ID: 961958431

View in Genome Browser
Species Human (GRCh38)
Location 3:130828288-130828310
Sequence GTGAGCAGGGCTGAGACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 375
Summary {0: 1, 1: 1, 2: 4, 3: 29, 4: 340}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961958431_961958437 -7 Left 961958431 3:130828288-130828310 CCCACAGTCTCAGCCCTGCTCAC 0: 1
1: 1
2: 4
3: 29
4: 340
Right 961958437 3:130828304-130828326 TGCTCACTGGTGTGAAGGACTGG 0: 1
1: 0
2: 2
3: 14
4: 178
961958431_961958439 25 Left 961958431 3:130828288-130828310 CCCACAGTCTCAGCCCTGCTCAC 0: 1
1: 1
2: 4
3: 29
4: 340
Right 961958439 3:130828336-130828358 ACAGAGCTCTACTTACAGCCTGG 0: 1
1: 0
2: 0
3: 13
4: 135
961958431_961958438 -2 Left 961958431 3:130828288-130828310 CCCACAGTCTCAGCCCTGCTCAC 0: 1
1: 1
2: 4
3: 29
4: 340
Right 961958438 3:130828309-130828331 ACTGGTGTGAAGGACTGGCAAGG 0: 1
1: 0
2: 0
3: 14
4: 163
961958431_961958440 28 Left 961958431 3:130828288-130828310 CCCACAGTCTCAGCCCTGCTCAC 0: 1
1: 1
2: 4
3: 29
4: 340
Right 961958440 3:130828339-130828361 GAGCTCTACTTACAGCCTGGAGG 0: 1
1: 0
2: 0
3: 12
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961958431 Original CRISPR GTGAGCAGGGCTGAGACTGT GGG (reversed) Intergenic
900323574 1:2096549-2096571 GTGAGCAGTGCAGATGCTGTTGG + Intronic
900362048 1:2293833-2293855 GTGAGCAGGCCTGTGGCTGCAGG + Intronic
900618577 1:3576675-3576697 GTGTGCAGGGCTGAGTGTGCAGG - Intronic
900618581 1:3576717-3576739 GTGTGCAGGGCTGAGGGTGCAGG - Intronic
903021844 1:20400369-20400391 GTGGGTAGGTCTGAGGCTGTGGG - Intergenic
903791696 1:25897639-25897661 GTGAGCAGGTCTGAGGCAGAGGG + Intronic
903884434 1:26532620-26532642 GTGAGCAGGGCTGCCAATGCTGG + Intronic
904508916 1:30985252-30985274 CTCAGAAGGGCTGAGTCTGTTGG - Intronic
905206708 1:36346838-36346860 GTTTGCAGGGCTCAGGCTGTGGG - Intronic
905533730 1:38702282-38702304 GGGAGCAGGAGGGAGACTGTGGG - Intergenic
905770682 1:40636171-40636193 ATGAGCAGGGCTCTGACTGGAGG + Intronic
906568265 1:46815617-46815639 GTGAACAGAGCTGAGACAGCTGG + Intronic
907627381 1:56043456-56043478 GAGACCAGGGCAGAGACTGGAGG - Intergenic
909476189 1:76083309-76083331 GTGAGCAGGGCTGTGATTCCTGG + Intronic
909525233 1:76614879-76614901 GAGATCAGGGCTGTGACTGGGGG + Intronic
910564682 1:88630407-88630429 GTGAGAAGGGATGAGTCTGGAGG + Intergenic
911182858 1:94876431-94876453 GTAAGCAAGGCAGTGACTGTAGG + Intronic
913154714 1:116084663-116084685 GGGTGCAGGGCTGAGGCTGCAGG + Intergenic
915941031 1:160118295-160118317 AGGAGCAGGGCTGGGTCTGTGGG - Intronic
916787954 1:168099766-168099788 ATGGGCAGGGCTGTGCCTGTGGG - Intronic
917703827 1:177611595-177611617 ATGAACAGGACTGAGCCTGTAGG + Intergenic
917933438 1:179840295-179840317 GAGAGTAGGGCTGTGACTGCCGG + Exonic
918099741 1:181363169-181363191 GAGAGCAGGGATGAGATTTTAGG - Intergenic
919796446 1:201324094-201324116 GGGGGCAGCGCTGAGACAGTGGG + Intronic
920117248 1:203629544-203629566 GGGGGAAGGGCTGAGACTGCGGG - Intronic
922096439 1:222446867-222446889 GTGAGCAGAGCTTCGACTCTTGG - Intergenic
922157444 1:223051483-223051505 GTGAGCAGAGCTGAGACATGTGG - Intergenic
922986845 1:229872640-229872662 GTGAGAAGAGCTGAGACAGACGG - Intergenic
923117794 1:230959826-230959848 GTAAGCAGGGATGAGAAAGTTGG - Intronic
923308436 1:232709942-232709964 GTGAGCAGGGGATGGACTGTAGG - Intergenic
923361173 1:233212640-233212662 GAGGGCAGTGCTGAGACAGTAGG - Intronic
923511190 1:234655374-234655396 TTGAGAAGTGCAGAGACTGTGGG + Intergenic
