ID: 961938840

View in Genome Browser
Species Human (GRCh38)
Location 3:130615878-130615900
Sequence TCTTGCCAAAGCAAGATTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 175}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961938840_961938844 10 Left 961938840 3:130615878-130615900 CCTTTAATCTTGCTTTGGCAAGA 0: 1
1: 0
2: 2
3: 17
4: 175
Right 961938844 3:130615911-130615933 CCATAAATCTTTCAGCCTCTTGG 0: 1
1: 0
2: 0
3: 16
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961938840 Original CRISPR TCTTGCCAAAGCAAGATTAA AGG (reversed) Intronic
907146605 1:52239268-52239290 TCTTGGGAAAGCAAAATTAGGGG + Exonic
907765487 1:57406296-57406318 TTTTGCCAGAGTAAGAGTAAGGG - Intronic
908721899 1:67134632-67134654 TCATGGGAAAGCAAAATTAAGGG + Intronic
909745948 1:79097512-79097534 TGTTCTCAAAACAAGATTAATGG - Intergenic
910519351 1:88101448-88101470 TCTTGCCCTAGCAAAATCAAAGG + Intergenic
910581081 1:88825641-88825663 TCTTGTCAAAACAAGATAATGGG - Intronic
911509456 1:98793156-98793178 TCTTTCTAAAGCAAGTTTCATGG - Intergenic
913262566 1:117012737-117012759 TTTTGTCAAAGCAAGTATAAAGG + Intronic
919990574 1:202706196-202706218 TCTTGCCAAAGCTTGATTTCTGG - Intronic
920353647 1:205354255-205354277 TCTTTCCAAAGAAAGCTAAAAGG - Intronic
920970896 1:210743110-210743132 CCTGGCCAAAGCAAGAGTCATGG + Intronic
923099595 1:230801722-230801744 TCTTCCCAGATCAAGATGAAGGG - Exonic
1063280088 10:4619350-4619372 TGTGGCCAAAGCAACATAAAGGG - Intergenic
1064454878 10:15478091-15478113 TCATGCCCAAGCAAGGCTAAGGG - Intergenic
1066105756 10:32155312-32155334 TCTAGCCAAAGGAAGAGAAAAGG - Intergenic
1066177356 10:32922073-32922095 TCTTACAAAAGCAAGATTCATGG - Intronic
1070460152 10:76658667-76658689 TCTTACCAAAATAAGAATAAAGG + Intergenic
1072222820 10:93341102-93341124 TCATACCAAAGCAAGATTAAGGG + Intronic
1074115447 10:110454555-110454577 TCTAGCCAAAGAAATATGAACGG + Intergenic
1078613846 11:12846450-12846472 TCTTTACAAAGCAACATTCAGGG + Intronic
1079071253 11:17349578-17349600 TCTGGCCAAAGTAATATAAATGG - Intronic
1082989381 11:59194182-59194204 TCGAGGCACAGCAAGATTAAAGG - Intronic
1084449863 11:69230164-69230186 TGTAGCCAAAGCAAGGTTCAGGG - Intergenic
1085202586 11:74710733-74710755 CCTGGCCAAAGCAAAATGAATGG - Intronic
1085852208 11:80134530-80134552 TGCTGCAAAAGCAAGACTAAGGG - Intergenic
1087848816 11:103004606-103004628 TATAGCCAAAGCAATATAAATGG + Intergenic
1090608277 11:128447538-128447560 TCCTGCCAAATAAAGCTTAAAGG - Intergenic
1094104010 12:26789594-26789616 TCTTACAAAAGAAGGATTAATGG - Intronic
1095398738 12:41790787-41790809 TCTTGCTAAAACTAGACTAAGGG - Intergenic
1095517681 12:43024650-43024672 TTTTGCCAAAGCAGCATTAGTGG - Intergenic
1099489079 12:83265977-83265999 TCTAGCCAAAGAAAGATGAGTGG + Intergenic
1099849486 12:88074415-88074437 ACTTGCTAAATTAAGATTAAGGG + Intronic
