ID: 961961181

View in Genome Browser
Species Human (GRCh38)
Location 3:130856958-130856980
Sequence ATTGTAACTTTGGGCACAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 191}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961961178_961961181 5 Left 961961178 3:130856930-130856952 CCAAGGTCTGATTGCAAAAATTC 0: 111
1: 110
2: 61
3: 37
4: 178
Right 961961181 3:130856958-130856980 ATTGTAACTTTGGGCACAAATGG 0: 1
1: 0
2: 0
3: 14
4: 191
961961175_961961181 25 Left 961961175 3:130856910-130856932 CCTACTGCTCAAGGCCATCGCCA 0: 2
1: 94
2: 253
3: 215
4: 200
Right 961961181 3:130856958-130856980 ATTGTAACTTTGGGCACAAATGG 0: 1
1: 0
2: 0
3: 14
4: 191
961961177_961961181 11 Left 961961177 3:130856924-130856946 CCATCGCCAAGGTCTGATTGCAA 0: 2
1: 3
2: 2
3: 10
4: 92
Right 961961181 3:130856958-130856980 ATTGTAACTTTGGGCACAAATGG 0: 1
1: 0
2: 0
3: 14
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961961181 Original CRISPR ATTGTAACTTTGGGCACAAA TGG Intronic
907855741 1:58301783-58301805 TCTGTAACTTTGGACAAAAACGG + Intronic
907983880 1:59511358-59511380 ATTCTATCTTGGGGCTCAAAGGG + Intronic
908306091 1:62818491-62818513 ATAGTAACCTTGGGTAAAAATGG - Intronic
908405292 1:63808464-63808486 TTTCTACCTTTGGGTACAAAAGG + Intronic
908877619 1:68695982-68696004 AATGTACCTGTGGGCAAAAAGGG - Intergenic
909901467 1:81141628-81141650 ATTGCAACTTCAGGCATAAATGG + Intergenic
917113344 1:171575606-171575628 CTTCTAACTTTGGGCACCAAAGG - Intronic
918963631 1:191311402-191311424 ATTGTCACTATGGCCACAGAAGG - Intergenic
921334544 1:214073118-214073140 ATTGTAAATTCTGGCATAAATGG - Intergenic
922112161 1:222570660-222570682 CTTGTATCTTTGGGCAGATAAGG - Exonic
923925390 1:238621258-238621280 AATGTCACTTTTGCCACAAAAGG - Intergenic
1063752946 10:8972859-8972881 CTTGAATCTTTGGGCAGAAATGG - Intergenic
1065872736 10:29969957-29969979 ATTGTAACCTCTGGCATAAATGG + Intergenic
1066484185 10:35827662-35827684 AATGCAAGTTTGGGCACAAAAGG + Intergenic
1066992169 10:42525935-42525957 ATTGTAACCTCAGGCATAAATGG - Intergenic
1068630950 10:59297155-59297177 ATTGCAACCTTGGGCATAAATGG + Intronic
1070121728 10:73584004-73584026 GATGGAACTTTGGGCCCAAAAGG + Intronic
1070182818 10:74030892-74030914 ATTGCAACCTCTGGCACAAATGG + Intronic
1072284454 10:93899545-93899567 TTTGTCTCTTTGGGCAAAAAAGG + Intronic
1072843801 10:98805285-98805307 ATTGTAACCTTTGGCATAAATGG + Intronic
1075434044 10:122418884-122418906 ATTAGAACTTTCTGCACAAATGG + Intronic
1080816727 11:35765099-35765121 ATTGCAACTATGCACACAAATGG - Intronic
1083788055 11:64964918-64964940 ATTATAATTTTGGACATAAAGGG + Intronic
1087374195 11:97321859-97321881 ATTGTAATTGTGGCCTCAAAAGG - Intergenic
1089849904 11:121487006-121487028 AGTGTGGGTTTGGGCACAAAGGG - Intronic
1090109589 11:123891645-123891667 ATTGTAACTTAGTACACCAATGG - Intergenic
1090478515 11:127046865-127046887 TTTTTAACTTTGGGAACAAAAGG - Intergenic
1093154722 12:15667916-15667938 ATTTTAGGTTTGGGAACAAATGG - Intronic
1093639188 12:21505535-21505557 AGACTAACTTTGGGAACAAAAGG + Intronic
1093847000 12:23984909-23984931 ATTGTAACCTCTGGCATAAATGG - Intergenic
