGCAGG + Intronic
1127441150 15:59009656-59009678 CAAGGAAATTATTCAGTGGCCGG + Intronic
1128659545 15:69488184-69488206 CAGGGAGCTCAGAGAGTAGCAGG + Intergenic
1130075248 15:80683320-80683342 CAAGAGAGTCAGACAGAAGCTGG + Intronic
1130099030 15:80877979-80878001 AGAGGAAATCAGACTGTAACTGG + Intronic
1130741845 15:86609274-86609296 CAAGAAAATCAGAAAGGAGGAGG + Intronic
1134210449 16:12272046-12272068 CAAGGAAGTCAGGTAGTTGCAGG + Intronic
1135799459 16:25479118-25479140 CAAGCAAAACACACAGAAGCTGG + Intergenic
1135847196 16:25929489-25929511 CAAGGGATCCAGACAGTAGTGGG - Intronic
1137019691 16:35412791-35412813 CAAGGAAATCAAACATCAACAGG + Intergenic
1137278156 16:46951184-46951206 CCTGGACATCAGTCAGTAGCTGG - Intergenic
1138891715 16:61150673-61150695 CAAGGAGAGCAGAGAGGAGCAGG - Intergenic
1138960219 16:62020266-62020288 CAAGAAAATCAGTCATTGGCAGG + Intronic
1141297797 16:82785945-82785967 CAGGGGAACCACACAGTAGCAGG - Intronic
1143305343 17:5942052-5942074 CAAGGGAATCAGAAAGCTGCTGG - Intronic
1145842361 17:28006475-28006497 AAAAGAAATGAGGCAGTAGCTGG + Intergenic
1146405300 17:32531426-32531448 GAAGGAACTCAGAGAGTTGCAGG - Intronic
1147927790 17:43955917-43955939 CAAGGATACCAGAGAGTAGGGGG + Intronic
1148770596 17:50063901-50063923 CAAGGAAAAAAGACACTAGAAGG - Intronic
1149086114 17:52718286-52718308 CAAGGAAATAAGGGAGTAACAGG + Intergenic
1155310061 18:24514719-24514741 TAAGGAAATCACTCAGTAGAAGG - Intergenic
1155803801 18:30141554-30141576 TAAGGAAATGACACAGCAGCAGG - Intergenic
1156070231 18:33198059-33198081 CAAATAAATCAGACAGTGGGAGG + Intronic
1156660819 18:39344392-39344414 AAGAGAAATGAGACAGTAGCTGG + Intergenic
1158153714 18:54401725-54401747 CAGGGCAATCAGACAGGAGAAGG - Intergenic
1158176776 18:54666183-54666205 CAGGGCAATCAGACAGGAGAAGG - Intergenic
1158636079 18:59159415-59159437 CCAGCACATCAGACAGTGGCTGG - Intergenic
1158878428 18:61753838-61753860 CAAAGAAAGCAAACATTAGCTGG - Intergenic
1158999956 18:62964627-62964649 CATGGAAATGAGGGAGTAGCTGG - Intronic
1160610552 18:80081593-80081615 GAAGGAAATCTGAGTGTAGCTGG + Intronic
1160682015 19:416234-416256 CCAGGACATCAGACAAGAGCTGG - Intergenic
1161646041 19:5454019-5454041 GAAGGGAAGGAGACAGTAGCGGG + Intergenic
1163321931 19:16579794-16579816 CAAGGAAATGCTACAGTGGCTGG - Intronic
1163332118 19:16646326-16646348 CAAGCAAATCACACAGTTGTGGG + Exonic
1164420917 19:28091770-28091792 CAGGGCAATCAGGCAGTAGAAGG + Intergenic
1165095894 19:33409837-33409859 CAAGGAACTCAGACACAAGGAGG - Intronic
1168454726 19:56497394-56497416 AAAGGAAATCTGACAGCACCGGG + Intergenic
925196102 2:1927145-1927167 CACGGAAATCAGAGAAGAGCTGG + Intronic
925226596 2:2188883-2188905 TAGGGAAATCAGACTGTGGCAGG - Intronic
926192843 2:10741536-10741558 CAAGGTACTCTGACAGTGGCCGG + Intronic