1100711320 12:97259945-97259967 TCTTGCCCATGCATGATTCAGGG + Intergenic
1100837332 12:98578924-98578946 TCTTGCCAAAAGAACATAAATGG + Intergenic
1105997846 13:25689358-25689380 TTTTACCAAAGGAAGATAAAGGG - Intronic
1108176302 13:47796200-47796222 TTTTGCTTAAGAAAGATTAACGG - Intergenic
1108232653 13:48365289-48365311 GCTTACCAAAGCAAATTTAATGG - Intronic
1108334066 13:49421227-49421249 TCTAGCCAAAGGAACATGAAAGG + Intronic
1109319896 13:60797738-60797760 TCTTGCCAAAGCAATAATTCAGG + Intergenic
1109929142 13:69190238-69190260 TAATGCCAAAACAAGATGAAAGG - Intergenic
1110339822 13:74376793-74376815 TCTTCCCAAAGCAAAATGAAAGG + Intergenic
1110352843 13:74529825-74529847 TCTGGCCAATGCCATATTAATGG + Intergenic
1110434571 13:75464689-75464711 TTGTGCCAATGCAAGATCAAGGG - Intronic
1111081022 13:83308040-83308062 TTTTGCCAAAGGAGTATTAATGG - Intergenic
1116100517 14:40427903-40427925 TATTGACAAAGTAAGATGAAAGG - Intergenic
1116303233 14:43213880-43213902 ACTATCCCAAGCAAGATTAATGG + Intergenic
1116708053 14:48328419-48328441 TCTTGTTAAAAAAAGATTAAAGG + Intergenic
1117293386 14:54355087-54355109 TCTTGCAAAGGCAAAATTATAGG + Intergenic
1118608158 14:67518200-67518222 TCTTGTCAAAGCAAGAGGAGCGG + Intronic
1120486606 14:85122123-85122145 TCTTGCAAAAGCAAGAATCTTGG - Intergenic
1120695546 14:87640357-87640379 TCTAGCCAAAGGAAGAGCAAAGG - Intergenic
1121172929 14:91869471-91869493 TCTAAAGAAAGCAAGATTAAGGG + Intronic
1123915516 15:25021642-25021664 TCCTACCAACACAAGATTAAAGG + Intergenic
1128800426 15:70493362-70493384 TCTTTCCAAAGGAAGCTTCAAGG + Intergenic
1129219472 15:74123101-74123123 TCTTTCCATAGCAAGATTCAGGG - Intronic
1130680582 15:85992653-85992675 TCTTACAATAGCAAGAGTAAGGG - Intergenic
1131433401 15:92404180-92404202 TCTTGCCAGAGCTGGATTCATGG + Intronic
1133367967 16:5226005-5226027 TCTTCCCACAGCAAGACTGATGG - Intergenic
1134060199 16:11194947-11194969 TCGTGCCAAAGCAAGCTCAAGGG + Intergenic
1138766102 16:59606589-59606611 TCTTGCCAAATCAAGATGAATGG - Intergenic
1148090426 17:45019794-45019816 TTTTGCCAACCCAAGAGTAAAGG - Intergenic
1149960736 17:61107050-61107072 TGTTAGCAAAGCAAGACTAAAGG - Intronic
1150201830 17:63365102-63365124 GGTTGTCAAACCAAGATTAATGG + Intronic
1154048120 18:10926776-10926798 TCTTGCTGGAGCAAGATTAAAGG + Intronic
1155372296 18:25114202-25114224 TCTTGCCAAAGGATAAATAAAGG - Intronic
1155690644 18:28618229-28618251 ACTTGCCAAAGCAAGTTTTAAGG + Intergenic
1158239083 18:55356478-55356500 GCGTGCAAAAGCAAAATTAAAGG - Intronic
1160114752 18:76066962-76066984 TCTTGAAAAAGCAAAATTGAAGG - Intergenic
1164531699 19:29053464-29053486 TCTTTCCAAAGCAAGCCTCAAGG - Intergenic
1166013342 19:39960270-39960292 TCTTGAAAACACAAGATTAAAGG - Intergenic
925963051 2:9036481-9036503 TCTTGGAAAAGCAAGATTTGTGG + Intergenic
928556863 2:32435711-32435733 TATTGCCAAAGCAGAATTATAGG - Intronic
928754161 2:34503804-34503826 TCTTAACAGTGCAAGATTAATGG - Intergenic
