ID: 961935780

View in Genome Browser
Species Human (GRCh38)
Location 3:130582072-130582094
Sequence CTGAGTATGGAGAAGTGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 481
Summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 434}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961935780 Original CRISPR CTGAGTATGGAGAAGTGGGA AGG Intronic
901685273 1:10940345-10940367 GCGTGTATGGAGGAGTGGGAGGG + Intergenic
903974134 1:27138184-27138206 GTGAGAATGGAGAAGAGGGCAGG - Intronic
904162954 1:28534947-28534969 ATGGGGATGGAGAAGTGGGCAGG - Intronic
904458827 1:30663492-30663514 CTCAGTTTGGGGAAGAGGGAGGG - Intergenic
905124154 1:35705568-35705590 CTGAGAATGGAGAAGTGGATGGG - Intergenic
905213427 1:36390210-36390232 ATGAGAGTGGAGAAATGGGAGGG - Intergenic
905261118 1:36719861-36719883 CTGAGAATGCAGCAGTGGGGTGG + Intergenic
905500845 1:38435065-38435087 CTGTGCATTGAGAAGTGGGCTGG - Intergenic
905642206 1:39598210-39598232 CTGAGTGTGGAGGTGGGGGAGGG - Intergenic
907425887 1:54379037-54379059 CTGACTATGAACAAGTGGGTTGG - Intronic
907427905 1:54392680-54392702 CTGAGCCTTGAGAAGTGAGAAGG - Intronic
907918763 1:58894252-58894274 TTGAGTATGGAGTACTGGCAAGG - Intergenic
908027543 1:59968655-59968677 CAGAGGATGGAGCTGTGGGAGGG + Intergenic
908189239 1:61684378-61684400 CACAGTGAGGAGAAGTGGGAAGG - Intronic
909415503 1:75401630-75401652 CTGGGGCTAGAGAAGTGGGATGG + Intronic
910354999 1:86343188-86343210 CTGAGTTTGCAGGAGCGGGAAGG - Intergenic
911520443 1:98923640-98923662 CAGAGTATTGAGACCTGGGATGG - Intronic
912503993 1:110143172-110143194 GTGGGCATGGAGATGTGGGAAGG + Intergenic
914084541 1:144440962-144440984 CTGAGTAAAGAGAAGTCGGCCGG - Intronic
914190554 1:145406228-145406250 CTGAGTAAAGAGAAGTCGGCCGG - Intergenic
914588360 1:149083102-149083124 CTGAGTAAAGAGAAGTCGGCCGG - Intronic
915257039 1:154641349-154641371 CACAGTATGGAGAAAGGGGATGG + Intergenic
915289355 1:154872567-154872589 CTGCGGATGGAGGAGAGGGAGGG - Intergenic
915301286 1:154953048-154953070 CTGAGGAGGGAGAAGGGGGTTGG - Intronic
915897055 1:159820260-159820282 CTGATTATTGACAAATGGGAGGG - Intergenic
915938477 1:160103066-160103088 CTGGGAATGGAGAAGTGGGATGG - Intergenic
916127393 1:161583340-161583362 CTGAGTATGTAGGATTGGCAAGG - Intronic
916144875 1:161729441-161729463 ATGAATATGGGGAAGTAGGAAGG + Intergenic
916270809 1:162939354-162939376 GTGAATGTGGAGAAGTAGGAAGG + Intergenic
917707427 1:177648530-177648552 CTGAGAATGGAGAAGAGAGGAGG - Intergenic
918528053 1:185486578-185486600 CAGAGCCTGGAGAAGTGGAATGG + Intergenic
919481779 1:198098985-198099007 ATGAGTTTGGAGAGGTAGGATGG + Intergenic
920381688 1:205538257-205538279 CTGCTTGTGGAGAAGTGGGTGGG - Intergenic
920386602 1:205574335-205574357 CTCAGGAGGCAGAAGTGGGAGGG + Intronic
920448597 1:206039477-206039499 AAGAGGATGGAGAAGGGGGATGG + Intronic
921885594 1:220302085-220302107 CACAGTATGCAGAAATGGGAAGG - Intergenic
922612562 1:226940977-226940999 CAGAGTTTGGAGAAGAGGAAAGG - Intronic
922905006 1:229167639-229167661 AAGAGAAGGGAGAAGTGGGAGGG + Intergenic
924391556 1:243565767-243565789 CTCATTATGGCAAAGTGGGAGGG - Intronic
924587864 1:245375746-245375768 CTTGGTAAGGAGAAGCGGGATGG + Intronic
924657337 1:245984899-245984921 CAGAGCAAGGAGAAGTCGGATGG - Intronic
1063546550 10:6987352-6987374 CTGAGTTTGGAGAGTTGGGATGG - Intergenic
1063703097 10:8404574-8404596 CAGGGTATGGAGAAGTTGGTTGG + Intergenic
1064331848 10:14401592-14401614 CTGAGCATGGAGAGGGAGGAGGG - Intronic
1064800254 10:19062725-19062747 TTGAGTAGGGAGAAATGGAAAGG + Intronic
1065645390 10:27828344-27828366 CTAAATATGCAGAAGTGAGAGGG + Intronic
1067451445 10:46384458-46384480 CTGAGTAAGGACAAGTGTGGGGG - Intronic
1067582993 10:47457271-47457293 CGGGGTATGGAGAAGTTTGAGGG - Intergenic
1067688002 10:48479331-48479353 CAGAGAATGGAGATGAGGGAAGG + Intronic
1067709822 10:48639099-48639121 CTGAGCTTAGAGAAGTGGGATGG - Intronic
1067959745 10:50834748-50834770 TTCAGGATGGAGAAGTCGGAGGG + Intronic
1068786645 10:60982909-60982931 GTGGGCATGGAGCAGTGGGAGGG + Intronic
1069532319 10:69228522-69228544 CTGAGAATGGAAGAGTTGGATGG - Intronic
1070953771 10:80451503-80451525 CAGGGAATGGAGAACTGGGAGGG - Intergenic
1071805928 10:89120878-89120900 CTGAGTCTGGAGAAGCAGGAAGG + Intergenic
1073080519 10:100857214-100857236 ATGAGATTGGAGAAGTGGGTAGG - Intergenic
