ID: 961959044

View in Genome Browser
Species Human (GRCh38)
Location 3:130834587-130834609
Sequence CTGAACTACCTTACAGCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961959044_961959048 29 Left 961959044 3:130834587-130834609 CCAGGGGCTGTAAGGTAGTTCAG No data
Right 961959048 3:130834639-130834661 AAATGCTGTGTGGAATCACCAGG No data
961959044_961959047 19 Left 961959044 3:130834587-130834609 CCAGGGGCTGTAAGGTAGTTCAG No data
Right 961959047 3:130834629-130834651 ACTGGAGATAAAATGCTGTGTGG No data
961959044_961959046 1 Left 961959044 3:130834587-130834609 CCAGGGGCTGTAAGGTAGTTCAG No data
Right 961959046 3:130834611-130834633 AAGAAGTATATGCAGAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961959044 Original CRISPR CTGAACTACCTTACAGCCCC TGG (reversed) Intergenic
No off target data available for this crispr