929415450 2:41742682-41742704 TCTTGCCAAAAAAATAATAAGGG - Intergenic
929558430 2:42940005-42940027 TCTGGCCAAAGCGACATTAAAGG + Intergenic
931173883 2:59833454-59833476 TATTGCCATAGCAAGGTTTAGGG + Intergenic
932342271 2:70972716-70972738 TAATGCAAAAGAAAGATTAAAGG - Intronic
932984839 2:76713117-76713139 TATTACCAAACCAATATTAATGG - Intergenic
935948611 2:108308665-108308687 TCTTTCCAAAGTAAGATATAAGG + Exonic
941545117 2:166840630-166840652 ACTTGCCAAACAAAGATTAAAGG + Intergenic
941735058 2:168965107-168965129 TGTTACCAAGGCAAGATTCATGG + Intronic
942224932 2:173806642-173806664 TCATGTCAGAGCAAGAATAAAGG + Intergenic
942723044 2:178974070-178974092 TCTTTCCTATGTAAGATTAAAGG - Intronic
943884191 2:193192251-193192273 TCTTGAGTAAGCAAGATCAAAGG - Intergenic
943922451 2:193726338-193726360 TATGGCCAAATCCAGATTAAGGG + Intergenic
944315794 2:198284537-198284559 TATTGCCAAAGCAAGTCTTAAGG + Intronic
944592072 2:201227380-201227402 TGTTGCCAAAGCAAGGATAAGGG + Intronic
945616295 2:212072553-212072575 ACTTGCCAAAGCAAGAAAGAGGG + Intronic
946564452 2:220948072-220948094 TCTTTCTAAAGCAACATTCAAGG - Intergenic
1169727283 20:8749292-8749314 TCTTGCGAAAGAAAGATGCAGGG - Intronic
1169834610 20:9864346-9864368 TGTTTCAAAAGAAAGATTAAGGG - Intergenic
1171269570 20:23803171-23803193 AGTTGCTAAAGAAAGATTAATGG - Intergenic
1176895261 21:14370097-14370119 TCTTGCCAAAACAAGAATTAAGG + Intergenic
1177491889 21:21836814-21836836 TGTTGCTAAAGCAATACTAAGGG - Intergenic
1181907103 22:26207231-26207253 TGGTGTCAAAGCAAGATGAATGG - Intronic
1184294741 22:43516220-43516242 TCTTCCCAAAGCAAGACTCTGGG - Intergenic
1185305500 22:50113242-50113264 TCTTTCCAAAGCAAGTTTAGTGG + Intronic
949276096 3:2283599-2283621 TCCTTCCAAAACAAGTTTAAAGG - Intronic
949880995 3:8660542-8660564 CCCTGCCAGAGCAAGATTGAAGG + Intronic
950218093 3:11174080-11174102 TCTTGCCCAGGCAAAATTAGTGG + Intronic
950510968 3:13426540-13426562 TCTCCCCAAAGCAAGCTCAAAGG + Intergenic
952613535 3:35241120-35241142 TCCTGCTAGAGCATGATTAAAGG + Intergenic
953461114 3:43081775-43081797 ACTGGCCAAAGCAAGTTAAATGG - Intronic
956211304 3:66804349-66804371 TCTGGCCAAAGAAATATAAAAGG + Intergenic
956716159 3:72081774-72081796 TTTTCCCAAAGAAAGATAAAGGG + Intergenic
956827170 3:73008074-73008096 ATTTCCCAAAGCAAGATTAAGGG - Intronic
957529194 3:81418490-81418512 TCTTGACAAAGCATGAATAATGG + Intergenic
957877487 3:86167378-86167400 TGTTGAAAAAGCAAGATAAAAGG + Intergenic
958869873 3:99545037-99545059 ACGTGCCAAAGAAATATTAATGG + Intergenic
959340545 3:105124549-105124571 TCTAGCCAGTGCAGGATTAAAGG - Intergenic
959737956 3:109682578-109682600 TCTTGCTCATGCTAGATTAAAGG - Intergenic
960351735 3:116602297-116602319 TCTTCCAAAAGCATGATGAATGG + Intronic
961938840 3:130615878-130615900 TCTTGCCAAAGCAAGATTAAAGG - Intronic
963345893 3:144096422-144096444 TCTTGGCAAAGAATCATTAAGGG - Intergenic