1074183383 10:111082037-111082059 CTGTGTATGCAGCAGTGGGAGGG + Intergenic
1075354965 10:121763585-121763607 CAGAGGATGGAGATGCGGGAGGG + Intronic
1075465525 10:122647734-122647756 CTGAGTGTGGAGATGTGGTGTGG - Intergenic
1076063254 10:127429601-127429623 CTGGGTATCGAGAAGTCAGAGGG - Intronic
1076523282 10:131094346-131094368 CTCTGTAAGGAGAAGTGGGAGGG - Intronic
1077761544 11:5104910-5104932 GTGAGGAAGGAGAAGAGGGAGGG - Intergenic
1078662018 11:13295421-13295443 CTGTTTGTCGAGAAGTGGGAGGG + Intronic
1079367028 11:19818266-19818288 CTGAGTATAGACAGGTGAGATGG - Intronic
1080552161 11:33382122-33382144 GTGAGTATGGAGAAGAGAGAGGG + Intergenic
1080822407 11:35819892-35819914 CTGAGTATTGTGAAGTGAGATGG - Intergenic
1082802375 11:57424634-57424656 CTAAGGCTGGAGAAGAGGGAGGG + Intronic
1083121675 11:60519471-60519493 TTGAGTATGGGGAAGTGGTTTGG + Intronic
1083544545 11:63538650-63538672 CAGGACATGGAGAAGTGGGAAGG + Intronic
1084952521 11:72674443-72674465 CTGATAATGCAGAAGGGGGAGGG + Exonic
1085124736 11:73992144-73992166 CTGAGTATGGAGAAGGCAAAAGG - Intergenic
1085198485 11:74686873-74686895 AGGGGTGTGGAGAAGTGGGAAGG + Intergenic
1085349242 11:75787981-75788003 CAGAGTAAGGACAAGTGGGTAGG + Intronic
1085534691 11:77211016-77211038 CTGAGGCTGGAGAGGTGGGTGGG + Intronic
1086005625 11:82031921-82031943 CTAAGTATTGAGAAGGGAGAAGG + Intergenic
1087277137 11:96171849-96171871 CTGAGAATGGAGAAGGTGGCAGG - Intronic
1089199409 11:116714790-116714812 CTGAGTGTGGAGAGGGGGAAAGG + Intergenic
1089303483 11:117512602-117512624 CTGAGGGTGGGGAAGGGGGAAGG + Intronic
1089622595 11:119730126-119730148 CAGAGTAAGGGGAAGAGGGAAGG - Intergenic
1089831132 11:121329179-121329201 CTGAGACTGAAGAAGAGGGAAGG - Intergenic
1090106168 11:123855168-123855190 CCCAGTAAGGAGAAGTGGGTCGG - Intergenic
1090379689 11:126317773-126317795 CTGTGTGTGGAGAAGTGGGGGGG + Intronic
1090591475 11:128274862-128274884 CAGAGAATGGAGAAGCGGGAAGG - Intergenic
1090638270 11:128707302-128707324 CTTATTATGGAGAAGTCGAAGGG - Intronic
1090647515 11:128777681-128777703 CTGAGTGTGCAGGAGCGGGAGGG - Intronic
1090709481 11:129372951-129372973 CGGGGAAGGGAGAAGTGGGAGGG + Intergenic
1090936076 11:131343748-131343770 CTGAGTAAAGAGAAGTTGGAAGG + Intergenic
1092160062 12:6310987-6311009 CTGGGTAGGGAGCAGTGCGAGGG + Exonic
1092719274 12:11424858-11424880 CTGAGGATGCAGAATTGAGAAGG + Intronic
1092916980 12:13197961-13197983 CTGGGTTTGGAGAAGAGGGTGGG + Intronic
1093011241 12:14109644-14109666 GTGAGGATGGAGAAGTGGCAGGG - Intergenic
1093480012 12:19594680-19594702 ATGAGTGTGGAGAAATGCGATGG + Intronic
1093647841 12:21609196-21609218 ATGAACCTGGAGAAGTGGGAAGG + Intergenic
1094008979 12:25786127-25786149 CTGTGTCTGGAGAACTGGAAAGG + Intergenic
1095775855 12:46009265-46009287 TTGAGGAGGGAGAAGTCGGAAGG + Intergenic
1097266460 12:57748322-57748344 CTTAGTGTAGAGAAATGGGAAGG + Exonic
1097701561 12:62825733-62825755 CGGAGTGTGGAGCAGGGGGAGGG + Intronic
1098144582 12:67485611-67485633 CTGAGCATGGAGTTTTGGGAAGG + Intergenic
1098210053 12:68153955-68153977 CTATGTATGGTGGAGTGGGAGGG - Intergenic
1099861735 12:88231142-88231164 CTTAGTTTGCAGAGGTGGGAGGG - Intergenic
1100036955 12:90263445-90263467 TTGAGTGTGGAAAGGTGGGAGGG - Intergenic
1100289899 12:93203811-93203833 CTGAGGTTGGAGAAGTGGTATGG - Intergenic
1100781477 12:98031421-98031443 CTCAGAATTGAGAACTGGGATGG - Intergenic
1100825695 12:98472349-98472371 CAGAGAATGGAGAGGTGGGTTGG - Intergenic
1101364621 12:104060289-104060311 GAGAGTTTGGAGAAGAGGGATGG - Intronic
1101711849 12:107275143-107275165 CTGAGTAAGGAATGGTGGGAAGG + Intergenic
1102216511 12:111165272-111165294 CTGAGAAAAGAGAAGTAGGAAGG + Intronic
1102352474 12:112204290-112204312 CTGAGTTCTGGGAAGTGGGAAGG + Intronic
1103639142 12:122334915-122334937 GTGTGTATGGACATGTGGGAAGG + Intronic
1104211075 12:126688925-126688947 ATGAGGATGGAGAGGTGGGCAGG + Intergenic
1105420586 13:20248410-20248432 CTCTGTAAGGAGCAGTGGGATGG + Intergenic
1106197847 13:27509417-27509439 CTGGAGATAGAGAAGTGGGAAGG - Intergenic
1106228274 13:27801469-27801491 CAGAGCATGGAGAAGTATGATGG + Intergenic
1107092750 13:36500097-36500119 CTGAGGATGGAGGAGTGGAGTGG - Intergenic
1108432858 13:50371720-50371742 CTGAGCCTGGAGAGGTGGGGAGG + Intronic
1109728118 13:66372025-66372047 ATAAGTATTAAGAAGTGGGAGGG - Intronic
