ID: 961952155

View in Genome Browser
Species Human (GRCh38)
Location 3:130761575-130761597
Sequence CACTGATTGTCCCCCACAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961952148_961952155 29 Left 961952148 3:130761523-130761545 CCTGCCCATCACAAATGAGCTCT No data
Right 961952155 3:130761575-130761597 CACTGATTGTCCCCCACAACAGG No data
961952150_961952155 24 Left 961952150 3:130761528-130761550 CCATCACAAATGAGCTCTAATGG No data
Right 961952155 3:130761575-130761597 CACTGATTGTCCCCCACAACAGG No data
961952149_961952155 25 Left 961952149 3:130761527-130761549 CCCATCACAAATGAGCTCTAATG No data
Right 961952155 3:130761575-130761597 CACTGATTGTCCCCCACAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961952155 Original CRISPR CACTGATTGTCCCCCACAAC AGG Intergenic
No off target data available for this crispr