ID: 961964544

View in Genome Browser
Species Human (GRCh38)
Location 3:130888635-130888657
Sequence AGGGAGAGTGCAGTGGCTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 481
Summary {0: 1, 1: 0, 2: 13, 3: 51, 4: 416}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961964544_961964554 21 Left 961964544 3:130888635-130888657 CCACTAGCCACTGCACTCTCCCT 0: 1
1: 0
2: 13
3: 51
4: 416
Right 961964554 3:130888679-130888701 TGTGTAGCAGGGCTGCTGCTAGG 0: 1
1: 0
2: 1
3: 31
4: 248
961964544_961964555 27 Left 961964544 3:130888635-130888657 CCACTAGCCACTGCACTCTCCCT 0: 1
1: 0
2: 13
3: 51
4: 416
Right 961964555 3:130888685-130888707 GCAGGGCTGCTGCTAGGTTATGG 0: 1
1: 0
2: 0
3: 13
4: 177
961964544_961964556 28 Left 961964544 3:130888635-130888657 CCACTAGCCACTGCACTCTCCCT 0: 1
1: 0
2: 13
3: 51
4: 416
Right 961964556 3:130888686-130888708 CAGGGCTGCTGCTAGGTTATGGG 0: 1
1: 0
2: 0
3: 19
4: 197
961964544_961964552 9 Left 961964544 3:130888635-130888657 CCACTAGCCACTGCACTCTCCCT 0: 1
1: 0
2: 13
3: 51
4: 416
Right 961964552 3:130888667-130888689 GCATATACTCTCTGTGTAGCAGG 0: 1
1: 0
2: 0
3: 7
4: 86
961964544_961964553 10 Left 961964544 3:130888635-130888657 CCACTAGCCACTGCACTCTCCCT 0: 1
1: 0
2: 13
3: 51
4: 416
Right 961964553 3:130888668-130888690 CATATACTCTCTGTGTAGCAGGG 0: 1
1: 0
2: 0
3: 10
4: 129
961964544_961964557 29 Left 961964544 3:130888635-130888657 CCACTAGCCACTGCACTCTCCCT 0: 1
1: 0
2: 13
3: 51
4: 416
Right 961964557 3:130888687-130888709 AGGGCTGCTGCTAGGTTATGGGG 0: 1
1: 0
2: 1
3: 23
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961964544 Original CRISPR AGGGAGAGTGCAGTGGCTAG TGG (reversed) Intronic
902206731 1:14873798-14873820 AGGGAGAGAGCAGTGCAAAGTGG + Intronic
904081967 1:27877860-27877882 AGGCTGGGTGCAGTGGCTGGTGG + Intronic
904128815 1:28260498-28260520 AGGGAGAGCGCAGGGGCTCTGGG + Intronic
904380801 1:30109402-30109424 AGTGAGTGTGAAGTGGCCAGAGG - Intergenic
905187049 1:36204208-36204230 AGGGAGGGTTCAGTAGCTACAGG + Intergenic
906315993 1:44786728-44786750 AGGGAGAGTGGAGAGCCTGGGGG + Intronic
906561794 1:46763625-46763647 AGGGAGCTTGCAGTAGCCAGAGG - Intronic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
907188961 1:52633130-52633152 AGGGGGAGCGCAGTGGGGAGGGG + Intergenic
907850813 1:58253042-58253064 AGGGAGAGAACAGATGCTAGTGG + Intronic
908363273 1:63390800-63390822 AGGGAGAGTGCAGTGACTATGGG - Intronic
909270535 1:73617963-73617985 AGAGACAGTGGAGTGGCTGGGGG - Intergenic
910200758 1:84696076-84696098 AGGAACAGTGAGGTGGCTAGTGG - Intergenic
910274276 1:85431566-85431588 AGGGAGAGAGGAGGGGGTAGAGG - Intronic
910440112 1:87243044-87243066 AGGGAGAAAGCAGTGCCTAACGG - Intergenic
911655021 1:100434333-100434355 AGGAAGAGCCCAGTGGCTACTGG + Intronic
911942859 1:104069513-104069535 AGAGAGAGTGCAATGACTGGGGG - Intergenic
911960846 1:104300915-104300937 AGGGAGGGTGCAGTGACTGAAGG + Intergenic
912018548 1:105072980-105073002 AGGAAGAGTGCAGTGACTGAGGG - Intergenic
914727783 1:150342560-150342582 GGCTAGAGTGCAGTGGCAAGTGG + Intronic
915484545 1:156211206-156211228 AGGGACAGGGAAGTGGCTTGTGG - Exonic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
915931710 1:160064829-160064851 AGGGAGAATGCAGTGCTAAGAGG + Intronic
917869868 1:179231599-179231621 CAGTAGAGTGCAGTGGCTAAGGG + Intergenic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
918683788 1:187389522-187389544 AAGGAGAATGCAGTGGCTTTGGG + Intergenic
918739149 1:188104784-188104806 AGAGATAGTGCAGTGGGTAAGGG + Intergenic
920161005 1:203997567-203997589 TGGGAGAAAGCAGTGGCTATGGG - Intergenic