1111587311 13:90298724-90298746 CTGAGTTTGGGGAAGTGAGGAGG + Intergenic
1112194397 13:97210952-97210974 TTGTGTATGGAGAAGAGGGGTGG + Intergenic
1113317576 13:109199085-109199107 CTGAATATTGAGAAGTGAGATGG - Intronic
1113966368 13:114155719-114155741 ATGAGGGTGGAGAAGTGGGGAGG + Intergenic
1114654563 14:24308327-24308349 CAGAGTGTGGGGAAGTGGGATGG + Exonic
1117460992 14:55944594-55944616 ATGAGTATAAAGATGTGGGATGG + Intergenic
1118929175 14:70224024-70224046 ATGAGTATGGAGAATTTTGAGGG + Intergenic
1120959778 14:90114238-90114260 CTGAGTATAGATACGTGGGGAGG - Intronic
1121467990 14:94128301-94128323 CTGGGTAGGGAGAAGAGGAAAGG - Intronic
1123168637 14:106349844-106349866 CTCTGTATGGAGAAGTGAAAAGG + Intergenic
1125297376 15:38217825-38217847 GGGAGTAGGGAGAGGTGGGAGGG - Intergenic
1125534496 15:40435669-40435691 ATGAGGCTGGAGAAGTGGGTAGG - Intronic
1126313743 15:47345821-47345843 CTGAGGATGGACAAGTGTGGGGG + Intronic
1126928740 15:53622622-53622644 CTGAGGAGGGAGCAGGGGGAGGG + Intronic
1126994234 15:54421523-54421545 CTGATTAGGTAGATGTGGGATGG - Intronic
1127291909 15:57578954-57578976 CTGACTATGGACAGCTGGGAAGG - Intergenic
1127897279 15:63312533-63312555 CTGAGTATGGACTAGTGTAAGGG - Intergenic
1128478060 15:68014155-68014177 CAGAGTAGGGGGATGTGGGAAGG - Intergenic
1128688025 15:69701358-69701380 CAGAGCTTGGAGAACTGGGATGG + Intergenic
1129929622 15:79399506-79399528 TTGGGTCTGGAGAAGTAGGATGG + Intronic
1130065794 15:80604087-80604109 GTGAGTAAGGAGAGGTGAGAGGG + Intergenic
1130536147 15:84786389-84786411 ATGAGTTTGGAGGAGTAGGAGGG + Intronic
1131111977 15:89770163-89770185 CTGGATATGGAGAGGTGGGGAGG + Intronic
1131385241 15:92000904-92000926 CTGAGTCTGGGGTAGTTGGAGGG + Intronic
1131393811 15:92070706-92070728 ATAAGGATGGAGGAGTGGGAGGG + Intronic
1131436415 15:92426258-92426280 CTGAGAATTGAAAATTGGGATGG + Intronic
1131511379 15:93051218-93051240 CTGGGTGTGGAGGGGTGGGAAGG + Intronic
1132504171 16:298397-298419 CTGAGGATGGAGAGGCAGGACGG + Intronic
1132528313 16:428953-428975 GTGAGGATGGGGAAGTGGAAGGG + Intronic
1134069658 16:11253173-11253195 CTTAATAAGGTGAAGTGGGAGGG - Intronic
1134562012 16:15219039-15219061 CTGAGGAGGGGGAAGTGGGTGGG - Intergenic
1134922550 16:18130665-18130687 CTGAGGAGGGGGAAGTGGGTGGG - Intergenic
1135723991 16:24840594-24840616 CTTAGTATTAAGAAGTGGGCTGG + Intergenic
1136092025 16:27927500-27927522 GTGAGTGTGGAGACTTGGGAGGG - Intronic
1136114561 16:28086673-28086695 CTGAGTCTGGAGGAGAGGCATGG + Intergenic
1137308446 16:47229406-47229428 CTGATTATAGAGTTGTGGGAGGG + Intronic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1137627785 16:49920592-49920614 CAGAGTATGGCAATGTGGGACGG + Intergenic
1137748487 16:50841129-50841151 CTGGGAAAGGAGAAGTTGGAAGG + Intergenic
1137750523 16:50858182-50858204 CTGAGTGTAGAGAAGTGGTGGGG + Intergenic
1137752418 16:50876674-50876696 CTGAGAATGCTGAAGTGTGAGGG - Intergenic
1138296521 16:55890147-55890169 CTGAGAATGGAGAAAAGGTATGG + Intronic
1139253406 16:65518654-65518676 CTGGGGATGGTGAAGTGGAAAGG - Intergenic
1139680427 16:68557523-68557545 GTGAGTATGGTTAAGTGGGTGGG + Intronic
1140222057 16:73050794-73050816 CTGGGTATGGAGAACTGCGAGGG - Intronic
1141417909 16:83891050-83891072 CTGAGTAAAGAGAAGCGGAATGG - Intergenic
1141618894 16:85226108-85226130 GTGAGTATGGTGGAGTGGCAGGG - Intergenic
1142199057 16:88752614-88752636 CTGAGGATGGAGATGAGGGAGGG + Intronic
1142342680 16:89534156-89534178 CTGGGGATGGAGAATGGGGAGGG - Intronic
1142519584 17:495468-495490 CTCAGGAGGCAGAAGTGGGAGGG - Intergenic
1142583194 17:954468-954490 CTGAGCCTGGAGAATTTGGAAGG - Intronic
1143185441 17:5007329-5007351 CTGAGGATGGAGAGGTGTGAGGG + Exonic
1145239993 17:21235577-21235599 ATGAGACTGGAGAGGTGGGATGG - Intergenic
1146128697 17:30251079-30251101 CTCAGGATGGAAGAGTGGGAGGG + Intronic
1146709974 17:35032554-35032576 CTGTGTGTGGAGAATAGGGACGG + Intronic
1147219306 17:38919245-38919267 CTGTGTAGGGACCAGTGGGATGG + Exonic
1147250528 17:39150613-39150635 ATGAGTTTGGAGAACTGGTAGGG + Intronic
1147987353 17:44314334-44314356 CTGGGTATGGCCAATTGGGATGG - Intronic
1148435745 17:47683277-47683299 CTGTGAATGTAGAAGTGGGGGGG + Exonic
1148805132 17:50260066-50260088 CTGAGACTGGAGAAGCTGGAGGG - Intergenic
1149141815 17:53440274-53440296 CTGTGTATGGTGAGGGGGGATGG - Intergenic