1094739128 12:33268635-33268657 AAAGTCACTTTGGGAACAAATGG + Intergenic
1095029670 12:37253952-37253974 ATTGTAACATTGGCCTCAAAGGG + Intergenic
1095107041 12:38247025-38247047 AGTATAACTTAGGACACAAATGG + Intergenic
1095330122 12:40950035-40950057 ATTGTAACTTTGGTCCCATGTGG + Intronic
1095714539 12:45328254-45328276 ATAGTAACTCTGGACACACAGGG - Intronic
1096166138 12:49425961-49425983 ATTGTAATTATGAGCACAACTGG + Intronic
1100122446 12:91384279-91384301 ATTGCAGCTTCAGGCACAAATGG + Intergenic
1100685137 12:96979406-96979428 ACTGAAACTCTGGGAACAAAAGG - Intergenic
1101751461 12:107585883-107585905 ATAGTAACTTTTGACACCAAGGG - Intronic
1104040125 12:125124387-125124409 ATTGTATCTTGGGGGACCAAAGG - Intronic
1108113404 13:47101975-47101997 CTTATAATTTTGGGCCCAAAGGG + Intergenic
1109023357 13:57128910-57128932 AATGTAATTTTGAGAACAAACGG + Intergenic
1109121706 13:58466164-58466186 ATTGCAACTTCAGGCATAAATGG - Intergenic
1109850972 13:68062748-68062770 ATTGCAACCTCAGGCACAAATGG - Intergenic
1110192774 13:72750483-72750505 ATTGCAACCTTAGGCATAAATGG - Intronic
1110377347 13:74807827-74807849 ATTGTAATTTTGAGTTCAAAAGG - Intergenic
1110633772 13:77740874-77740896 ACTGTAACCTTGGGCACTAGTGG + Intronic
1111480857 13:88824401-88824423 GTTGTAATTTTGAGCTCAAACGG - Intergenic
1111774460 13:92641818-92641840 GTTGGCACTTTGGGCAGAAAGGG + Intronic
1112541327 13:100316667-100316689 ATTTTAACATTGGCCACACAGGG + Intronic
1112829594 13:103432562-103432584 ATTTTGACACTGGGCACAAAGGG - Intergenic
1116127632 14:40808428-40808450 ATTGTTACTTAGGGAAGAAAAGG + Intergenic
1116171847 14:41412669-41412691 ATTGTCAGTTTTGGCACAGAAGG + Intergenic
1118327415 14:64791089-64791111 ATTCTAAGTTTGGGCACACTTGG + Intronic
1118507901 14:66434992-66435014 AATGTAAAGTTGGGCACAAATGG - Intergenic
1118922958 14:70166855-70166877 ATGGTAACTGTGGCCACACAAGG + Exonic
1119537863 14:75417682-75417704 ATTGCAACTTCTGGCATAAATGG + Intergenic
1119816072 14:77568925-77568947 ATTGTAACCTCTGGCATAAATGG - Intronic
1119877027 14:78069680-78069702 ATCATAACTTTTGCCACAAAAGG - Intergenic
1120757722 14:88259626-88259648 TTTGTAACTTTTTGTACAAAAGG + Intronic
1124967712 15:34449286-34449308 GTTGGCACTTTGGGCAGAAAGGG + Intergenic
1126807788 15:52369760-52369782 ATTGCAACCTTAGGCATAAATGG + Intronic
1126914784 15:53453870-53453892 TTTGTAACACTGGGCACAAAAGG - Intergenic
1133664504 16:7953084-7953106 ATTGTAACCTCAGGCATAAATGG + Intergenic
1140513480 16:75525341-75525363 ATTGTGCCTTTAGGCAGAAAGGG - Intergenic
1145098396 17:20052219-20052241 ATGGTGACATTTGGCACAAATGG - Intronic
1147898228 17:43766528-43766550 ATCTTAACTTGTGGCACAAAAGG + Exonic
1149676148 17:58464371-58464393 ATTGTAACTTTGGGTAAATTAGG - Intronic
1153175054 18:2362375-2362397 ATTTTAACTTTGGGCAAGCAAGG - Intergenic
1155883858 18:31183704-31183726 AATGTGATTTTGGGGACAAATGG + Intergenic
1156695563 18:39762044-39762066 AGTGTAATTTTGGGAACAAGAGG - Intergenic
1156742450 18:40348506-40348528 ATTATAAAATTGGCCACAAAGGG + Intergenic
1157534724 18:48449872-48449894 AGTGTATATTTGGGCACAGATGG + Intergenic
