ID: 961950713

View in Genome Browser
Species Human (GRCh38)
Location 3:130746675-130746697
Sequence CCCTCGAGGAGGGCTCGGAC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 69}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961950713_961950724 -5 Left 961950713 3:130746675-130746697 CCCGTCCGAGCCCTCCTCGAGGG 0: 1
1: 0
2: 0
3: 3
4: 69
Right 961950724 3:130746693-130746715 GAGGGCCTCACCACCGGGCGGGG 0: 1
1: 0
2: 0
3: 8
4: 107
961950713_961950723 -6 Left 961950713 3:130746675-130746697 CCCGTCCGAGCCCTCCTCGAGGG 0: 1
1: 0
2: 0
3: 3
4: 69
Right 961950723 3:130746692-130746714 CGAGGGCCTCACCACCGGGCGGG 0: 1
1: 0
2: 0
3: 5
4: 95
961950713_961950720 -10 Left 961950713 3:130746675-130746697 CCCGTCCGAGCCCTCCTCGAGGG 0: 1
1: 0
2: 0
3: 3
4: 69
Right 961950720 3:130746688-130746710 TCCTCGAGGGCCTCACCACCGGG 0: 1
1: 0
2: 0
3: 9
4: 177
961950713_961950722 -7 Left 961950713 3:130746675-130746697 CCCGTCCGAGCCCTCCTCGAGGG 0: 1
1: 0
2: 0
3: 3
4: 69
Right 961950722 3:130746691-130746713 TCGAGGGCCTCACCACCGGGCGG 0: 1
1: 0
2: 0
3: 6
4: 44
961950713_961950732 11 Left 961950713 3:130746675-130746697 CCCGTCCGAGCCCTCCTCGAGGG 0: 1
1: 0
2: 0
3: 3
4: 69
Right 961950732 3:130746709-130746731 GGCGGGGGGAGATGGAACCCGGG 0: 1
1: 0
2: 1
3: 20
4: 327
961950713_961950726 -3 Left 961950713 3:130746675-130746697 CCCGTCCGAGCCCTCCTCGAGGG 0: 1
1: 0
2: 0
3: 3
4: 69
Right 961950726 3:130746695-130746717 GGGCCTCACCACCGGGCGGGGGG 0: 1
1: 0
2: 0
3: 6
4: 146
961950713_961950728 3 Left 961950713 3:130746675-130746697 CCCGTCCGAGCCCTCCTCGAGGG 0: 1
1: 0
2: 0
3: 3
4: 69
Right 961950728 3:130746701-130746723 CACCACCGGGCGGGGGGAGATGG 0: 1
1: 0
2: 3
3: 13
4: 201
961950713_961950725 -4 Left 961950713 3:130746675-130746697 CCCGTCCGAGCCCTCCTCGAGGG 0: 1
1: 0
2: 0
3: 3
4: 69
Right 961950725 3:130746694-130746716 AGGGCCTCACCACCGGGCGGGGG 0: 1
1: 0
2: 0
3: 9
4: 112
961950713_961950731 10 Left 961950713 3:130746675-130746697 CCCGTCCGAGCCCTCCTCGAGGG 0: 1
1: 0
2: 0
3: 3
4: 69
Right 961950731 3:130746708-130746730 GGGCGGGGGGAGATGGAACCCGG 0: 1
1: 0
2: 4
3: 36
4: 462

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961950713 Original CRISPR CCCTCGAGGAGGGCTCGGAC GGG (reversed) Exonic
900183119 1:1321082-1321104 CCCTCGAGTAGGGGCCGGCCAGG - Exonic
901919713 1:12527581-12527603 CCCTCGGGGAGGGCAGGGCCTGG + Intergenic
902224561 1:14988450-14988472 CCCTCCAGCAGGGCTGGGCCGGG - Intronic
903175559 1:21578099-21578121 CCCTGAAGGAGGGCTGGGCCTGG - Exonic
905803657 1:40861470-40861492 CCCTCGCGGAGGGCGCGCGCGGG + Exonic
913173913 1:116256729-116256751 CCCTCAAGGAAGGCTAGGACAGG - Intergenic
919854584 1:201696461-201696483 CCCTCGAGGAAGCATTGGACAGG + Intronic
1063348694 10:5335425-5335447 CCCTCAAGGAGGTCACAGACTGG - Intergenic
1070913228 10:80136145-80136167 CCCCAGAGGAGGGCTCGGCTGGG - Intronic
1070954168 10:80453978-80454000 CCCACTGGGAGGGCGCGGACCGG + Intergenic
1074067079 10:110025833-110025855 CCCTAGAGCAGGGTTTGGACAGG + Intronic
1076625249 10:131817949-131817971 CCCTCGGGGAGGGGTGGGAAGGG - Intergenic
1076720367 10:132389720-132389742 CACTGGAGGAGGGCAAGGACAGG + Intergenic
1091553426 12:1554063-1554085 CCCTCATGAAGGGCTCGGCCTGG + Intronic
1092155439 12:6278929-6278951 GCTCCGAGGAGGGCGCGGACGGG - Intergenic
1095773638 12:45990102-45990124 CCCGCGAGGGAGGCTCGGCCCGG - Intronic
1096754806 12:53790357-53790379 CTATCCAGGAAGGCTCGGACAGG - Intergenic
1103825841 12:123737255-123737277 CACTGGAGGAGGGCTCGGTAAGG + Exonic
1120186212 14:81396113-81396135 CCCCGGAGGAGCTCTCGGACTGG + Exonic
1121536521 14:94694882-94694904 CCCTCGAGGTGGGCTTCGAAAGG + Intergenic