927080273 2:19621177-19621199 CAAAGCAATCAGACAATAGAAGG + Intergenic
928063426 2:28138184-28138206 CAAAGAAATCAGAAAGTAGATGG + Intronic
930911304 2:56633232-56633254 CAGGGAAATCAGGCAGGAGAAGG - Intergenic
932520599 2:72407862-72407884 CAGGGCAATCAGACAGGAGAAGG + Intronic
933023458 2:77223356-77223378 CAGGGCAATCAGGCAGTAGAAGG + Intronic
934513841 2:94971648-94971670 CATGGACATCAGAAAGCAGCAGG - Intergenic
935599052 2:104903691-104903713 AAAGGAAGTCAGGCAGTGGCAGG + Intergenic
936335897 2:111589611-111589633 CAGGGAAATCAGGCAGGAGAAGG + Intergenic
936465153 2:112741515-112741537 GAAGGAAATCAGACTGTGCCAGG + Intronic
940388705 2:153105520-153105542 CAGGGAAATCAGGCAGGAGAAGG + Intergenic
940441700 2:153723451-153723473 CAGGGAAATCAGGCAGGAGAAGG + Intergenic
940474874 2:154149921-154149943 CAGGGAAATCAGGCAGGAGAAGG - Intronic
941623603 2:167806322-167806344 CAGGGCAATCAGACAGGAGAAGG - Intergenic
942200297 2:173564062-173564084 CAGGGAAATCAGACAAGAGAAGG + Intergenic
942262334 2:174181334-174181356 CAAAGAAATGAAACAGTAGCTGG + Intronic
943703286 2:191009901-191009923 CATGGAAATCAGACAGTACCTGG - Exonic
943915913 2:193632291-193632313 CAGGGAAATCAGGCAGGAGAAGG + Intergenic
944270438 2:197778831-197778853 CAAGGAAATCAAAAGGTAGGAGG + Intronic
945252955 2:207779695-207779717 CAAAGAAAACAAACATTAGCCGG - Intergenic
945586410 2:211669465-211669487 CTGGGAAATCAGACAGTTTCAGG - Intronic
946476177 2:220008677-220008699 CAAGCAAATCAGAAAGTGGTGGG - Intergenic
946679233 2:222195722-222195744 CCAGGAGATCAGACAGTGGCTGG - Intergenic
947027945 2:225760093-225760115 CAAAGAAATAAGTCATTAGCTGG - Intergenic
947417806 2:229916332-229916354 TAAGGAAAACACACAGTAGCAGG + Intronic
948305447 2:236944002-236944024 CAAGGCATTCAGACATTAACTGG + Intergenic
1169471220 20:5887294-5887316 CAAGGAACTGAGACAGGAGAGGG + Intergenic
1170003127 20:11636788-11636810 CAAGGCAATCAGGCAGGAGAAGG + Intergenic
1170521464 20:17190200-17190222 CATGGAAGACAGACAGGAGCAGG - Intergenic
1170581259 20:17701197-17701219 AAAGGAAAAAAGACAGTAGAGGG + Intronic
1170948857 20:20915948-20915970 CAAGGAAAAGAGAGAGAAGCAGG - Intergenic
1170949601 20:20924752-20924774 CAAGGCAGTCAGTCATTAGCTGG - Intergenic
1171898362 20:30832328-30832350 CAGGGAAATCAGGCAGGAGAAGG - Intergenic
1171904003 20:30884872-30884894 CAGGGAAATCAGGCAGGAGAAGG - Intergenic
1173738458 20:45378374-45378396 CACTGAAATGTGACAGTAGCAGG + Exonic
1174687003 20:52465646-52465668 CAAGGAACACAGTCAGTAGTTGG + Intergenic
1174825339 20:53763450-53763472 CAAGGAGGTCAGGCAGTAACAGG - Intergenic
1176973670 21:15293300-15293322 CAAGAAAAACAGGCAGGAGCAGG + Intergenic
1177620158 21:23580184-23580206 GAAGGAAGTGAGACAGCAGCAGG + Intergenic
1177952779 21:27559649-27559671 AAAAGAAATCAGAGAGCAGCAGG + Intergenic