1158234457 18:55297837-55297859 ATTGAAACTTTTGGCAAAAGTGG + Intronic
1163045854 19:14641372-14641394 AGTGTACCTTGGGGCAGAAAGGG + Intronic
1168215894 19:54925346-54925368 ATTGTAACCTCTGGCATAAATGG - Intronic
926545804 2:14238322-14238344 AAGGTAACTCTGGGCTCAAATGG + Intergenic
927361792 2:22243833-22243855 ATTGCTACTTTGGGCAAATAAGG - Intergenic
930514200 2:52385072-52385094 ATTATAACTTTGGGGAAAAGGGG - Intergenic
930790179 2:55317343-55317365 ATTGTAACTGGGGGGAAAAAAGG + Exonic
932555142 2:72817102-72817124 ATTGTACATTTGGGTAAAAAGGG - Intronic
935393473 2:102580149-102580171 ATAGTAGCTTTGGGAACAAAAGG - Intergenic
936382732 2:112001305-112001327 ATTTTAACTTTTGCCAAAAAGGG - Intronic
936992621 2:118382328-118382350 ATTGCAACATTAGGCATAAATGG - Intergenic
940070423 2:149680587-149680609 ATTATAACTATAGGCAAAAAGGG + Intergenic
941512705 2:166433168-166433190 ATTGCAACTTCTGGCATAAATGG + Intronic
942257617 2:174120814-174120836 TTTGTGACTTTGGCCACAAGAGG - Intronic
944304336 2:198162185-198162207 ATTGAAAATTTGAGCACAAGAGG - Intronic
945239292 2:207661435-207661457 ATTGCAACTTTGAATACAAATGG - Intergenic
945798028 2:214388779-214388801 ATAGTAACTTTGGGAAGATATGG - Intronic
1168934939 20:1656856-1656878 ATTGCAACCTCGGGCATAAATGG - Intronic
1169737546 20:8853139-8853161 AAAGGAACTTTGGGCACATAAGG + Intronic
1170077733 20:12438182-12438204 ATTGTTACATTGGGTAGAAATGG + Intergenic
1170296180 20:14828900-14828922 ATTGTAGTTGTGGGCAAAAAGGG - Intronic
1170781879 20:19432985-19433007 ATTGCAACCTCGGGCATAAATGG + Intronic
1172336210 20:34118085-34118107 AATGTAATTTTGGGGACTAATGG - Intergenic
1173263198 20:41454668-41454690 ATCCTAACTTTTGGCAGAAATGG - Exonic
1174860383 20:54085906-54085928 ATTGCAACTTCAGGCATAAATGG + Intergenic
1175552770 20:59827772-59827794 CTTGTCACTGTGGGCACAAGAGG + Intronic
1178783832 21:35633748-35633770 ATGTTTACTTTGGGCACTAAAGG - Intronic
1183673648 22:39287994-39288016 ATTGCAACTTAAGGCATAAATGG + Intergenic
949367285 3:3296513-3296535 CTTTTAACATTGGCCACAAAGGG - Intergenic
949691719 3:6648141-6648163 TTTGTAGCTTTGGGAAGAAAAGG + Intergenic
950966257 3:17148425-17148447 ATTGTAACATTACGCATAAATGG - Intergenic
952148190 3:30556833-30556855 AATGTAACCTTGGTCACCAAAGG - Intergenic
952465731 3:33583436-33583458 ACTGTACCTTTGGGAAGAAATGG + Intronic
953370773 3:42386436-42386458 GTGGTTACTTTGGGCCCAAATGG + Intergenic
954580100 3:51698619-51698641 TTTGGAACTTGGGGCCCAAAAGG + Intronic
957798514 3:85043754-85043776 ATTGTAAATTTGACCAGAAAAGG - Intronic
958521455 3:95193238-95193260 ATTTTAATTTGGGGCACCAAAGG - Intergenic
959890338 3:111547811-111547833 ATTGTGATTTTGGGTACAAAGGG + Intronic
960193028 3:114730180-114730202 ATTGCAACATTTGGCATAAATGG - Intronic
961961181 3:130856958-130856980 ATTGTAACTTTGGGCACAAATGG + Intronic
962243634 3:133772790-133772812 ATTGTAAGTTTGGGAACTACTGG + Intronic
963541224 3:146591802-146591824 ATTGTGAATTTAGGCAGAAAGGG + Exonic
964495594 3:157286506-157286528 CCTGTAATTTGGGGCACAAATGG + Intronic
964969016 3:162536972-162536994 TTTTTTACTTTGGGCACATATGG + Intergenic
967470841 3:189860258-189860280 ATTGTAAATTTGAACACACATGG - Intronic