963787769 3:149552341-149552363 TCTCCCCAAAGTAAGGTTAAGGG + Intronic
965241916 3:166211951-166211973 TCATGCCACAGCAAGAATCAAGG + Intergenic
967204239 3:187104624-187104646 TTTTGCCAAAGAGAGATTGAAGG + Intergenic
967904480 3:194488541-194488563 TCTTGCCTGAGCAAGGTGAAGGG - Intronic
970318006 4:14847587-14847609 TCTGGCCCAAGCAAGGTTATAGG - Intergenic
971193003 4:24445630-24445652 TCTTGCCCCACCCAGATTAAAGG - Intergenic
971527054 4:27633201-27633223 TTTTGCAAAAGCAATATTGATGG + Intergenic
972676131 4:41261232-41261254 GCTTCCCAAACCAAGATTATGGG - Intronic
974896484 4:67945886-67945908 TCTTTCCAAAACAATATTCAGGG - Intronic
977063069 4:92279659-92279681 TCTAGGCAAAGTAAGATTCAAGG + Intergenic
977298422 4:95237787-95237809 GCTTCCCAAAGCAGGATTACAGG - Intronic
977459990 4:97313012-97313034 TCTTGCCAAAACAACCTTAATGG + Intronic
981828412 4:148971849-148971871 TCTTGTGAAAGCAAAAGTAAAGG - Intergenic
983147794 4:164240177-164240199 TATTGACAAAACAAGAGTAAAGG - Intronic
983160790 4:164411726-164411748 TTTTGCCAAAGCAAGTCTCAAGG + Intergenic
985246162 4:187981764-187981786 TCTTTCCAAAAAAAGATTGATGG + Intergenic
986921674 5:12691454-12691476 TATTGCCTAAGGAAGATAAAAGG + Intergenic
987777084 5:22382004-22382026 TCCGGCCAAAGCAACATAAAGGG - Intronic
987945722 5:24606008-24606030 TCTTGCAAAAGCAAAAGTATAGG + Intronic
988581806 5:32474997-32475019 TCTTGCCAATGAAATATTAAAGG - Intergenic
989985792 5:50696443-50696465 TCTTTCCAAACAAAGATTATGGG - Intronic
990515259 5:56525410-56525432 TCCTGCCAAACCAAACTTAATGG + Intronic
991135496 5:63177153-63177175 TCCAGACAAAGCAAGATTGAAGG + Intergenic
992123284 5:73615911-73615933 TCTTGCCACAGCATAACTAAAGG + Intergenic
993771099 5:91928260-91928282 TCTTGCCATAGAAAAATTATAGG + Intergenic
995201300 5:109427677-109427699 TCTTTCCAAAACAAAATTAGGGG - Intergenic
995840983 5:116443011-116443033 TTTTGCCAAAGAAAAATCAAAGG + Intergenic
995892885 5:116975649-116975671 TTTTGCCAAAGCCAGATGAAAGG - Intergenic
996925973 5:128827145-128827167 TCTTCCTAAAGCAAAATTTAGGG - Intronic
997865078 5:137454715-137454737 CTTTGCCAAAACAAAATTAAGGG - Intronic
998211487 5:140202395-140202417 TCTTGCCAGAGCAGAATTTAAGG + Intronic
1000772268 5:165369582-165369604 TCCTGACAAAGCAAAAATAAGGG + Intergenic
1003040091 6:2679953-2679975 TCTTGCAAATGCTAAATTAATGG + Intronic
1003650687 6:7957254-7957276 TCTTGCCTTTGCAAGATAAATGG - Intronic
1004016324 6:11735275-11735297 TCTTGGGAAAGCAAGATGAGTGG + Intronic
1008721985 6:54365600-54365622 TCTAGCCAAAGGAATATGAATGG - Intronic
1011464181 6:87638443-87638465 TCTTTCCAAAGCATCATTCAGGG - Intronic
1015628986 6:135211926-135211948 TGTTGCTAAGGTAAGATTAATGG - Intronic
1016403225 6:143702823-143702845 TTTCACCGAAGCAAGATTAAAGG - Intronic
1021205234 7:17772237-17772259 GCTTTCCAAAGGAAGATGAAAGG - Intergenic
1023199507 7:37680726-37680748 TCTTTCCAGAGCAACATTATAGG + Intergenic