1179037984 21:37776341-37776363 CAGGGAAATCAGGCAGGAGAAGG - Intronic
1179396877 21:41048336-41048358 CAGAGAAATCAGGCAGAAGCAGG + Intergenic
1180337424 22:11591008-11591030 CAGGGAAATCAGGCAGGAGAAGG - Intergenic
1181300850 22:21880077-21880099 AAAGGAAATAATACAGTAACAGG + Intergenic
1182241103 22:28917099-28917121 CTAGGCAATCACACAGTGGCAGG - Intronic
1185194524 22:49460801-49460823 CAAGGAAATAGAACAGCAGCAGG - Intronic
1185217902 22:49613757-49613779 CCTGGAAATCAGCCAGGAGCAGG + Intronic
949308335 3:2668586-2668608 CAAGGCAATCAGGCAGGAGAAGG - Intronic
950004989 3:9685828-9685850 CAAGGAAAACAGGCACTAACAGG - Intronic
950095115 3:10324504-10324526 GAGGGAAGTCAGACAATAGCAGG - Exonic
950427965 3:12934881-12934903 GAAGGAACTCAGACAGATGCAGG - Intronic
950748918 3:15113418-15113440 GGAGGAAATCAGACAGGAGTGGG + Intergenic
951104942 3:18731827-18731849 CATGGAAAACAGACAGTACAGGG - Intergenic
952612693 3:35229946-35229968 CAGGGAAATCAGGCAGGAGAAGG + Intergenic
953146003 3:40275493-40275515 CAGGGCAATCAGACAGGAGAAGG + Intergenic
953286279 3:41612912-41612934 TAAGTACATCAGACAGAAGCTGG + Intronic
955535000 3:59913879-59913901 CAAGGAAATCAAGAAATAGCTGG - Intronic
956474213 3:69602132-69602154 CTATGAAAGCAGACAGTAGGAGG - Intergenic
956927857 3:74008754-74008776 CAAGGAAATCTTCCACTAGCAGG - Intergenic
958162602 3:89835857-89835879 CAGGGAAATCAGGCAGGAGAAGG + Intergenic
958726985 3:97917876-97917898 CAGGGAAATGAGACAGAATCTGG - Intronic
960365512 3:116766835-116766857 CAAAGAAATCAGATAGAAGATGG - Intronic
961121290 3:124373300-124373322 CCTGGACATCTGACAGTAGCTGG + Intronic
961935333 3:130576850-130576872 CAAGGAAATCAGACAGTAGCTGG + Intronic
962643884 3:137416729-137416751 CAAGGCAATCAGGCAGGAGAAGG + Intergenic
962667062 3:137664713-137664735 CAGGGCAATCAGACAGGAGAAGG + Intergenic
962697920 3:137969271-137969293 CAGGGCAATCAGACAGGAGAAGG + Intergenic
963282109 3:143394599-143394621 CAGGGCAATCAGACAGGAGAAGG + Intronic
963978862 3:151513618-151513640 CAGGGAAATCAGGCAGGAGAAGG + Intergenic
964926457 3:161963933-161963955 CAATGAAAGCAGCCAGGAGCGGG + Intergenic
965996356 3:174887107-174887129 AAAGGAAATCAGGCTGTAGAAGG - Intronic
967174610 3:186852000-186852022 CAAGCACATCACACAGCAGCAGG + Intronic
967335988 3:188345319-188345341 CACGGAAAGCAGAAGGTAGCCGG - Intronic
967579817 3:191138814-191138836 CAAAGAAATGGGAGAGTAGCTGG + Intergenic
971264323 4:25084742-25084764 CAAGGAAAGCAGCCAGCCGCTGG + Intergenic
972563710 4:40250907-40250929 GCAGGAAATCAGAGGGTAGCAGG + Intergenic
972618906 4:40726852-40726874 AAATGAAATCATACAGTAGATGG + Intergenic
972892451 4:43575570-43575592 CAGGGAAATCAGGCAGGAGAAGG + Intergenic
973116426 4:46465786-46465808 CAGGGCAATCAGACAGGAGAAGG - Intronic
973312726 4:48726970-48726992 CAAGAAAATCTGACAGGGGCAGG + Intronic