924528842 1:244876349-244876371 GTGAGCAGGGCTGAGAGAGAGGG + Intergenic
924592220 1:245414476-245414498 CTGAGCAGGGCTGAAGCCGTGGG + Intronic
1063469488 10:6272979-6273001 GTGAGTGGGGCTGAGATTGCAGG + Intergenic
1063474686 10:6318116-6318138 GTTAGCAGGGCTGTGTCTTTTGG + Intergenic
1063601233 10:7483079-7483101 GTGAGAAGTTCTGAGACTGTGGG + Intergenic
1065945353 10:30601046-30601068 GTGTGCAGGGCTGGGACAGAGGG + Intergenic
1067699363 10:48557689-48557711 GAGAGCCAGGCTGTGACTGTGGG + Intronic
1067788576 10:49270961-49270983 GTGAGCAGGGCTGATTCTGAGGG + Intergenic
1067850610 10:49751603-49751625 GTGGGCAGGGATGAGGCTCTAGG - Intronic
1068947190 10:62741339-62741361 GTGAGCGGGGCTGAGGTTGGAGG - Intergenic
1069626237 10:69869288-69869310 CTGAGCTGGGCTCAGAATGTGGG - Intronic
1069750863 10:70744190-70744212 GTGAGCCGGGCTGGGGCTGGGGG + Intronic
1071057898 10:81531879-81531901 ATGAGGAGGGCTGAAACTGAGGG + Intergenic
1073534800 10:104267307-104267329 GTAAGCAGGGCTGAGACTGTGGG - Exonic
1073766256 10:106685925-106685947 TTGTGCTGGGCTGAGAGTGTGGG + Intronic
1074569611 10:114612490-114612512 GTGTGCCAGGCTGAGGCTGTGGG - Intronic
1075105344 10:119536538-119536560 GTGAGAAAGGCAGAGACTGGAGG + Intronic
1076196712 10:128523841-128523863 GGGAGCAGGGCTCAGAGTGCTGG - Intergenic
1076565051 10:131392946-131392968 ATGAACAGGGCTGGGAGTGTGGG + Intergenic
1076802260 10:132836053-132836075 GTGAGCAGGGCTGTGTCGGGAGG - Intronic
1077080809 11:723975-723997 GGGAGCCAGGCTGACACTGTGGG - Intronic
1077222364 11:1423407-1423429 GGGAGAAGTTCTGAGACTGTGGG + Intronic
1077288278 11:1777334-1777356 GTGATCAGGGCTGAGCTGGTAGG + Intergenic
1077378795 11:2218241-2218263 GGGAACAGGCCTGAGACAGTTGG + Intergenic
1081622175 11:44625069-44625091 ATGAGCAGGGCTGACCCTTTGGG + Intergenic
1081876860 11:46414454-46414476 GAGAGGTGGGCTGAGACTATGGG - Intronic
1081965065 11:47164462-47164484 GGGGGCTGGGCTGAGACTGCCGG + Exonic
1082640763 11:55657880-55657902 CTGAGCAGGGCTGGAGCTGTGGG - Intergenic
1083309122 11:61775503-61775525 GTGGGCATGGCTGGGTCTGTCGG + Intronic
1083453377 11:62761661-62761683 GTGAGCAGGGCTCAGGGTGGCGG + Intronic
1084965856 11:72744112-72744134 GTGATCAGGGCTGTGACTGTGGG - Intronic
1085046708 11:73357748-73357770 TTGTTCAGGGCTGAGACTGTTGG + Intronic
1085236193 11:75017395-75017417 TTGAGCAGGGCTGCTACTGTTGG + Intronic
1085470455 11:76754161-76754183 GGGACCAGGGCAGAGACTGTGGG - Intergenic
1085511276 11:77089362-77089384 GTGAGCAGAGCTGTGACAGCAGG - Intronic
1085590695 11:77757312-77757334 GTGAGCAGGTCTGTGAAAGTGGG + Intronic
1086166286 11:83782700-83782722 ATGAGAAAGGCTGATACTGTGGG + Intronic
1086267326 11:85016864-85016886 GTGAGGATGGCTGTGGCTGTGGG - Intronic
1086536012 11:87847625-87847647 GTGAGTAGGGGTGAGATGGTGGG + Intergenic
1087755941 11:102054919-102054941 GTGAGGAGGGTTGAGAGGGTAGG - Intronic
1091856571 12:3745449-3745471 CTGAGCAGGGCTGAAATTTTAGG - Intronic
1094491604 12:30964107-30964129 GTGGGAGGGGCTGAGGCTGTGGG + Intronic
1101234642 12:102776261-102776283 TTTAGTAGGGGTGAGACTGTGGG - Intergenic
1101879651 12:108617523-108617545 GTCAGCAGGGCTGAGGTTTTGGG + Intergenic
1102341064 12:112121999-112122021 TTGAGCGGGGCTGAGGCTGCGGG + Intergenic
1104295131 12:127505043-127505065 GTAAACATGGCTGAGATTGTAGG + Intergenic
1104979949 12:132569296-132569318 GGGAGCAGGGCTGAGGGTGGCGG + Intronic
1105492667 13:20903145-20903167 GTGTGCAGGGCTGAGAACGGAGG - Intergenic