1149804341 17:59600932-59600954 CTGGAGATGGAGAAGTGGTAAGG - Intronic
1151893971 17:76967920-76967942 CTGAGGAGGCTGAAGTGGGAGGG - Intergenic
1203212885 17_KI270730v1_random:96388-96410 CGGAATATGGAGAACTGGAATGG + Intergenic
1153212827 18:2786749-2786771 TTGAGTATGGAGTGGTGGTAGGG - Intronic
1154101926 18:11483737-11483759 TAGAGTGGGGAGAAGTGGGAAGG + Intergenic
1154450370 18:14470809-14470831 CTGAGTAGGTAAAAGTGGGCAGG + Intergenic
1155108727 18:22692860-22692882 GTGAGTAGGGAGTAGGGGGAGGG + Intergenic
1156193337 18:34745211-34745233 CTGAGTTTGGAGAGTTGGGAAGG - Intronic
1157446565 18:47750890-47750912 CTCAGTAAGGGGAACTGGGAGGG + Intergenic
1157530689 18:48418212-48418234 CTGAGTATGGAGAGGAGGGAAGG + Intergenic
1157813712 18:50716425-50716447 CTGAGTGTGGAAACTTGGGAAGG - Intronic
1158157562 18:54443027-54443049 ATGAGAGTTGAGAAGTGGGATGG - Intergenic
1159130021 18:64270831-64270853 GTGATTATGGAGAAGTGGGGTGG + Intergenic
1159743002 18:72196504-72196526 CTGAATAAGGAAAAGGGGGAGGG + Intergenic
1159904977 18:74081686-74081708 CTGAGTATGGTGGAGTTGGAGGG - Intronic
1159965704 18:74594024-74594046 CTCAGTATGGAGAAGTTGTTAGG + Intergenic
1160511884 18:79457468-79457490 CTGAGAAGGGAGAGGAGGGAGGG - Intronic
1161730787 19:5959358-5959380 CTGCGTCTGCAGGAGTGGGATGG - Intronic
1164410812 19:28003288-28003310 CTGAGTCTTGAGAAGTGAGTAGG - Intergenic
1164584470 19:29458023-29458045 AACAGTATGGAGAGGTGGGATGG - Intergenic
1164738972 19:30562820-30562842 CTCAGGATGGAAAAGTGGGATGG - Intronic
1165369493 19:35395585-35395607 CTGGGAATGGAGAAGTGTCAGGG + Intergenic
1165427300 19:35753240-35753262 CTGAGGATGAGGAGGTGGGATGG + Exonic
1167784884 19:51628399-51628421 CTGAGGATGCAGGAGTGGAAGGG + Intronic
1168168574 19:54571979-54572001 CTGAGTTTGGGGGAGTGGGGAGG - Intergenic
925150872 2:1613865-1613887 CTGAGTATAGGAAAGTGGGAAGG - Intergenic
925327849 2:3036830-3036852 CTGGCTATGGGGAACTGGGATGG + Intergenic
925591523 2:5514679-5514701 CTGAGAATGGACAATTGTGAAGG + Intergenic
925921229 2:8639274-8639296 CTGAGAATGGAGGGGTGGGATGG - Intergenic
926722732 2:15973516-15973538 CTGAGCATGGCGAGGTGGAAGGG + Intergenic
927348942 2:22083487-22083509 GTGATTATGGAGAAGTGTTAGGG - Intergenic
927406696 2:22778464-22778486 CTGAATTTGGACAAGTGGAATGG - Intergenic
927748125 2:25641503-25641525 CTCAGGATGCTGAAGTGGGAGGG - Intronic
927957416 2:27217506-27217528 GCGAGTACGGAGAAGCGGGAAGG - Exonic
928021175 2:27706270-27706292 CTGAGGGTGGGGAGGTGGGAGGG + Exonic
928404873 2:31007015-31007037 CTGAATATGTAGGTGTGGGATGG + Intronic
929138983 2:38650870-38650892 CTGCGTCTGGAACAGTGGGAAGG - Intergenic
929243590 2:39677644-39677666 CTGTGTTTGGAGGAGTGGGATGG + Intronic
929278588 2:40052835-40052857 CAGATTATGTAGAAGTGGGGAGG + Intergenic
931890044 2:66661731-66661753 GTCAGTGTGGGGAAGTGGGATGG + Intergenic
932182644 2:69662433-69662455 CTGAGTGGGGAGGGGTGGGAGGG + Intronic
932190545 2:69738510-69738532 CTGAGTGGGGAGGGGTGGGAGGG - Intronic
932404358 2:71503679-71503701 CTGAATCTGGAGAAGAGGGCTGG - Intronic
932829749 2:74977738-74977760 CTGACTGTGGAGAAGTGGAAAGG + Intergenic
933084073 2:78032791-78032813 ATGTGAATGGAGAAGTGGTAAGG - Intergenic
933167897 2:79095481-79095503 CTTAGTTTGCAGAGGTGGGAAGG + Intergenic
934735035 2:96685779-96685801 CTTCCTATGGAGCAGTGGGAAGG + Intergenic
937372107 2:121305978-121306000 TTTAGAATGGTGAAGTGGGAAGG + Intergenic
937495238 2:122412245-122412267 CTGAGTATGCTGATGTGGGAGGG + Intergenic
937909185 2:127067250-127067272 GGGAATATGGAGAAGTGTGAGGG + Intronic
937928161 2:127183522-127183544 CTGAGAAGGCTGAAGTGGGAGGG - Intergenic
939783880 2:146484187-146484209 ATGAGTAGGGAGAAGGGAGAAGG + Intergenic
939977636 2:148737460-148737482 CTGGAGATGGAGGAGTGGGATGG + Intronic
940413281 2:153390946-153390968 CAGGGTAAGGAGAATTGGGAGGG + Intergenic
940424677 2:153516856-153516878 CTGTGTAAAGAGAAGTGGGAAGG - Intergenic
942736994 2:179125772-179125794 CTGAGAATGAAGAAGTGAAAAGG - Intronic
942785134 2:179692392-179692414 TAGAGAATGGAGGAGTGGGAAGG - Intronic
944192144 2:197014895-197014917 CTGTGTGTGGAGAGGTGGGGTGG - Intronic
945146781 2:206746812-206746834 CAGAGTATGAAGAATTGGGAAGG + Intronic
945930193 2:215847163-215847185 CTGAGTATGGATAAACTGGAAGG + Intergenic