973859313 4:55045415-55045437 CAGGGAAATCAGGCAGGAGAAGG + Intergenic
973860483 4:55059770-55059792 CAGGGAAATCAGGCAGGAGAAGG + Intergenic
973977204 4:56274031-56274053 CAAGGAAAAGAGTCAGTATCAGG - Intronic
974315256 4:60271023-60271045 CAGGGAAATCAGGCAGGAGAAGG - Intergenic
975455244 4:74582661-74582683 CAAGGAATTCAGGCAGTAGATGG + Intergenic
975520669 4:75297644-75297666 CAGGGAAATCAGGCAGGAGGAGG - Intergenic
975529094 4:75382254-75382276 CAGGGAAATCAGGCAGGAGAAGG + Intergenic
975529939 4:75389760-75389782 CAGGGAAATCAGGCAGGAGAAGG - Intergenic
976620757 4:87125063-87125085 CAAGAAAATCAGACTGGAGAAGG + Exonic
977496737 4:97784091-97784113 AAAGGAAATCAGAAAGTATCTGG + Intronic
977767520 4:100817402-100817424 CAAGGAAATCAGGGAATTGCGGG - Intronic
977933238 4:102771588-102771610 CAAGGAAATCAGGGAGGAGGGGG + Intergenic
978004472 4:103599448-103599470 CAGGGCAATCAGACAGGAGAAGG - Intronic
979235993 4:118400987-118401009 CAAGCAGGTCATACAGTAGCAGG - Intergenic
979976433 4:127201980-127202002 CAAGGCAATCAGGCAGGAGAAGG + Intergenic
981493550 4:145367043-145367065 CAGGGCAATCAGACAGGAGAAGG - Intergenic
981830865 4:148999705-148999727 AAAGGAAATGGGATAGTAGCTGG - Intergenic
982078570 4:151763593-151763615 CAAGGAACTCAGAAGGTAGCTGG + Intergenic
983061765 4:163168690-163168712 CAAGGAAATTAGAAAGAAGTTGG + Intergenic
984370657 4:178860534-178860556 CAAGGCAATTAGGCAGTAGAAGG - Intergenic
985228391 4:187788034-187788056 CAAGGAAAACAGAATTTAGCTGG - Intergenic
985340628 4:188948973-188948995 AAAGGCAATCAGACAGGAACTGG - Intergenic
987899515 5:23993444-23993466 TAAGAAAATAAGACAGTACCTGG - Intronic
988328265 5:29799511-29799533 CAAGGCAATCAGGCAGGAGAAGG - Intergenic
988372576 5:30390267-30390289 CCAGGACATCAGACAGCAGGAGG + Intergenic
988395138 5:30687658-30687680 CAAGAAAATCAGACAGCTGGTGG - Intergenic
988397109 5:30709052-30709074 CAAGGCAATCAGGCAGGAGAAGG + Intergenic
988918108 5:35915860-35915882 CAGAGCAATCAGACAGGAGCAGG + Intronic
989838749 5:46031826-46031848 CAGGGAAATCAGACAGGAGAAGG + Intergenic
989948646 5:50270857-50270879 CAGGGAAATCAGGCAGAAGAAGG + Intergenic
990673312 5:58156788-58156810 AAAGGAAGACAGGCAGTAGCTGG + Intergenic
993841414 5:92884556-92884578 GAATGAATTCAGACTGTAGCTGG - Intergenic
994266197 5:97719782-97719804 CAGGGAAATCAGGCAGGAGAAGG - Intergenic
994571944 5:101526728-101526750 CAGGGAAATCAGGCAGGAGAAGG - Intergenic
994790694 5:104222892-104222914 TAAGAAAATCAGACACTAACAGG + Intergenic
994918237 5:106006406-106006428 CATGAAAATGAGACAGTTGCAGG - Intergenic
995276198 5:110280647-110280669 CAGGGAAATCAGGCAGAAGAAGG - Intergenic
995738652 5:115330766-115330788 CAAGGAAATCAGAAAGTGCCAGG - Intergenic
996003094 5:118387105-118387127 CAGGGCAATCAGACAGGAGAAGG + Intergenic