1109300525 13:60585702-60585724 ATGAGCAGATCCGAGACTGTGGG + Intergenic
1109977384 13:69856540-69856562 GTGAGAAGGGCTGAGACCGAGGG - Intronic
1110121367 13:71885851-71885873 GTCAGCAGTGCTGAGGCTGAGGG + Intergenic
1110258588 13:73459467-73459489 GTGAGCTGTGCTGAGAGTGGAGG + Intergenic
1112086947 13:96041624-96041646 GCGAGCAGGGCTGAGAACTTAGG - Intronic
1112751895 13:102591920-102591942 GAGAGCAGGACTGAAAATGTGGG - Intergenic
1114356775 14:21918468-21918490 GTGAGCAGAGGAGAGAGTGTGGG + Intergenic
1114649829 14:24277462-24277484 GAGGGCAGGGCTGAGGGTGTGGG + Intergenic
1115224720 14:31090594-31090616 GTAAGAAGGGCCCAGACTGTTGG - Intronic
1118194493 14:63612184-63612206 GTGACTAGGGCAGAGATTGTTGG - Intronic
1118729152 14:68654586-68654608 GTGAACAGGGCTGTTTCTGTGGG + Intronic
1119431634 14:74571775-74571797 GTGGGCAGGGCTGAGGCTCCAGG + Intronic
1121272314 14:92646202-92646224 GTGAGCAAGGCTGAGAATCAGGG - Intronic
1122259436 14:100504067-100504089 GTGAGGAGGGTGGAGACTATTGG - Intronic
1122494199 14:102140222-102140244 GGGAGCAGGGCGGTGACAGTGGG + Intronic
1124373161 15:29114931-29114953 GTGTGCACGGCTGTGGCTGTGGG + Intronic
1125201901 15:37107386-37107408 GAAAGCAGGGAGGAGACTGTTGG - Intergenic
1126464026 15:48944228-48944250 GTGGCCAGGGCAGAGACTCTGGG + Intronic
1127879972 15:63148507-63148529 CTGAGCAGGGCTGAAGCTGAGGG + Exonic
1129756309 15:78101261-78101283 GGGAGCAGGGCTGAGCCTCTTGG - Exonic
1130007145 15:80110710-80110732 GTGGGCAAAGATGAGACTGTAGG + Intronic
1130939840 15:88498252-88498274 GTGAGCATGGCTGTGTCTGCAGG - Intergenic
1131369393 15:91867118-91867140 GTTAGCAGCGCGGAGGCTGTCGG + Intronic
1132395961 15:101474664-101474686 CTGAGCAGGGCAGAGAATGGTGG - Intronic
1132673987 16:1114172-1114194 GTGAGTGGGGCTGAGGCTGGTGG - Intergenic
1132696277 16:1203466-1203488 GTGAGCAGGAATGCGGCTGTGGG + Intronic
1132708153 16:1255209-1255231 GGGAGCTGGGCTGGGGCTGTGGG + Intergenic
1132829397 16:1920000-1920022 GTGGGGACTGCTGAGACTGTGGG - Intergenic
1132829439 16:1920161-1920183 GTGGGGACGGCTGAGACCGTGGG - Intergenic
1132829454 16:1920215-1920237 GTGGGGATGGCTGAGACCGTGGG - Intergenic
1132829474 16:1920287-1920309 GTGGGGATGGCTGAGACCGTGGG - Intergenic
1132829484 16:1920323-1920345 GTGGGGACGGCTGAGACCGTGGG - Intergenic
1132829505 16:1920410-1920432 GTGGGGATGGCTGAGACCGTGGG - Intergenic
1132829510 16:1920428-1920450 GTGGGGACGGCTGAGACCGTGGG - Intergenic
1132829514 16:1920446-1920468 GTGGGGATGGCTGAGACTGTGGG - Intergenic
1132879575 16:2155986-2156008 GGGGGCGGGGCTGAGACGGTCGG + Intronic
1133282814 16:4676748-4676770 GTGAGCAGGACTGGCACTGTGGG + Intronic
1134824580 16:17274372-17274394 TTGAGCAGGGCTGGGTCTGCTGG + Intronic
1135692871 16:24557920-24557942 GTGAGCAGGGTTGGGAGTTTAGG - Intronic
1136573938 16:31112267-31112289 GTGAGCAGGCCAAAGGCTGTGGG - Exonic
1136680344 16:31957543-31957565 GTGAGTAGGGCAGAGTCTGCAGG - Intergenic
1136780688 16:32899088-32899110 GTGAGTAGGGCAGAGTCTGCAGG - Intergenic
1136889724 16:33960582-33960604 GTGAGTAGGGCAGAGTCTGCAGG + Intergenic
1137225242 16:46498756-46498778 GTGAGTAGGGGAGAGAGTGTAGG - Intergenic
1137731506 16:50693689-50693711 GTGGGCTGGGGGGAGACTGTGGG + Intronic
1137770253 16:51010636-51010658 AGGGCCAGGGCTGAGACTGTTGG + Intergenic
1139308050 16:66004969-66004991 AGGAGCAAGGCTGAGACTATCGG + Intergenic
1139364024 16:66422528-66422550 GACAGCTGGGCTGAGACTGTGGG - Intergenic
1141248325 16:82331738-82331760 GTGAGCAGGGCTGAGGGAGGAGG + Intergenic