1026633455 7:72059432-72059454 TTTTGCCAAGGCAAGAATGAGGG - Intronic
1027141940 7:75663841-75663863 TCCTGCTAAGGCAAGATTACAGG + Intronic
1029333355 7:99878721-99878743 TCCTCCCATAGCAAGATTCATGG + Intronic
1031022777 7:116645948-116645970 ATTGGCCAAAGGAAGATTAATGG + Intergenic
1032674911 7:134120831-134120853 TTTGGCCAAAGCAAGTTTCACGG + Intergenic
1032776161 7:135115421-135115443 TCTTTCCAAAGCAAGAAGACTGG + Exonic
1033507820 7:142023371-142023393 TCTTGACTAAGCAGAATTAATGG + Intronic
1033665868 7:143440018-143440040 TCTTGCAAGAGGATGATTAAAGG + Intergenic
1038379723 8:27081303-27081325 TCTTGCCAAAGACAGATATATGG - Intergenic
1038903421 8:31870177-31870199 TCTTGCAGAAGCAAGATAAGAGG + Intronic
1041692529 8:60703024-60703046 TCTGGCCAAAGCAAGTTACATGG + Intronic
1041809366 8:61890313-61890335 TATTGCTAATTCAAGATTAATGG + Intergenic
1042873846 8:73423082-73423104 TCTTTCCAAAGTAAGCATAAAGG + Intronic
1043789095 8:84440564-84440586 TCTTGCCAAGGTAAAATTACAGG - Intronic
1044381144 8:91535338-91535360 TCTTGCCAATTGAATATTAATGG - Intergenic
1045775367 8:105796245-105796267 TATTGCCAAAGAAAGATTCTAGG + Intronic
1048657548 8:136557990-136558012 TCTTGCCAAAGCTAGTCTGAAGG - Intergenic
1050112459 9:2231069-2231091 TCTTTCTAAAGCATGTTTAAGGG + Intergenic
1050685902 9:8169113-8169135 TTTTGCAAAGGCAGGATTAAAGG - Intergenic
1053154073 9:35762174-35762196 TCATGCCAGAGCAAGAGCAAGGG + Intergenic
1055108734 9:72538939-72538961 TCATGCCATAGCAAGATGAGAGG - Intronic
1055183455 9:73419772-73419794 TCTAGCCAAAGTAAAATGAAAGG + Intergenic
1056026944 9:82508214-82508236 TATTGCCAAAGAAAGAAAAAAGG + Intergenic
1056322175 9:85445868-85445890 TCTGGCCAAAGCAAGGTATATGG - Intergenic
1058304098 9:103415100-103415122 TCATGCCAAAATAAGAATAATGG - Intergenic
1059566665 9:115389204-115389226 TATTGCCAAAGCAAGAATCCTGG + Intronic
1060496031 9:124119185-124119207 TGCTGCCAAAGCCAGAATAAGGG + Intergenic
1188339498 X:28981543-28981565 TCTTGCCAAAGGGATGTTAAGGG - Intronic
1189238837 X:39509823-39509845 TCTGGCCAAAGCAAGTTACATGG + Intergenic
1189649683 X:43176198-43176220 TTTTGTTATAGCAAGATTAATGG - Intergenic
1189853173 X:45196967-45196989 TCTTGCCAAAGGAAAGATAAAGG + Intronic
1192080283 X:68041151-68041173 TCATGGCAAAGCAACATGAATGG - Intergenic
1193259486 X:79388713-79388735 TTTTGCCAAAGAAAGAGTACTGG + Intergenic
1194794093 X:98188506-98188528 TTTTGCCAAGACAAGATGAAAGG + Intergenic
1195113803 X:101675321-101675343 TCATGCCAAAGAAAGATAAATGG + Intergenic
1195844486 X:109210868-109210890 CATAGCCAAAGCAAGAATAAGGG - Intergenic
1195919822 X:109972466-109972488 TGTTGCCAAAGCAGTATCAAGGG - Intergenic
1196429884 X:115613042-115613064 AGTTTCCATAGCAAGATTAAAGG - Intronic
1196809559 X:119618345-119618367 TGTTGACAAAGCAAGAATATAGG - Exonic
1197807979 X:130415704-130415726 TCTGGCCAAAACAGGATTCACGG - Intergenic