946143902 2:217714290-217714312 GAGAGGATGGAGAAGGGGGAAGG - Intronic
946576712 2:221083482-221083504 CTGAGTAGTTAGAAGTGGCACGG - Intergenic
946651380 2:221895575-221895597 CTGTGTCTCGAGGAGTGGGAAGG - Intergenic
946934735 2:224708381-224708403 ATGAGGATGGAGAAGTGAGAAGG - Intergenic
948328316 2:237144297-237144319 CTTGGAATGAAGAAGTGGGATGG - Intergenic
948807306 2:240458628-240458650 CTGAGGATGGGGAAGGAGGAAGG - Intronic
1169026985 20:2379938-2379960 GTGAGGAAGGGGAAGTGGGAGGG - Intergenic
1169129105 20:3154573-3154595 CTCAGGAGGTAGAAGTGGGAAGG + Intronic
1169209834 20:3759747-3759769 CTGAGACTGGTGATGTGGGAGGG - Intronic
1169960566 20:11154835-11154857 CTGATACTGGTGAAGTGGGAAGG + Intergenic
1170213432 20:13868197-13868219 CTAAGTATGGGGGAATGGGATGG - Intronic
1171071505 20:22073175-22073197 CAGAGGATGGGGAAATGGGATGG + Intergenic
1171190886 20:23158642-23158664 CTCAGCATGGAGAAATGGGCTGG - Intergenic
1173408078 20:42784511-42784533 CTTAGTGGAGAGAAGTGGGATGG + Intronic
1173549815 20:43924863-43924885 CTGTGTGTGGAGAAGGGAGAGGG - Intronic
1175840288 20:62022261-62022283 CCAAGCATGGAGAGGTGGGAAGG + Intronic
1176445816 21:6819562-6819584 CTGAGTAGGTAAAAGTGGGCAGG - Intergenic
1176823984 21:13684595-13684617 CTGAGTAGGTAAAAGTGGGCAGG - Intergenic
1177006848 21:15684030-15684052 ATGAGACTGGAGAAGTGGGCAGG + Intergenic
1179037667 21:37773445-37773467 ATGAGTAGGGAGCAGAGGGAAGG + Intronic
1179166964 21:38942980-38943002 CTGAGTAGGGAGAAATGAAACGG - Intergenic
1179392038 21:41002743-41002765 CTGAGTATGGACCGGTGTGAGGG - Intergenic
1179493716 21:41758246-41758268 CTGAGGATGGGGATGAGGGAAGG - Intronic
1179583142 21:42357512-42357534 ATCAGTGTCGAGAAGTGGGAAGG - Intergenic
1179635197 21:42704278-42704300 GTGACTATGGAGATGTGGGAGGG - Intronic
1179898700 21:44377774-44377796 GTGAGTATGGCCAGGTGGGAGGG + Intronic
1181019372 22:20090947-20090969 CTGAGGATGGGGAAGTGGCCCGG + Intronic
1181720848 22:24773263-24773285 AGGAGTATGGAAAAGGGGGAAGG - Intronic
1181859283 22:25805702-25805724 CTGAGGCTGGAGAGGTGGGCAGG - Intronic
1182033015 22:27174902-27174924 CAGAGCAGGGAGAAGAGGGATGG + Intergenic
1182271734 22:29158138-29158160 ATGAGGCTGGAGAAGTGGGCTGG + Intronic
1184611686 22:45607875-45607897 CTAAGAATGGAGGAGTGGCAGGG + Intergenic
1185104100 22:48857665-48857687 CTGAGTATGGAGCTCAGGGATGG - Intergenic
1185104137 22:48857815-48857837 CTGAGTATGGAGCTCAGGGATGG - Intergenic
1185104162 22:48857915-48857937 CTGAGTATGGAGCTCAGGGATGG - Intergenic
1185125333 22:49007345-49007367 CTCAGTAAGGAGGACTGGGAGGG + Intergenic
949268514 3:2187853-2187875 CTGAGTAGGGAAAGGTGGCATGG + Intronic
949829519 3:8198987-8199009 CTGAGGAAGGATAAGTGAGAGGG - Intergenic
951113313 3:18831678-18831700 CTGAGTATTCTGAAGTGGGATGG + Intergenic
953345420 3:42171613-42171635 ATGAGCCGGGAGAAGTGGGAAGG - Intronic
953790272 3:45942165-45942187 CTGAGTATGGAGCTGTGCCAGGG - Intronic
954615849 3:51968267-51968289 CCGATTATGGAGGAGTGGGGGGG - Intronic
954864516 3:53717546-53717568 CCTACCATGGAGAAGTGGGATGG + Intronic
955044750 3:55349222-55349244 CTGAGTATGGGGAAGAAGCATGG - Intergenic
955083465 3:55679169-55679191 ATGAGGATGGAGAAGAAGGAAGG - Intronic
955360453 3:58269491-58269513 CTGAGTCTGGAGAGCAGGGAAGG + Intronic
955920127 3:63946724-63946746 CTGAGGCTGGAGAGATGGGAGGG + Intronic
959134541 3:102400511-102400533 CTGAGCATGGAGAAGGCAGAGGG - Intronic
960092686 3:113657526-113657548 CTGAGTTTGAAGAATTAGGAGGG + Exonic
961935780 3:130582072-130582094 CTGAGTATGGAGAAGTGGGAAGG + Intronic
962064171 3:131961862-131961884 CTGAGTAGGGAAAAGGGAGAAGG - Intronic
963285614 3:143431787-143431809 CTGAGTTTAGAGAAGTAAGAGGG - Intronic
963627168 3:147688482-147688504 ATGATGATGGAGAAGTGGGTAGG - Intergenic
965787931 3:172355915-172355937 CTCAGTATGGAGAACAAGGAAGG - Intronic
965807443 3:172556834-172556856 CTCAGTAAGGAGAATTGGGCCGG + Intergenic
966167594 3:177038067-177038089 CTTAGTAGGGAGAAATGGGTTGG - Intronic
966451899 3:180072928-180072950 CTGTATTTGGAGAAGAGGGAGGG + Intergenic
966473606 3:180319813-180319835 CTGGGCAAGGAGGAGTGGGAAGG + Intergenic
967527899 3:190514916-190514938 CTCAGTATTTAGAAGAGGGAAGG - Intronic
967575672 3:191088576-191088598 CTGAGTATGGGGTAGTGGGAAGG - Intergenic
968178835 3:196575062-196575084 CTGAGTTTGGAGAATTTGGTTGG + Intronic
968434323 4:576784-576806 CTGGGTAAGGAGAAGGGGAAAGG + Intergenic