1141270932 16:82540603-82540625 GGGAGCAGGGCTGAACCAGTGGG - Intergenic
1141659649 16:85435189-85435211 GTGTGCAGGGCCGAGGCTCTGGG - Intergenic
1142109330 16:88322871-88322893 TTGGGCAGGCCTGTGACTGTCGG + Intergenic
1142182359 16:88677465-88677487 GTGAGCAGGGGCGCCACTGTGGG - Intergenic
1142385059 16:89758808-89758830 GAGAGCTGGGTTGAGACTGGCGG + Intronic
1203083343 16_KI270728v1_random:1163117-1163139 GTGAGTAGGGCAGAGTCTGCAGG - Intergenic
1143263012 17:5614299-5614321 GAGAGCAGGGCTGGGAGTGGTGG - Intronic
1143292094 17:5839067-5839089 GTGAGCAGAAGTGAGACAGTTGG + Intronic
1143644868 17:8223613-8223635 GGGAGCAGAGGTTAGACTGTAGG - Intergenic
1144556385 17:16286311-16286333 CTGAGCAGGGCTGGGTCTGGGGG + Intronic
1144624716 17:16838850-16838872 GTGAGGAGGGGTCAGAGTGTGGG - Intergenic
1144645391 17:16970285-16970307 GTGGGCTGGGCTCAGACTCTGGG + Intronic
1144679587 17:17183948-17183970 GTCAGCAGGGCTGAGTGTGATGG + Intronic
1144881714 17:18433871-18433893 GTGAGGAGGGGTCAGAGTGTGGG + Intergenic
1145150519 17:20510515-20510537 GTGAGGAGGGGTCAGAGTGTGGG - Intergenic
1146625267 17:34430591-34430613 GAGAGCATGGCTGAGCCTGGAGG + Intergenic
1147578856 17:41617544-41617566 GTGAGGAGGGGTCAGAGTGTGGG - Intergenic
1148274479 17:46291369-46291391 GTGAGCAGGACTAAAACTGCAGG + Intronic
1149611761 17:57962590-57962612 GGAAGCAGGGCTGAGCCTCTGGG + Intergenic
1150282777 17:63938924-63938946 GGGAGCAGGGCTGAGGCCATGGG + Exonic
1150408576 17:64923186-64923208 GTGAGCAGGACTAAAACTGCAGG - Intergenic
1150760211 17:67954589-67954611 GTGAGCAGGACTAAAACTGCAGG - Intronic
1151435909 17:74097285-74097307 GGGAGCAGGACTGAGACGGACGG - Intergenic
1152586019 17:81189854-81189876 GGGAGCAGGCCTGACCCTGTGGG - Intronic
1152844900 17:82593661-82593683 GGGAGCCGGGCTGAGGCTGCGGG + Intronic
1153645510 18:7192613-7192635 GCGAGCAGGGCTCACCCTGTTGG + Intergenic
1155389494 18:25319304-25319326 GTGAGCATGGCTGAGTGTGGTGG + Intronic
1155439575 18:25847710-25847732 GTGGGCAGGGCTGAGAAGGTAGG - Intergenic
1156919868 18:42508647-42508669 ATGAGCAGGGCTGATACTGTTGG - Intergenic
1158804661 18:60955913-60955935 GTGACCAGGTCTGGGGCTGTAGG + Intergenic
1160013506 18:75124285-75124307 GTGAGCTGGGCGGTGAGTGTGGG + Intergenic
1160167766 18:76529211-76529233 GAGCGCAGGGCTGAGACTGTGGG - Intergenic
1160420435 18:78740317-78740339 GTGTGCACGGCTGAGACAGAAGG - Intergenic
1160443997 18:78913365-78913387 GTGAGCAGGGGTGGGAGTGGGGG - Intergenic
1160832356 19:1109804-1109826 GTGTCCAGGCCTGGGACTGTGGG + Intronic
1161129868 19:2581453-2581475 GAGAACAGGTCTGAGGCTGTGGG + Intronic
1161234298 19:3190273-3190295 GGGAGCAGGGGTGAGGCTGCTGG + Intronic
1161235167 19:3194025-3194047 GGGAGCAGGGCTGAGAAGGGAGG + Intronic
1161470967 19:4456634-4456656 CTGAGCAGGGCTGAGCCAGCTGG - Intronic
1163002633 19:14378152-14378174 GTCAGCAGGACTGAGACTTCAGG + Intergenic
1163064163 19:14780940-14780962 GTCAGCAGGACTGAGACTTCTGG - Intergenic
1163065881 19:14794786-14794808 GTGGGCGGGGCTGAGAGAGTGGG - Intronic
1163155477 19:15437910-15437932 GTGAGCAGGGCTGAGATGCGGGG - Intronic
1163623500 19:18374585-18374607 GTCAGCAGGGCTGGGACCATGGG - Intergenic
1163773184 19:19203008-19203030 GTGAGCAGGTAAGAGTCTGTGGG - Exonic
1163805366 19:19393532-19393554 GTGAGCAGGACTGACACAGCTGG + Intronic
1164863561 19:31583178-31583200 CAGAGGAGGGCTGTGACTGTTGG - Intergenic
1165061777 19:33208298-33208320 GTAAGCCAGGGTGAGACTGTGGG + Exonic
1165309725 19:35022823-35022845 GTGAGGAGGGCTGGGGGTGTCGG + Intronic