996071808 5:119139443-119139465 AATGGAAATCAGAAAGAAGCCGG + Intronic
996455486 5:123676555-123676577 CAGGGTAATCAGACAGGAGTAGG - Intergenic
997267769 5:132506123-132506145 CCAGGGAATCAGAAAGTACCAGG + Intergenic
998118353 5:139556247-139556269 AAAAGAAATCAAACATTAGCTGG + Intronic
999388733 5:151174520-151174542 GAAGGAAATCAGGCAGAGGCTGG + Intergenic
999623001 5:153491052-153491074 CAAGCAAAACAGTCAGTACCGGG - Intronic
1001654803 5:173341135-173341157 CAAGGAAGGCAGAAAGTAGGCGG + Intergenic
1001751216 5:174133070-174133092 ACAGGAAAGCAGACAGCAGCAGG - Intronic
1002505115 5:179673940-179673962 CAAAGAAATGACACAGTAGCTGG + Intergenic
1003827377 6:9968028-9968050 CAGGGAAATCAGGCAGGAGAAGG - Intronic
1003852518 6:10239868-10239890 CAAGGAAATAAGAGATTAGGTGG + Intergenic
1003902259 6:10665511-10665533 CAAAGAAATCAGAGAGGGGCTGG - Intergenic
1004713765 6:18196991-18197013 CAAGAAATTCAAACAATAGCAGG - Intronic
1005263556 6:24086987-24087009 CAGGGAAATCAGGCAGGAGAAGG + Intergenic
1006277600 6:33018141-33018163 CAAGGAAGTCAGACTGCAGTGGG - Intergenic
1008046007 6:46851878-46851900 CAAGGAAAGCACACAGTATCAGG - Intergenic
1009510512 6:64545518-64545540 CAGGGCAATCAGACAGGAGAAGG + Intronic
1009858110 6:69290194-69290216 GGAGAAAATCAGACAGTAACCGG + Intronic
1011055591 6:83200279-83200301 GGAGCAAATCAGAAAGTAGCTGG - Intergenic
1012783925 6:103599295-103599317 CAAGGAAATGATACATTGGCTGG - Intergenic
1014674226 6:124344826-124344848 CAGGGCAATCAGGCAGTAGAAGG - Intronic
1015928571 6:138334468-138334490 CAAGGAGAAGAGACAGTGGCGGG + Exonic
1016132342 6:140490802-140490824 AAAGGAAATAAGATAGGAGCAGG - Intergenic
1017268415 6:152478296-152478318 GAAGAAAATTGGACAGTAGCTGG + Intronic
1017805052 6:157938303-157938325 AATGGAAATCAGGCATTAGCAGG - Intronic
1018049690 6:159997929-159997951 GAGGGAAATCAAACAGGAGCTGG - Intronic
1019365667 7:631437-631459 GAAGGAAAACAGGCAGAAGCCGG + Intronic
1020385919 7:7602221-7602243 CAGGGCAATCAGACAGGAGAAGG + Intronic
1020645290 7:10807894-10807916 CAGGGAAATCAGGCAGGAGAAGG - Intergenic
1022084973 7:27057797-27057819 GAAGGAAATAAGACAGTAGGAGG - Intergenic
1024892732 7:54222247-54222269 CAGGGAAATCAGGCAGGAGAAGG + Intergenic
1025996336 7:66529778-66529800 CCAGGAAATAAGACGGGAGCAGG + Intergenic
1026988348 7:74568995-74569017 CCAGGAAATAAGACGGGAGCAGG + Intronic
1027480114 7:78685142-78685164 AAAGAAAATCAGACAGGAGAAGG - Intronic
1027888843 7:83944956-83944978 CAAGGAAATCACACAGGAATAGG + Intergenic
1027947636 7:84769401-84769423 TAAGCAAATCATACAGTATCAGG + Intergenic
1031648090 7:124252215-124252237 ACATGAATTCAGACAGTAGCAGG - Intergenic
1032855829 7:135832738-135832760 CAGGGAAGTCAGACATCAGCAGG + Intergenic
1034717141 7:153254051-153254073 CAAGGAAAGGAGACAGGTGCAGG + Intergenic
1034860839 7:154593249-154593271 CAAGGAAATCAGAATCTAGCTGG - Intronic