968569051 4:1329792-1329814 CTGAGGCTGGACAAGAGGGAAGG + Intronic
968807796 4:2786832-2786854 CCAAGGATGGAGAAGTGGAAGGG + Intergenic
969660036 4:8521991-8522013 CTGAGGATGCAGAAGTGTGCAGG - Intergenic
969689735 4:8697939-8697961 CTGAGAGTGGAGAGGTGGGGTGG - Intergenic
969880303 4:10167783-10167805 TTGAGTATGGAGAAGTCAGGAGG - Intergenic
970855251 4:20643933-20643955 GAGAGAATGGAGAAGTGAGAGGG + Intergenic
971234510 4:24829144-24829166 CTGAGGATGGAGCTGTGGGACGG + Intronic
973931153 4:55793926-55793948 CTGGGGATGGGGAAGAGGGACGG + Intergenic
977313251 4:95413092-95413114 CTGAGTGTGGTAAAGAGGGAAGG - Intronic
977934683 4:102787694-102787716 CTGAGCAGGAAGGAGTGGGATGG + Intergenic
980354572 4:131725003-131725025 CTGAGTAAGGAGGGGTGGGGCGG + Intergenic
980356190 4:131732487-131732509 CTGAGTAAGGAGGGGTGGGGCGG + Intergenic
980356725 4:131734975-131734997 CTGAGTAAGGAGGGGTGGGGCGG + Intergenic
980357265 4:131737463-131737485 CTGAGTAAGGAGGGGTGGGGCGG + Intergenic
980357808 4:131739958-131739980 CTGAGTAAGGAGGGGTGGGGCGG + Intergenic
980358341 4:131742441-131742463 CTGAGTAAGGAGGGGTGGGGCGG + Intergenic
980358878 4:131744938-131744960 CTGAGTAAGGAGGGGTGGGGCGG + Intergenic
980359418 4:131747411-131747433 CTGAGTAAGGAGGGGTGGGGCGG + Intergenic
980359961 4:131749879-131749901 CTGAGTAAGGAGGGGTGGGGCGG + Intergenic
980360500 4:131752374-131752396 CTGAGTAAGGAGGGGTGGGGTGG + Intergenic
980361041 4:131754846-131754868 CTGAGTAAGGAGGGGTGGGGCGG + Intergenic
980361583 4:131757329-131757351 CTGAGTAAGGAGGGGTGGGGTGG + Intergenic
980362124 4:131759801-131759823 CTGAGTAAGGAGGGGTGGGGCGG + Intergenic
980362667 4:131762284-131762306 CTGAGTAAGGAGGGGTGGGGCGG + Intergenic
980424508 4:132608800-132608822 CTGAGTGAAGAAAAGTGGGAGGG + Intergenic
981584433 4:146285914-146285936 CTGAGTTTGGAGTGGTGAGAAGG + Intronic
981584438 4:146285962-146285984 CTGAGTTTGGAGTGGTGAGAAGG + Intronic
981584456 4:146286102-146286124 CTGAGTTTGGAGTGGTGAGAAGG + Intronic
981584462 4:146286150-146286172 CTGAGTTTGGAGTGGTGAGAAGG + Intronic
981584484 4:146286294-146286316 CTGAGTTTGGAGTGGTGAGAAGG + Intronic
981584493 4:146286366-146286388 CTGAGTTTGGAGTGGTGAGAAGG + Intronic
981584505 4:146286458-146286480 CTGAGTTTGGAGTGGTGAGAAGG + Intronic
981584508 4:146286482-146286504 CTGAGTTTGGAGTGGTGAGAAGG + Intronic
981584543 4:146286722-146286744 CTGAGTTTGGAGTGGTGAGAAGG + Intronic
981584570 4:146286958-146286980 CTGAGTTTGGAGTGGTGAGAAGG + Intronic
981584582 4:146287054-146287076 CTGAGTTTGGAGTGGTGAGAAGG + Intronic
982195670 4:152910287-152910309 CAGAGTTGGGGGAAGTGGGAGGG + Exonic
982878366 4:160676445-160676467 CTGAGTAAGGATAAATGTGAAGG + Intergenic
982888088 4:160809321-160809343 GTGAGTGTGCAGAAGTGTGATGG + Intergenic
984476596 4:180243010-180243032 CTGAGTATGGAGCTCTGGGGAGG + Intergenic
984501525 4:180565148-180565170 CAGGGTATGAGGAAGTGGGAGGG - Intergenic
985010714 4:185579757-185579779 TTGAGTATGGAGCTGGGGGAAGG + Intergenic
986366784 5:7040803-7040825 CCCAGTATGGGGAGGTGGGAAGG + Intergenic
987039790 5:14051684-14051706 CTGAGTCTGCAGCAGAGGGAAGG + Intergenic
987147466 5:15006193-15006215 ATGAGTGTGGAGAAGTAGGCAGG - Intergenic
988594550 5:32579970-32579992 GTGAGTCTGAAGAACTGGGAAGG - Intronic
988893546 5:35647249-35647271 CTTAGTAAGGAGAAGGGGGAGGG + Intronic
988996138 5:36716571-36716593 CTGATTCAGGAGAACTGGGATGG + Intergenic
989624920 5:43420134-43420156 CTGAGGAAGGAGGAGTGGGGCGG - Intergenic
989637755 5:43555318-43555340 TTAATTATAGAGAAGTGGGAGGG - Intronic
990603601 5:57385302-57385324 CACAGAATGTAGAAGTGGGAGGG - Intergenic
991037143 5:62138787-62138809 CTTGGTCTGGAAAAGTGGGAGGG + Intergenic
991212406 5:64120870-64120892 CTGAGTAAGGTGAAGAGGGAAGG + Intergenic
991317446 5:65325128-65325150 CTGGGGATGGAGGAGTGGGGAGG + Intronic
991965016 5:72082163-72082185 CTGAGAGTGGAGGTGTGGGAGGG - Intergenic
992987771 5:82251140-82251162 CTGGGTATGGAGATTTGGGGTGG - Intronic
994713084 5:103289840-103289862 CTGAGAAGGGAGAAGATGGAAGG - Intergenic
994792358 5:104245528-104245550 GTGAGTGGGGGGAAGTGGGAGGG + Intergenic
995352339 5:111193845-111193867 CAGAGTATGTAGAAGAGGGCAGG + Intergenic
995357205 5:111252370-111252392 TTTAGTATGGAGAAGTGTGGAGG + Intronic
995629588 5:114118834-114118856 CTGAGTGAGGAAAAGTGAGAAGG - Intergenic