970072128 4:12172257-12172279 ATTATAACATTGGTCAAAAATGG + Intergenic
970906958 4:21226992-21227014 ATTGTCAGTTTGGCAACAAACGG + Intronic
971288031 4:25308949-25308971 ATTGCAACTTCAGGCATAAATGG + Intergenic
973843156 4:54883669-54883691 AGTGTAACTTTGGGTTAAAATGG - Intergenic
974980507 4:68951246-68951268 ATTCTAAGTGTGAGCACAAAAGG + Exonic
975467754 4:74728821-74728843 ACTGTAAATTTGGACAAAAATGG - Intergenic
975841032 4:78474410-78474432 ATTGGAACTTGGGGGAAAAAAGG + Intronic
976200747 4:82576013-82576035 ATTGCAACTTCAGGCATAAATGG + Intergenic
976909110 4:90278614-90278636 AGTTTAACATTGGGCACACATGG + Intronic
977667237 4:99655142-99655164 AGTGTAACTTTGGGGAAAGAGGG - Intergenic
977845051 4:101758430-101758452 ATTGTGACTTTGTTCACATATGG + Intronic
978755259 4:112294888-112294910 ATTATAACTTTAGATACAAAGGG + Intronic
980115658 4:128676964-128676986 GAAGTAACTTTGGCCACAAAAGG - Intergenic
980153389 4:129076442-129076464 GTTTTAATTTTGGGTACAAAGGG + Intronic
980929468 4:139171482-139171504 ATTGCAACTTCGGGCATAAATGG + Intronic
982487177 4:155980010-155980032 ATTGGAACTTTAAGCAGAAAGGG - Intergenic
983422888 4:167542701-167542723 ATTGTTACATTGAGCATAAAAGG - Intergenic
983856992 4:172658538-172658560 ATTTCAAATTTGGGCACAAAAGG + Intronic
984333545 4:178358213-178358235 AATGTGACTTTTGGCAAAAAGGG - Intergenic
984377545 4:178952625-178952647 ATTGCAACCTCGGGCATAAATGG - Intergenic
986890983 5:12305288-12305310 ATTGTAACTTCTGGCATTAATGG - Intergenic
989351930 5:40496505-40496527 ATAGGAACAATGGGCACAAAAGG - Intergenic
991186959 5:63820163-63820185 ATTGCAACTTCAGGCATAAATGG - Intergenic
991521717 5:67506024-67506046 ATTGTTACTTTGGGTGAAAAAGG + Intergenic
991973126 5:72160113-72160135 ATTTTCACTTTGAGCATAAATGG + Intronic
993922119 5:93818246-93818268 ATTGTAAGTATGGGGAGAAATGG + Intronic
994669117 5:102745555-102745577 ATTATAACTGTGGACACATAAGG + Intergenic
995235697 5:109827412-109827434 ATAGTTACTTTGGGGAGAAAAGG - Intronic
995428795 5:112051528-112051550 ATAGTAACCTTGGGTATAAAGGG + Intergenic
996858397 5:128036608-128036630 AGTGTGACTTTGGGCACCCAGGG - Intergenic
997007862 5:129840993-129841015 AATGTAATGTTTGGCACAAATGG - Intergenic
1002387278 5:178877682-178877704 ATTGCCACTTTGGCCACCAAAGG + Intronic
1007585745 6:42988173-42988195 ATTGTGACTATGGGGGCAAAAGG - Intronic
1009501608 6:64420585-64420607 TTTGTGACTTTGGGCATCAAAGG + Intronic
1011264883 6:85505996-85506018 ATTTTTACTTTAGGTACAAAAGG - Exonic
1012176968 6:96099272-96099294 ATTTTAACTTTATGCACATATGG + Intronic
1012218370 6:96616950-96616972 ATTGAAACTGGGGGCACAACTGG - Intergenic
1014244840 6:119056986-119057008 ATTGCAACCTTCGGCATAAATGG - Intronic
1016357960 6:143238283-143238305 ACCATAACTTTGAGCACAAAAGG - Intronic
1016667023 6:146654037-146654059 ATTGCAACTTCAGGCATAAATGG + Intronic
1018949047 6:168366600-168366622 ATTTTTACTTTGTGCAGAAAGGG - Intergenic
1018957958 6:168424221-168424243 ATTGCAACCTTGGGTATAAATGG - Intergenic
1021756082 7:23854512-23854534 TTTGCAACTTCTGGCACAAATGG - Intergenic
1022367110 7:29732276-29732298 ATTGTCACTTTGGGAAAAACTGG - Intergenic