1036051739 8:5206405-5206427 CAAGGGAGCCAGACAGTAGTAGG - Intergenic
1036179254 8:6568787-6568809 GGAGGAAAGCAGACTGTAGCCGG - Intronic
1037855091 8:22366304-22366326 AAAGGAAAGCAGACAGTCGCTGG - Intergenic
1038919508 8:32067182-32067204 CAGGGCAATCAGACAGGAGAAGG - Intronic
1039684003 8:39776452-39776474 TAAGGAAACCAGGCAGTAACTGG - Intronic
1040123348 8:43707078-43707100 CAGGGAAATCAGGCAGGAGAAGG - Intergenic
1040376839 8:46833988-46834010 CAGGGAAATCAGGCAGGAGAAGG + Intergenic
1040539103 8:48335937-48335959 CAGGGCAATCAGACAGGAGAAGG - Intergenic
1041385097 8:57292921-57292943 CAGGGAAATCAGGCAGGAGAAGG - Intergenic
1042209670 8:66367190-66367212 CAAGGAAATGAGATAGTGGCTGG - Intergenic
1042593978 8:70425669-70425691 CAAGCAAAGAAGACAGTATCAGG - Intergenic
1042692259 8:71513772-71513794 CAAGGACATCATAGAGTAGAAGG - Intronic
1045942158 8:107751738-107751760 TAAAGAAATCCCACAGTAGCAGG + Intergenic
1046651737 8:116843126-116843148 CAAGGAAAGCACACAGTGCCTGG - Intronic
1046765985 8:118070717-118070739 CAAGAATAGCAGACAGGAGCGGG + Intronic
1047412409 8:124634653-124634675 CAAGGAAATCAGAAGGTTTCTGG - Intronic
1047613022 8:126539470-126539492 CCAGGACATAGGACAGTAGCAGG + Intergenic
1047740091 8:127799557-127799579 GAAGGAAAACAGACAGTAGCAGG + Intergenic
1048098506 8:131321071-131321093 CAAGGCAATCAGGCAGGAGAAGG - Intergenic
1048516881 8:135119358-135119380 CAGGGACAACAGACAGCAGCAGG - Intergenic
1048784173 8:138032986-138033008 AAAGGAAATCAGAATGTTGCTGG - Intergenic
1050499935 9:6286953-6286975 CAAGGTAATCAGATATTACCTGG + Intergenic
1050501201 9:6299494-6299516 CAAGGCAATCAGGCAGGAGAAGG + Intergenic
1050836078 9:10080252-10080274 AAGGAAAATCAGACAGGAGCAGG + Intronic
1050893114 9:10850410-10850432 CAGGGAAATCAGGCAGGAGAAGG - Intergenic
1050908046 9:11029372-11029394 CAGGGAAATCAGGCAGGAGAAGG + Intergenic
1050924581 9:11247979-11248001 CAGGGAAATCAGGCAGGAGAAGG + Intergenic
1050927750 9:11287015-11287037 CAGGGAAATCAGGCAGGAGAAGG + Intergenic
1050953203 9:11623692-11623714 CAAGGAAATGGGAAAGAAGCAGG + Intergenic
1050956429 9:11667254-11667276 CAGGGAAATCAGGCAGGAGAAGG - Intergenic
1052086927 9:24279272-24279294 CAAGGAAATTAGCCAGGAGCAGG - Intergenic
1052804713 9:33002482-33002504 CAAGGTAATCAGACATCATCTGG - Intronic
1053651382 9:40173434-40173456 CAAGGAAAGCACACAGTATCAGG + Intergenic
1053901774 9:42802787-42802809 CAAGGAAAGCACACAGTGTCAGG + Intergenic
1054533198 9:66202769-66202791 CAAGGAAAGCACACAGTATCAGG - Intergenic
1055272179 9:74573647-74573669 GTTGGAAACCAGACAGTAGCCGG - Intronic
1056555772 9:87686066-87686088 AAATGATTTCAGACAGTAGCAGG - Intronic
1056920944 9:90788877-90788899 CAAGAAAATCTGACAGTAGGAGG + Intergenic
1057422729 9:94925581-94925603 TAAGGAAATGACACAGTAGAAGG - Intronic