1165427748 19:35755228-35755250 GTCGGTGGGGCTGAGACTGTCGG + Exonic
1165913552 19:39244370-39244392 GTGAGCAGGGCTGGGAGGGCAGG + Intronic
1166000291 19:39873542-39873564 GTGAGCGGCGCTGTGAGTGTGGG - Exonic
1167030298 19:46954444-46954466 GTCAGAAGGGCTGAGACAGGTGG + Intronic
1167269712 19:48499938-48499960 GTGAGCAGGGCAGAGACCCAGGG + Intronic
1167506050 19:49871644-49871666 GTGGGTAGGGCTGAGGCTGGGGG + Exonic
1167677178 19:50894602-50894624 TTGAGCAGGGATAAGACTTTAGG - Intergenic
1168116109 19:54222094-54222116 CTGGGCAGGGCTGAGAGGGTGGG + Exonic
1168119091 19:54241842-54241864 CTGGGCAGGGCTGAGAGGGTGGG + Exonic
1168129926 19:54311680-54311702 CTGGGCAGGGCTGAGAGGGTGGG + Exonic
1168185455 19:54697226-54697248 CTGGGCAGGGCTGAGAGGGTGGG - Intronic
1168471919 19:56646919-56646941 ATGAGCAGGGCTGGGACAGAAGG + Intronic
926684074 2:15685103-15685125 GTGAGCTGGGCTGGGACTCAGGG - Intergenic
926685311 2:15693338-15693360 GTGTGCAGTGCTGGGACTGGAGG + Intronic
929083597 2:38146599-38146621 GTGAGGAGGGCAGGGACAGTGGG + Intergenic
929709933 2:44256430-44256452 GTGTGCAGGGCTGCAACTGCTGG - Intergenic
930611124 2:53544995-53545017 TTGGGCAAGGCTGACACTGTGGG - Intronic
930872633 2:56184221-56184243 GTGTGCAGGGCAGAGAGTGCGGG + Exonic
932410859 2:71546915-71546937 GTGTGCAGGGCTGGGACTTGTGG + Intronic
932437650 2:71712123-71712145 GTGGGCAGGGCTGAGAGGGAGGG + Intergenic
932769063 2:74490362-74490384 GAGGGCAGGGCTCAGACTCTTGG - Exonic
937983658 2:127629007-127629029 GAGAGCTGGGCTGTGTCTGTGGG + Intronic
939198214 2:138999934-138999956 GAGAGAAGGGCTGAGACTCAGGG + Intergenic
942277721 2:174335042-174335064 GGGAGCGGGGCTGAGCCTGGCGG - Exonic
945239158 2:207660645-207660667 GTGTGCAGGGCTGATCATGTGGG - Intergenic
946970576 2:225086620-225086642 GGGAACAGGGCTGGCACTGTTGG - Intergenic
947352856 2:229264480-229264502 GTGAGCTGGGCTGGGACTTGGGG - Intronic
947728775 2:232416938-232416960 CTGAGCATGGCTGAGAAGGTGGG + Intergenic
947817916 2:233050347-233050369 GTGAGCAGGCCGGAGGCTCTAGG + Intergenic
948824066 2:240565991-240566013 GTGAGCAGGGCTGAGCCGCGGGG - Intronic
948995976 2:241579013-241579035 GGAAGCAGGGCAGTGACTGTCGG + Intergenic
1168964015 20:1888016-1888038 GTGAGCAAGGGGGAGAGTGTGGG + Intergenic
1172190424 20:33059035-33059057 CAAACCAGGGCTGAGACTGTGGG + Intronic
1172270829 20:33654908-33654930 CTGAGCTGGGCTGGGGCTGTGGG - Intergenic
1173407718 20:42781080-42781102 GTCAACTGGGATGAGACTGTCGG - Intronic
1173510678 20:43625713-43625735 GTGAGTAGGGGTGAGAATGGTGG + Intronic
1174051210 20:47768790-47768812 GAGAGCAGTGCTGGGACTGGGGG - Intronic
1174386968 20:50193088-50193110 GTAGGCAGGCCTGTGACTGTAGG + Intergenic
1175785751 20:61710800-61710822 TCGAGCAGGGCTGAGCATGTAGG - Intronic
1176109552 20:63405215-63405237 GTGAGCAGGGCTGGGGTCGTGGG - Intergenic
1178093511 21:29189373-29189395 GTGAGGTGGGCTGAGACAGCTGG + Intergenic
1178263860 21:31124512-31124534 ATGAGCAGGGCAGGTACTGTGGG - Exonic
1180086215 21:45509113-45509135 CTGAGCACGGCTGGGTCTGTGGG + Intronic
1181788390 22:25243973-25243995 GTGTGCAGGGCTGAGAGTCCAGG + Intergenic
1182183135 22:28372450-28372472 GGGAACATGGCTGGGACTGTAGG - Intronic
1182282559 22:29225782-29225804 GTGAGGAGGGGAGAGACTGCTGG + Intronic
1183013149 22:34963814-34963836 GTGAACTGGGATGAGAATGTAGG - Intergenic
1183668353 22:39257747-39257769 GAGAGAAGGGCTGAGGCTGGGGG - Intergenic
1183730971 22:39618375-39618397 GTGTGCATGGGTGTGACTGTGGG + Intronic