996090892 5:119350821-119350843 ATGAGTGTGGAGATGAGGGAAGG - Intronic
997303416 5:132822796-132822818 CTATGTAAGGAGAAGAGGGAAGG + Exonic
997427339 5:133812398-133812420 CTGGGGATGGAGAAGTGTCAGGG - Intergenic
997572154 5:134938632-134938654 GTGAGAGTGGAGAAGGGGGAGGG + Intronic
998265957 5:140668075-140668097 CTGAAAATGGAGAAATGAGATGG + Intronic
998337995 5:141390317-141390339 GTGAATATGGAGAAATGGGTAGG - Intronic
998701804 5:144711307-144711329 GTGAGAAAAGAGAAGTGGGAAGG - Intergenic
999174982 5:149625748-149625770 GTGTGTGTGGAGAGGTGGGAGGG - Intronic
999315143 5:150578853-150578875 CCAAGTATGCAGAAGAGGGACGG + Intergenic
999937994 5:156508779-156508801 CTGAGTACAGAGAATTGGGGTGG + Intronic
1000015164 5:157269275-157269297 GTAGGTAGGGAGAAGTGGGAGGG + Intronic
1001874378 5:175186667-175186689 GAGAGTTTGGTGAAGTGGGAAGG - Intergenic
1003184434 6:3818609-3818631 CTGAGTCTGGAAAAGTGAGGAGG + Intergenic
1004317173 6:14599725-14599747 CTGAGGAAGGAGAGGTGGGGAGG + Intergenic
1004330514 6:14716572-14716594 CTGATCATGGATAACTGGGAGGG - Intergenic
1006116957 6:31780630-31780652 CTCAGGGTGGAGAAGAGGGATGG + Intronic
1006171791 6:32097306-32097328 CTGAGGGTGGGGAAGAGGGAGGG + Intronic
1006855210 6:37128201-37128223 CTGAGTATGGAGATAAGAGAAGG - Intergenic
1007010350 6:38411020-38411042 TTGAGTATGGAGAGTTGGTAAGG - Intronic
1007832720 6:44651128-44651150 CTGAGCATAGAGAGCTGGGAGGG - Intergenic
1007907412 6:45476197-45476219 ATGAGAATGCAGAAATGGGATGG + Intronic
1009796570 6:68476893-68476915 CTGGGGAAGGAGAAGTGGCAAGG - Intergenic
1009913657 6:69965782-69965804 CTAGGGATGGTGAAGTGGGATGG - Intronic
1010577074 6:77544839-77544861 CTGAGCAGGGAGAAGTGAAAGGG + Intergenic
1011847384 6:91582912-91582934 CTGAGGATGGAGTTGGGGGATGG + Intergenic
1013367709 6:109447827-109447849 CTGAGCAGGGAGGAGTGGGCAGG - Intronic
1013791013 6:113836541-113836563 CTGGTTATGGAAAACTGGGAAGG + Intergenic
1014125738 6:117774991-117775013 CTGAGTATGGAAAAGTGGCCAGG - Intergenic
1014174540 6:118317242-118317264 GAGAGTATGTAGATGTGGGAAGG - Exonic
1014259297 6:119197627-119197649 CTGGGTCTTGAGAGGTGGGAGGG + Intronic
1015941293 6:138454986-138455008 CTGATTATAGAGTAGTGGGATGG + Intronic
1017026542 6:150186151-150186173 CTGAGGGTGGAGATGTGGCAAGG - Intronic
1017398716 6:154034108-154034130 CTGTGTATGATGAAATGGGAAGG + Intronic
1018219726 6:161565987-161566009 CTGATGATGCAGAAGGGGGAAGG - Intronic
1018548298 6:164962816-164962838 CTGCCTATGGAGCTGTGGGAAGG + Intergenic
1018735633 6:166685431-166685453 CTGAGGGAGGACAAGTGGGATGG - Intronic
1019017652 6:168891541-168891563 CTGAGGTTGGAGGGGTGGGAGGG - Intergenic
1019322222 7:420936-420958 CTGAGGTTGGAGGGGTGGGACGG - Intergenic
1019834447 7:3368476-3368498 ATCAGTATGGAGTAGGGGGATGG + Intronic
1020905024 7:14053569-14053591 CTGACCAGGGAGAACTGGGATGG - Intergenic
1021205260 7:17772480-17772502 CTGAGAATGGAGAGGTGGACTGG + Intergenic
1021836349 7:24679760-24679782 CTGAGTGTAGCGGAGTGGGAAGG - Intronic
1021911457 7:25389455-25389477 CTCAGGCTAGAGAAGTGGGAAGG - Intergenic
1022865415 7:34413680-34413702 TTAAGGAGGGAGAAGTGGGAGGG - Intergenic
1023142524 7:37116399-37116421 CTGAATTTGGAGAACTGGGTTGG + Intronic
1024214917 7:47240515-47240537 GTGAAAATGGAGAATTGGGAGGG - Intergenic
1024324277 7:48096515-48096537 CTGGGGAAGGGGAAGTGGGAGGG - Intronic
1025095030 7:56090070-56090092 ATGAGGAAGGAGCAGTGGGATGG - Intronic
1026068080 7:67093057-67093079 CTGAGGAGGCAGAGGTGGGAGGG + Intronic
1026214147 7:68333373-68333395 CTTAGGAGGGTGAAGTGGGAAGG - Intergenic
1027477687 7:78653835-78653857 ATGAGGATGGACAAGTGGTATGG - Intronic
1028897797 7:96061590-96061612 CTCACTATTGGGAAGTGGGAGGG - Intronic
1029598650 7:101550994-101551016 CTGAGTCTGCAGAAGAGGAAGGG - Intronic
1030152350 7:106420154-106420176 CAGAGAATGGAGAGGTGGGGAGG - Intergenic
1031124281 7:117756039-117756061 CTGAGGAAGGAGAAGTGGCAGGG - Intronic
1031948785 7:127869393-127869415 CAGAGTTTGGAGTAGAGGGATGG + Intronic
1032144702 7:129368489-129368511 TGCACTATGGAGAAGTGGGACGG + Intronic
1034066785 7:148144613-148144635 ATGAGTATCAAGAACTGGGAAGG - Intronic
1034537315 7:151733650-151733672 CTGAGCAGGGAGAGGAGGGATGG - Intronic
1036458226 8:8928234-8928256 CTGAATATGTAGAAATTGGATGG + Intergenic