1057487966 9:95500727-95500749 CAAGGAGTTCACACACTAGCCGG + Intronic
1058094046 9:100838751-100838773 TCAGGAAATCAGAAAGTTGCAGG + Intergenic
1059510589 9:114841564-114841586 AAAGGAAAACAGAAAGGAGCAGG + Intergenic
1059885634 9:118741767-118741789 CAAGAAAATCAGTCAGTAAATGG + Intergenic
1060386032 9:123229440-123229462 CAAAGAAATGAGACAGTAGCTGG + Intronic
1062177260 9:135170644-135170666 GAAATAAATCAGACAGTACCCGG + Intergenic
1189116102 X:38344298-38344320 AAAGGAAATCACCCATTAGCTGG - Intronic
1189623895 X:42874133-42874155 CAGGGAAATCAGGCAGGAGAAGG - Intergenic
1190607916 X:52164051-52164073 CAGGGCAATCAGACAGGAGAAGG + Intergenic
1190975922 X:55400670-55400692 CAAGGCAATCAGGCAGAAGAAGG + Intergenic
1191071805 X:56408866-56408888 TATGGAAATCAAAAAGTAGCAGG - Intergenic
1191136758 X:57072514-57072536 CAGGGAAATCAGACTGGAGTAGG - Intergenic
1191147138 X:57178716-57178738 CATGGGAAGCAGAGAGTAGCAGG + Intergenic
1191165256 X:57383323-57383345 CAGGGAAATCAGGCAGCAGAAGG + Intronic
1191180803 X:57561510-57561532 CAGGGAAATCAGGCAGGAGAAGG + Intergenic
1191783006 X:64888670-64888692 CAGGGCAATCAGACAGGAGAAGG + Intergenic
1192352140 X:70365236-70365258 CAGGGAAATCAGACAGGAGAAGG - Intronic
1192525499 X:71839918-71839940 CAAGGCAATCAGGCAGGAGAAGG - Intergenic
1192532303 X:71899066-71899088 CAAGGCAATCAGGCAGGAGAAGG - Intergenic
1192578668 X:72262967-72262989 CAAGGAAACCAGACAGATGTGGG + Intronic
1192721108 X:73699233-73699255 CTAGGAAATCAGGCAGGAGAAGG + Intergenic
1193112552 X:77744017-77744039 CAAAGAAATCATACAGAGGCTGG + Intronic
1193457357 X:81747295-81747317 CAAGGCAATCAGGCAGGAGAAGG + Intergenic
1193476628 X:81974105-81974127 CAGGGCAATCAGACAGGAGAAGG - Intergenic
1194268888 X:91785010-91785032 AAAGGAAAACAGACATTTGCAGG - Intronic
1194286141 X:92013028-92013050 CAAGGCAATCAGGCAGGAGAAGG + Intronic
1194605459 X:95973519-95973541 CAAAGAAATCAGTCAGGAGACGG - Intergenic
1194838450 X:98711062-98711084 AACGGAAATCAGACAAAAGCAGG - Intergenic
1196005524 X:110833229-110833251 CAGGGAAATCAGGCAGGAGAAGG - Intergenic
1196993503 X:121354944-121354966 CAAGGGAAACAGACATTATCTGG - Intergenic
1197020498 X:121682085-121682107 CAGAGAAATGAGTCAGTAGCTGG + Intergenic
1197868369 X:131042356-131042378 CAAGCAGATCAGTCTGTAGCTGG - Intergenic
1198509875 X:137339759-137339781 GAAGGAGAACAGACAGTAGGAGG + Intergenic
1200586103 Y:5006022-5006044 AAAGGAAAACAGACATTTGCAGG - Intronic
1200603687 Y:5237569-5237591 CAAGGCAATCAGGCAGGAGAAGG + Intronic
1201626479 Y:16020425-16020447 CAGGGTAATCAGACAGGAGAAGG - Intergenic
1201750777 Y:17429670-17429692 CAGGGAAATCAGGCAGGAGAAGG - Intergenic
1201752626 Y:17449862-17449884 CAGGGAAATCAGGCAGGAGAAGG + Intergenic
1202104834 Y:21352464-21352486 CAGGGAAATCAGGCAGGAGAAGG - Intergenic