1184876933 22:47282238-47282260 GGGTGCAGGGCTGAGACTGGCGG + Intergenic
1185251529 22:49804209-49804231 GTGAGCTTCGCTGAGACTGCAGG + Exonic
1185349396 22:50326759-50326781 GTGGGCAGGGCTGCGCCTCTCGG - Intronic
949942979 3:9168951-9168973 GGGTGCAGAGCTGTGACTGTTGG - Intronic
950294378 3:11815873-11815895 GTAAGCAGGGCTGAGAATGTGGG + Intronic
950566184 3:13771028-13771050 GTGAGCAGGAGGGAGACTGGAGG - Intergenic
951954545 3:28240548-28240570 TTGAGCAGGGCTGGGAAAGTGGG - Intergenic
952325662 3:32318421-32318443 GTTAGCAGTGCTGAGACCCTGGG + Intronic
952719134 3:36514155-36514177 GTCACCATGGATGAGACTGTGGG - Intronic
952901558 3:38114903-38114925 GGGAGGAGGGCTGGGACTGGGGG - Intronic
952945981 3:38478158-38478180 GTGAGCAGGGTGGGGGCTGTCGG - Exonic
954275644 3:49540009-49540031 GTGGGCAGGGCTAAGGCCGTGGG + Intergenic
954622923 3:52005960-52005982 GGGAGCAGGCCTGAGCCTGGAGG - Intergenic
954715822 3:52526290-52526312 GTGGGCAGGGCTGAGAGGGTGGG + Intronic
955368599 3:58332423-58332445 GTTTGCAGGGCTCAGACTGGGGG + Intergenic
955519275 3:59759233-59759255 GTGGGCAGGGCTGAGAAGTTTGG + Intronic
961368298 3:126415005-126415027 GAGACCAGGGCTGGGCCTGTGGG + Intronic
961548540 3:127652879-127652901 GGCAGCAGGGCTGAGGGTGTGGG + Intronic
961958431 3:130828288-130828310 GTGAGCAGGGCTGAGACTGTGGG - Intergenic
962103644 3:132368690-132368712 CAGTGCAGGGCTGAGACAGTGGG - Intergenic
963603618 3:147396745-147396767 AGGCGCAGGGCTGAGTCTGTGGG + Intronic
965132849 3:164723656-164723678 GGGAGCAGGCCTGTGACTGCTGG - Intergenic
965398922 3:168194765-168194787 ATGAGCAGGACTGAAACTGGTGG - Intergenic
965425425 3:168516989-168517011 GTGTGCTAGGCTGAGACTCTGGG + Intergenic
966455442 3:180110223-180110245 GTGAGAGGGGCTGAGGCTGCAGG + Intergenic
966550577 3:181199970-181199992 GTGGGAAGGGCTGGGAATGTGGG + Intergenic
966920183 3:184605943-184605965 ATGAGCAGGGCTGCCACTGAGGG + Intronic
968981518 4:3852526-3852548 GTAAGCAGGGCAGAGTCTTTTGG - Intergenic
969347445 4:6578328-6578350 CTGAGCATGGCTGGGTCTGTGGG - Intronic
971517741 4:27509617-27509639 GCAGGCAGGGCTCAGACTGTGGG + Intergenic
972634966 4:40875718-40875740 GTGATTAGGGCTCAGACTCTGGG + Intronic
973636320 4:52864555-52864577 GTGAGAAGCTCTGAGACTCTGGG + Intronic
973862295 4:55077678-55077700 GTGAGGGGGGTTGTGACTGTGGG + Intergenic
975461738 4:74661327-74661349 GTGAGCACGTCTGAGCCTGTAGG - Intergenic
975989510 4:80242885-80242907 CTGAGCAGGTCTGACACTTTTGG + Intergenic
978296717 4:107213984-107214006 CTTAGCAGGGCTAAGAATGTGGG - Intronic
978857036 4:113405073-113405095 TTGATTTGGGCTGAGACTGTTGG - Intergenic
980212463 4:129807511-129807533 TTGAACAGGGGTGAGACTGAGGG + Intergenic
981181433 4:141750501-141750523 GTGAAAAGGGTTGAGAATGTGGG + Intergenic
981771192 4:148310658-148310680 ATGAGCAGGCATGAGAATGTGGG - Intronic
981906934 4:149932011-149932033 GGGAGCAGGGAGGAGAGTGTGGG + Intergenic
983532270 4:168823193-168823215 GTGGGCAGGGCTGACACTTTGGG - Intronic
983567461 4:169168894-169168916 GTGAGCAGGGAGGAGACATTTGG + Intronic
984877752 4:184384748-184384770 AAGAACAGGGCTGGGACTGTTGG - Intergenic
985589131 5:755737-755759 GCAGGCAGGGCTGAGACTGGAGG - Intronic
985589272 5:756351-756373 GTGAGCAGGGCTGTGTGTGAAGG - Intronic
985589283 5:756393-756415 GTGAGCAGGGCTGTGTGTGCAGG - Intronic
985603810 5:848253-848275 GCAGGCAGGGCTGAGACTGGAGG - Intronic
985603971 5:848938-848960 GTGAGCAGGGCTGGGTGTGCAGG - Intronic
985604001 5:849057-849079 GTGAGCAGGGCTGTGTGTGCAGG - Intronic