1122924451 14:104893175-104893197 CCCTCGAGGAGGGTCAGGCCAGG + Intronic
1132614825 16:835323-835345 GCCTCCAGGAGGGCCTGGACTGG + Intergenic
1132641534 16:980678-980700 CCCGCGAGGTGGCCTCGGCCCGG - Intronic
1132844049 16:1991911-1991933 CGCTCGAGGCGGGCTCGCAGAGG + Intronic
1136370653 16:29834022-29834044 CCCGCAAGGAGTGCTGGGACCGG + Exonic
1136383289 16:29907017-29907039 GCCTCCAGGAGGGCTGGGTCTGG + Exonic
1136392527 16:29974431-29974453 CCCTCGACGAGGGGGAGGACTGG + Exonic
1138598325 16:58041206-58041228 GCCCCGAGGAGGGCTCGGTGTGG - Intronic
1139529728 16:67537355-67537377 CCCTCGGGGAGGGGACCGACGGG - Intronic
1144951912 17:18998930-18998952 CTCTGGAGGAGGGCTGGGACGGG - Intronic
1146658561 17:34649550-34649572 CCCTGGAGAAGGGCTCTAACTGG + Intergenic
1148540555 17:48477158-48477180 CCCTTGAAGAAGGCTCTGACAGG - Intergenic
1152693951 17:81734565-81734587 CCCTCGGGGAGGGCACGGCAGGG + Intergenic
1155335095 18:24755517-24755539 CCCTCGAGGAGCCCACTGACTGG - Intergenic
1156577680 18:38337665-38337687 CCCTAGATGAGGTCTCAGACAGG + Intergenic
1161314930 19:3613316-3613338 CCTCCGAGGAGGGCCCGGGCGGG + Exonic
1161947129 19:7444390-7444412 CCCTGGAGGAGGGCAGTGACCGG + Exonic
1164648030 19:29873406-29873428 CCCGCGGGGAGGGCGCGGAGCGG - Intergenic
1165327792 19:35124425-35124447 CCCTGGAGCAGTGCTCGGAGCGG - Intergenic
1165832844 19:38737661-38737683 CCCTCGAGGTGGGGCCGGGCAGG - Intronic
934618682 2:95791158-95791180 CCCTGGAGGAGGGCTTCGAATGG + Intergenic
934642211 2:96033399-96033421 CCCTGGAGGAGGGCTTCGAATGG - Intronic
936286376 2:111184502-111184524 TCCTGGAGGAGGGCTGGGGCTGG - Intergenic
1179010585 21:37553042-37553064 CCCTCGAGGCGGCCTGGGCCTGG + Intergenic
1182222975 22:28773094-28773116 CCCTCGCGGCGGGCGCGGGCAGG + Intronic
1183501441 22:38181885-38181907 GCCTAGAGGAGGCCTGGGACAGG - Intronic
952706265 3:36380663-36380685 CCCGCGAGGACGGCGTGGACGGG + Exonic
952905747 3:38138272-38138294 CCCTCGAGGATGGCGAGGAGGGG - Intergenic
960622756 3:119652660-119652682 ACCTCCAGGAGGGCTCAGTCAGG - Intronic
961950713 3:130746675-130746697 CCCTCGAGGAGGGCTCGGACGGG - Exonic
970481970 4:16485302-16485324 CCCTAGAGAAGGGCTTGGCCTGG - Intergenic
976199057 4:82561689-82561711 CGCCCGCGGAGGGCTCGGGCGGG + Intronic
985305827 4:188538451-188538473 CTCTCGTGGAGGCCTCGGACTGG + Intergenic
985616549 5:926531-926553 GCCGCGAGGACAGCTCGGACGGG - Intergenic
1001709673 5:173768125-173768147 CCCTCCAGGAGGTCAGGGACAGG + Intergenic
1002198764 5:177515138-177515160 TCCTTGAGGAGGGCTGGAACAGG - Intronic
1007377670 6:41467760-41467782 CCCTAGAGCTGGGCTCCGACTGG - Intergenic
1015843837 6:137497728-137497750 CCCTTTCGGAGGGCTCAGACCGG + Intergenic
1018629464 6:165809746-165809768 CCCACTAGGAGGGCTGGGAAGGG - Intronic
1019178781 6:170174851-170174873 CCCAGGAGGAGGCCTGGGACAGG - Intergenic
1019488290 7:1299404-1299426 CCGGAGAGGAGGGCTGGGACCGG + Intergenic
1019631995 7:2054312-2054334 CGCACGTGGAGGGCTCGGGCTGG + Intronic
1023374181 7:39539595-39539617 CCCTCAAGGAGCTCTCAGACTGG + Intergenic
1026446339 7:70487958-70487980 CCCTCGTAGAGGGCTCCGAAGGG + Intronic
1026949757 7:74339105-74339127 GACTCGAAGGGGGCTCGGACAGG + Intronic
1036210037 8:6834456-6834478 CCCTCCAGCTGGGCACGGACTGG - Intronic
1036520092 8:9483726-9483748 CTCTCTAGGAGAGCTCTGACTGG - Intergenic
1036868746 8:12421407-12421429 TCCTCCAGGAGGGCTGGGCCTGG + Intergenic
1037865884 8:22441556-22441578 CACCCTAGGAGGGCTCGGAGGGG + Intronic
1057337210 9:94165779-94165801 CCCTCCAGGAGGCCTTGGCCAGG - Intergenic
1190123481 X:47683224-47683246 CTCTCTAGGAGAGCTCTGACCGG + Intergenic
1196288926 X:113915867-113915889 CTCTCTAGGAGAGCTCTGACTGG - Intergenic
1200249142 X:154542907-154542929 CCCATGAGGAGGGCAGGGACTGG + Intronic