1036719949 8:11164926-11164948 ATTAGTAAGGTGAAGTGGGAAGG - Intronic
1037594322 8:20342135-20342157 CTGAGTGCGGACAAATGGGAAGG - Intergenic
1037597211 8:20364203-20364225 CTGAGTCTGGAAAGGTGGGAGGG + Intergenic
1037915555 8:22770708-22770730 CTGATCAAGGAGAGGTGGGATGG - Intronic
1039328011 8:36505986-36506008 CTGACTATGGAGAAAAGGGAGGG + Intergenic
1040921417 8:52624009-52624031 CTGAGTATTGAGGGGTTGGAGGG + Intronic
1041224160 8:55682300-55682322 CCAAGTATGGAGAAATGGAAAGG + Intergenic
1043363968 8:79510161-79510183 CTGAATTTAGAGAAGGGGGAGGG - Intergenic
1043386652 8:79755631-79755653 CTGAGTCTGCAGATTTGGGATGG + Intergenic
1044417716 8:91954883-91954905 GTGTGGCTGGAGAAGTGGGATGG + Intergenic
1045696217 8:104811353-104811375 CTGAGTAGAGAGACTTGGGATGG + Intronic
1046547786 8:115673402-115673424 GTAAGTATGGAGTAGTGGGTGGG - Intronic
1047934615 8:129764612-129764634 CTGGCTATGCAGAGGTGGGAAGG + Intronic
1048298669 8:133235378-133235400 ATGAATATGGAAAAGTGGAAAGG + Intergenic
1048808653 8:138264502-138264524 CTGAGTATGTAGCAGTGAGAAGG + Intronic
1048837862 8:138538306-138538328 CTGAGAGTGGAGAAGAAGGAAGG + Intergenic
1049347513 8:142146681-142146703 ATGTGGCTGGAGAAGTGGGAGGG + Intergenic
1051367514 9:16331683-16331705 CAGAGAATGTAGAGGTGGGAGGG + Intergenic
1052105714 9:24511992-24512014 CTGAGGATGGAGGAGTGGCCAGG + Intergenic
1052376566 9:27724255-27724277 TTGTGTAGGGAGAGGTGGGAGGG + Intergenic
1053103796 9:35393498-35393520 CTGAAGATGGAGAGGTGTGACGG + Intronic
1053170081 9:35872102-35872124 CTGGGTATGGGAGAGTGGGAAGG - Intergenic
1053170103 9:35872166-35872188 CTGGGTATGGGAGAGTGGGAAGG - Intergenic
1053371805 9:37567850-37567872 CTGAGGACGCAGAAGAGGGAAGG - Intronic
1053484748 9:38443259-38443281 CTGGGAGAGGAGAAGTGGGAGGG + Intergenic
1055131940 9:72785709-72785731 CTGGGCAGGGTGAAGTGGGAAGG + Intronic
1055472660 9:76628827-76628849 GTGTGTTTGGAGAAGTGGGTTGG - Intronic
1056704329 9:88939328-88939350 CTGGGAATGGAGAATTGAGATGG + Intergenic
1056942500 9:90967367-90967389 CTGACCATGGTGACGTGGGAAGG + Intergenic
1058385532 9:104430877-104430899 GTGAGGATGGAGAATTGGGCAGG + Intergenic
1058770479 9:108226481-108226503 CTGAGAATTTAGAAGTGGAAAGG - Intergenic
1058874321 9:109229911-109229933 CTGGGTATGGACTAGTGGCAGGG - Intronic
1059545855 9:115175958-115175980 CGGACTGTGTAGAAGTGGGAAGG + Intronic
1060016179 9:120088273-120088295 CTGAGGATGGAGAAAAGGGAAGG + Intergenic
1060405030 9:123368832-123368854 CTGAGGCTGGGGAAGTGGGGAGG - Intronic
1061347755 9:130041174-130041196 TTGAGGGTGCAGAAGTGGGAAGG - Intronic
1062331677 9:136047646-136047668 CTGAGTACGGGGGAGTTGGAGGG + Intronic
1203523377 Un_GL000213v1:64963-64985 CTGAGTAGGTAAAAGTGGGCAGG + Intergenic
1186844580 X:13517962-13517984 CTGGGTATGGAGAAAGTGGAAGG - Intergenic
1187522071 X:20022534-20022556 CTGAGGAAGGAGAGGAGGGACGG + Intronic
1187968823 X:24639538-24639560 GTGGGTAGGGAGAAGTGGAAAGG - Intronic
1188934350 X:36154901-36154923 ATTAGTATTGAGAAGTGGGTGGG - Intergenic
1189414782 X:40804190-40804212 CTGAGGATGGAGAAGAGAGCTGG + Intergenic
1190381763 X:49845958-49845980 CAGCCTATGGAGATGTGGGATGG - Intergenic
1190876730 X:54465407-54465429 ATTAGTGTGGAGAAGTAGGAAGG + Intronic
1192234177 X:69285608-69285630 AAGAGAATGGAGAAGGGGGAAGG + Intergenic
1192321260 X:70092392-70092414 TGGGGTAGGGAGAAGTGGGAAGG + Intergenic
1192553573 X:72072452-72072474 GTGAGGCTGGAGAAGTAGGAGGG - Intergenic
1192946002 X:75966190-75966212 CTTAGTTTGCAGAGGTGGGAGGG + Intergenic
1194327121 X:92533440-92533462 CTGGGTGTGTAGATGTGGGAAGG + Intronic
1194640055 X:96392915-96392937 CTGAGTATGAAGCAGTAGGAGGG + Intergenic
1195112642 X:101663029-101663051 CTAAGTGTGGTGATGTGGGATGG - Intergenic
1195641513 X:107180714-107180736 CTGAGTATGGGAAAGGGGCAGGG + Intronic
1196544672 X:116947770-116947792 CTGAAGATGGTGAAGGGGGAAGG + Intergenic
1197644502 X:129003551-129003573 CTGATTGAGGAGATGTGGGATGG + Intergenic
1198724462 X:139662788-139662810 GTGAATTTGGAGAAGGGGGAGGG - Intronic
1199166268 X:144679203-144679225 CTGAAGATGGCGAAGGGGGAAGG - Intergenic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1200063109 X:153492303-153492325 CTGAGGAGGGGGGAGTGGGAGGG + Intronic
1200268371 X:154658864-154658886 CAGAGTATGCAGAGTTGGGAAGG + Intergenic
1200635836 Y:5652648-5652670 CTGGGTGTGTAGATGTGGGAAGG + Intronic