986263147 5:6166693-6166715 CAGAGCAGGGCTGAGCCTTTGGG - Intergenic
990170854 5:53048130-53048152 AGGAGGAGTGCTGAGACTGTTGG - Intronic
994804366 5:104424716-104424738 GTGAGCAGGGGCGAGAGTGTAGG + Intergenic
997825727 5:137105377-137105399 TTAAGCAGAGTTGAGACTGTTGG - Intronic
998426473 5:142033218-142033240 GCCAGCATGGCTCAGACTGTAGG + Intergenic
999252009 5:150188386-150188408 GCGAGCAGGGATGAGGCAGTTGG - Intergenic
1001568711 5:172716563-172716585 GTGGGCAGGGCTGGGGCTGAGGG - Intergenic
1001952494 5:175826035-175826057 GTGGGCTGGGCTGAGACTCAGGG + Intronic
1005383523 6:25262520-25262542 GTGAGCACGGCTGGAACTGGAGG + Intergenic
1005648820 6:27867387-27867409 GTGATCAGCTCTGAGACTGGGGG + Exonic
1005839279 6:29730859-29730881 GTGAGCTGGGCTGAGAATGGCGG - Intronic
1007074580 6:39058358-39058380 CTGAGGAGGGCTGAGTCTGGTGG - Intronic
1007583096 6:42971102-42971124 GAGAGCAGCTTTGAGACTGTGGG - Intronic
1007614794 6:43173502-43173524 GTGAGAAGGGGTGAGGCTCTGGG + Intronic
1011063251 6:83295034-83295056 GGGAGCATGGCTGCAACTGTGGG + Intronic
1014719486 6:124898482-124898504 GTAAGCAGGGGTGAGACAGCAGG + Intergenic
1016909035 6:149178790-149178812 GTGAGAAGGGCTGTGTCTGGAGG - Intergenic
1017012289 6:150070697-150070719 CTGGGCAGGCCTGAGTCTGTTGG - Intergenic
1017240851 6:152166812-152166834 GGGAGCAGAGGTGAGCCTGTAGG + Intronic
1017289746 6:152722141-152722163 GTCAGGACGGCTCAGACTGTGGG - Exonic
1019281330 7:201787-201809 GTGACCCGGGGAGAGACTGTGGG + Intronic
1019565841 7:1678666-1678688 GGCAGCAGGGCTGAGGCTGGTGG - Intergenic
1019779571 7:2931356-2931378 GAGCACTGGGCTGAGACTGTGGG - Intronic
1019983588 7:4639413-4639435 GGGAGCAGGGCTGAGCCTCTTGG + Intergenic
1020006486 7:4786155-4786177 GAGAGCAGGCCTGAGACTCAGGG + Intronic
1020444489 7:8255084-8255106 GTGGGCAGGGGTAAGAGTGTAGG - Intronic
1020627477 7:10599767-10599789 GTGAGAAGAGGTGAGAATGTAGG + Intergenic
1021662861 7:22938221-22938243 GTGAGCAGGGCTTCACCTGTAGG - Intergenic
1022726616 7:32987106-32987128 GTGAGCAGGGGTGATAGTGGGGG + Intronic
1024259572 7:47563690-47563712 CTGAGCAGGGAGGACACTGTTGG + Intronic
1024976943 7:55122190-55122212 ATGAGCAAGGCTGAGAGTGCTGG - Intronic
1025046967 7:55700527-55700549 GTGAGCAGGGATGATAGTGGGGG - Intergenic
1029416225 7:100444851-100444873 CTGAGCAGGGCTGGGGCTGGAGG - Intergenic
1030124913 7:106144478-106144500 GTGAGAATGGCAGAGACTGCTGG + Intergenic
1032852595 7:135808151-135808173 GTGAGTAGGGGTGCGAGTGTGGG - Intergenic
1034462728 7:151206877-151206899 GTGGGCAGGAGTGAGACTTTGGG + Intergenic
1035119917 7:156558444-156558466 TTGAGCAGGGATGAGACGCTAGG + Intergenic
1035609159 8:948747-948769 GTGAGCAGGGCTCAGGCCGTGGG + Intergenic
1035627523 8:1082571-1082593 GTGAGCAGGGCTGGGCATGGTGG + Intergenic
1037319045 8:17626962-17626984 GAGAGCAGACCTGAGACTGATGG + Intronic
1037891506 8:22626306-22626328 GTGGGCTGGGGTGAGACTGCTGG + Intronic
1038072347 8:24031019-24031041 GTGAGCATTGCTGAGACTGGGGG + Intergenic
1038533813 8:28339538-28339560 GGGAGCAAGGCTAAGACAGTTGG - Intronic
1040295800 8:46148441-46148463 GGGAGAAGGGGTGAGACTGCAGG - Intergenic
1040302737 8:46196324-46196346 GGGAGAAGTGCTGAGACTGCAGG + Intergenic
1040305738 8:46210870-46210892 GGGAGAAGGGCTGTGAATGTAGG + Intergenic
1040329102 8:46376885-46376907 GTGAGAAGTGGTGAGACTGCAGG + Intergenic
1040967741 8:53101237-53101259 GTGGGCAGAGCTCAGACTTTTGG - Intergenic
1041252154 8:55945035-55945057 CTGGCCAGGGCTGAGAGTGTTGG - Intronic