1022375484 7:29807340-29807362 AATGTACATTTGGCCACAAATGG + Intronic
1024826162 7:53392233-53392255 ATTGTAACCTCAGGCATAAATGG + Intergenic
1028985957 7:97008078-97008100 ATTATGAGTTTGGTCACAAAAGG - Intronic
1034179204 7:149124869-149124891 ATTGTAAATGTGGTCATAAATGG - Intronic
1037221062 8:16522139-16522161 AATTTAAATTTGTGCACAAAAGG - Intronic
1038119654 8:24598664-24598686 ATTGCAACCTTTGGCACAAATGG - Intergenic
1038457162 8:27683260-27683282 ATTGTAACCTAGGGCAGAAGTGG + Intergenic
1039253540 8:35692978-35693000 AATGTAGATTTGGGCACATATGG + Intronic
1039758922 8:40553023-40553045 ATTGTAACCTCAGGCATAAATGG + Intronic
1040988237 8:53319592-53319614 ATTTTAACTTGGGGCAAGAAGGG - Intergenic
1044522671 8:93217517-93217539 ATTGTGACCTGAGGCACAAAAGG - Intergenic
1044852340 8:96441271-96441293 GTTGCATCATTGGGCACAAAAGG + Intergenic
1045593094 8:103621198-103621220 ATTGTTACTTTCTGCAGAAAGGG + Intronic
1045721831 8:105121326-105121348 ATAGTCACTTTGGGAAGAAAGGG + Intronic
1048232225 8:132654161-132654183 ATTGTAACTATAGACAAAAAAGG + Intronic
1050808404 9:9713805-9713827 ATTGTAACATTGGAGACAAGTGG - Intronic
1053172942 9:35904044-35904066 ATTGCAACCTTAGGCATAAATGG + Intergenic
1055261673 9:74443824-74443846 ATTATAGCTTTGGACACAACTGG - Intergenic
1057257486 9:93562067-93562089 ATTGCAACTTCCGGCATAAATGG + Intronic
1059241676 9:112811365-112811387 ATTGTAAATTTTGGATCAAATGG + Intronic
1060246248 9:121948891-121948913 ATGCAAGCTTTGGGCACAAAGGG + Intronic
1060246371 9:121950065-121950087 ATGCAAGCTTTGGGCACAAAGGG - Intronic
1061501484 9:131005627-131005649 ATTTTTACTTTGTGCAGAAAGGG - Intergenic
1062064593 9:134519456-134519478 TGTGTAGCTTTGGGCATAAATGG + Intergenic
1185876139 X:3703841-3703863 TTTGTATTTTTGGGTACAAACGG + Intronic
1186491406 X:9976300-9976322 TTTGTAACTGAGAGCACAAAGGG - Intergenic
1188024076 X:25190054-25190076 ATAGACACTTAGGGCACAAAGGG + Intergenic
1188576308 X:31655096-31655118 ATTGCAACCTTAGGCATAAATGG - Intronic
1189176083 X:38958848-38958870 ATTTTTCCTTTGGTCACAAAGGG - Intergenic
1189394545 X:40609206-40609228 CTTCTAACTTTGGGCACAGGTGG + Intergenic
1189964622 X:46359845-46359867 ATTTTAACTTTCTGCAGAAAGGG + Intergenic
1190106278 X:47563107-47563129 GTTGTAACTCTGGGATCAAAAGG + Intronic
1190414139 X:50165124-50165146 ATTGTAACCTAAGGCATAAATGG - Intergenic
1191260393 X:58312930-58312952 TTTTTAACTATAGGCACAAATGG - Intergenic
1193707602 X:84842149-84842171 TTTGTAACTTTGGTAAGAAAAGG + Intergenic
1194428499 X:93770711-93770733 ATTTTTACTTTCTGCACAAAGGG + Intergenic
1194780462 X:98019304-98019326 ATTGTAAAATTTCGCACAAATGG + Intergenic
1195716597 X:107825035-107825057 TTTCTAACTTGGGGCAAAAAGGG - Intergenic
1196565899 X:117205293-117205315 ATTGTAACTATGGGAAGTAATGG - Intergenic
1196843700 X:119881588-119881610 TTTGTAACTTTTGGTACAGATGG - Intergenic
1199087246 X:143641588-143641610 TTTGTAACTTTGGCCCCTAATGG + Intergenic
1199394088 X:147313355-147313377 ATTGAAACTTTGCTCACAAATGG - Intergenic
1199781100 X:151060566-151060588 ATTGTATCTCTAGGCACAATAGG - Intergenic
1200789444 Y:7286582-7286604 TTTGTATTTTTGGGTACAAACGG - Intergenic