1041822542 8:62054175-62054197 CAGAGAAGGGCTGAGGCTGTGGG - Intergenic
1042025752 8:64421918-64421940 GTTACCAGGGCTGAGAGTATAGG + Intergenic
1042497019 8:69466650-69466672 GAGGGCAGGGCTGAAACTGGAGG - Exonic
1044472848 8:92591313-92591335 GTGAGCTGTGATTAGACTGTGGG - Intergenic
1045491822 8:102675932-102675954 GTGGGGAGGACTGATACTGTAGG - Intergenic
1046283865 8:112070530-112070552 GTAACCAGGGCCTAGACTGTTGG + Intergenic
1048543350 8:135363342-135363364 ATGAACAGGGCTGAGACCCTGGG + Intergenic
1049601077 8:143507968-143507990 GTGGGCAGAGCTGGCACTGTGGG - Intronic
1049784010 8:144441979-144442001 GTGTGCAGGGGTGAGCCTGGGGG - Intronic
1050669031 9:7975383-7975405 GGGAGCTAGGCAGAGACTGTGGG - Intergenic
1051420444 9:16883841-16883863 GTCAACAGGGGTGAGACTGATGG + Intergenic
1053577545 9:39368478-39368500 GTGAGCATGGCAGAGAATGTAGG - Intergenic
1053842052 9:42196430-42196452 GTGAGCATGGCAGAGAATGTAGG - Intergenic
1054099121 9:60927195-60927217 GTGAGCATGGCAGAGAATGTAGG - Intergenic
1054120520 9:61202819-61202841 GTGAGCATGGCAGAGAATGTAGG - Intergenic
1054587230 9:66979737-66979759 GTGAGCATGGCAGAGAATGTAGG + Intergenic
1056391552 9:86145949-86145971 GAGACCAGAGCTGGGACTGTGGG + Intergenic
1056922891 9:90807809-90807831 GGGGGCAGGGCTGGGACTGAGGG - Intronic
1057033453 9:91796765-91796787 GTGGGCAGGGCTGACACCCTGGG + Intronic
1057033603 9:91797277-91797299 GTGGGCAGGGCTGACACCCTGGG + Intronic
1057033799 9:91797956-91797978 GTGGGCAGGGCTGACACCCTGGG + Intronic
1057353713 9:94319292-94319314 GTGAGCAGGGCCCAGAATGGTGG + Intronic
1057654037 9:96938300-96938322 GTGAGCAGGGCCCAGAATGGTGG - Intronic
1057839780 9:98477019-98477041 GTCAGAAGGGCTGAGGTTGTTGG + Intronic
1057872100 9:98725996-98726018 GAGAGCATCGCTGAGAATGTAGG - Intergenic
1058850148 9:109003871-109003893 GTGTGCAGAGGTTAGACTGTAGG + Intronic
1059339808 9:113591333-113591355 ATGAGCGGGGCTGACACCGTTGG + Exonic
1060675362 9:125509646-125509668 GAGAGCAGTGCACAGACTGTCGG + Intronic
1061119727 9:128635433-128635455 GTGAGCAGCGCTGGGATTCTGGG - Intronic
1061443981 9:130627202-130627224 GAGACCAGGGCCGAGGCTGTGGG + Intronic
1061592841 9:131609132-131609154 GTGACCAGGGCTGACATTGGGGG - Intronic
1062237984 9:135521779-135521801 GTGGGCAGGGCTGGGAGGGTGGG + Intronic
1062390179 9:136330721-136330743 GTTAGCAGGGCTGGGACTGAGGG + Intronic
1185759932 X:2682908-2682930 TTGGGGAGGGCTGAGACTGGGGG + Intergenic
1186466866 X:9790160-9790182 GGGCACAGGGCTGAGACTGGTGG + Intronic
1187295046 X:17991026-17991048 GTGAGCATAGCTGAGACACTGGG - Intergenic
1188349564 X:29111606-29111628 GTGACTAGGGATGAGACTGTTGG + Intronic
1189179070 X:38986423-38986445 GTGAAGAGAGTTGAGACTGTGGG + Intergenic
1189666029 X:43355755-43355777 GTTAGAAGGGCTGAGAATTTAGG + Intergenic
1190214569 X:48470965-48470987 GTGAGCGGCTCTGAGCCTGTCGG - Intergenic
1190949719 X:55131596-55131618 CGAAGCAGGGCTGAGACTTTTGG - Intronic
1192579361 X:72268091-72268113 GGCAGCTGGGTTGAGACTGTAGG + Intronic
1194945205 X:100058694-100058716 GAGAGCAGAGTGGAGACTGTTGG + Intergenic
1196632692 X:117961836-117961858 GTCAGCAAGGCTGAGGCTCTAGG - Intronic
1198068771 X:133127257-133127279 GGGAGCTTGGCTGAGGCTGTTGG + Intergenic
1198957542 X:142148933-142148955 GTGAGCAGGAGTGTGAGTGTTGG + Intergenic
1199083145 X:143598866-143598888 GGGAGCAGGGATAAGACTGTGGG + Intergenic
1199880301 X:151969159-151969181 GTAAGCAGTGCTGGGACTGCAGG + Intronic
1200088612 X:153624053-153624075 GTGCGCAGGGCCGAGTCTCTAGG - Intergenic