921032910 1:211349717-211349739 AGGGAGAGTGCAGAGTGTAGTGG + Intronic
921279311 1:213549955-213549977 AGAGAGAGGGCAGTGGGGAGAGG + Intergenic
922362935 1:224839684-224839706 TGGGACAGTGCAGTGGCAACTGG - Intergenic
922377032 1:224979326-224979348 AGGGAGAGTGCAGTGCTTGTGGG + Intronic
923118766 1:230970368-230970390 AGGGATGGGGCAGTGGCTGGAGG + Intronic
923430885 1:233919364-233919386 AGGGACAGTGATGTGGCCAGAGG - Intronic
924261624 1:242237504-242237526 AGGGACAGTGCAGGAGCAAGGGG + Intronic
924516319 1:244769011-244769033 AGGGAGAGCGCAGTGACTGGGGG - Intergenic
1066649838 10:37643670-37643692 AAGGAGAGTGCAGTGATTATGGG - Intergenic
1067030340 10:42875405-42875427 AAGGAGGGTGCAGTGGGCAGGGG - Intergenic
1067032728 10:42889217-42889239 AAGGAGAGTGCAGTGATTATGGG - Intergenic
1068381649 10:56261749-56261771 GGTGAGAGAGCAGTGGCTACTGG - Intergenic
1069050571 10:63788305-63788327 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1069112296 10:64462812-64462834 AGGGAGAGTGCAGCAGAAAGAGG + Intergenic
1069852519 10:71419315-71419337 AGGGGGAGAGCAGAGGCTAAGGG - Intronic
1070764188 10:79047183-79047205 TGGGAGAGTCCAGTGGGTGGAGG + Intergenic
1070804241 10:79261382-79261404 AGGGAGAGAGCAGGCGCTGGAGG + Intronic
1073027270 10:100497182-100497204 AGGGAGTGTGGAGCGGCTGGTGG - Exonic
1073576691 10:104631798-104631820 AGGGAGACTGCAGAGCCTAGTGG - Intergenic
1075234535 10:120714799-120714821 ATGGAGTGGGCAGAGGCTAGGGG + Intergenic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1075536317 10:123275035-123275057 AGGGAGGGGGCAGGGGCTGGCGG + Intergenic
1075812319 10:125233423-125233445 ATGGAAACTGCAGTGGCTATTGG - Intergenic
1075895318 10:125989969-125989991 GGGGAGTGTGCAGTGGCAGGAGG - Intronic
1076274123 10:129182222-129182244 AGGGAGAGGGGAGTGGCAAGAGG - Intergenic
1076633528 10:131867732-131867754 AGGGAGAGCGGAGTGGTTTGTGG + Intergenic
1076816793 10:132918986-132919008 AGGCAGAGGGCAGTGGCCACAGG - Intronic
1077317819 11:1927153-1927175 AGGGAGGGTGGAGGGGCAAGTGG + Intronic
1080938394 11:36886064-36886086 AGGGAGAGTCCAGTGGCAGCAGG - Intergenic
1083433993 11:62630337-62630359 AGGGAGAGTTGATTGGCCAGCGG - Intronic
1083736391 11:64683920-64683942 AGGGAGAGGTCTGTGGCTAGGGG - Intronic
1083891785 11:65599321-65599343 AGGGAGGGAGGAGTGGCTGGTGG - Intronic
1084660848 11:70545431-70545453 AGAGAGCGTGCGGTGGCTCGGGG - Intronic
1084749276 11:71193602-71193624 GGGGAGCAGGCAGTGGCTAGGGG - Intronic
1084868895 11:72082359-72082381 ATATAGAGTGCAGTGGCAAGAGG - Intronic
1085572244 11:77569531-77569553 AGGGAGAGTGCAGTGATTATGGG - Intronic
1087029126 11:93684715-93684737 AGGGAGAGTCCAGTGGCAGCAGG - Intronic
1087190477 11:95249192-95249214 AGGAAGAGAGCAGTGGGAAGTGG + Intergenic
1087250333 11:95891857-95891879 AGAGAGAGTGCACAGGATAGAGG + Intronic
1088507827 11:110543039-110543061 AAGGAGAGTGTTGTGGCCAGTGG + Intergenic
1088651270 11:111959524-111959546 AGGGCAAGTGGAGTGGCAAGGGG - Intronic
1089311374 11:117560359-117560381 AAGGGGACTGCAGTGGCTACAGG - Intronic
1089769493 11:120793203-120793225 AGGCAGAGTGCAGTGGGTCGAGG + Intronic
1090031223 11:123208268-123208290 AGGGACATTCCAGTGGCTAGAGG - Intergenic
1090529440 11:127575530-127575552 AGGGAGAGTGCAGGAGATGGAGG + Intergenic
1091688120 12:2578195-2578217 AGGGATAGAGCGGTGGCCAGGGG + Intronic
1091854496 12:3728570-3728592 AGGAAGAGTGCAGGGGTGAGGGG - Intronic
1092062292 12:5561296-5561318 GGGGAGAGTGCGGTGACCAGTGG - Intronic
1092171735 12:6377628-6377650 AGGGAGACTGGAGTTTCTAGGGG - Intronic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1096236293 12:49929539-49929561 AGGTAGAGAGCTGTGGGTAGGGG - Intergenic
1096355964 12:50941266-50941288 AGGCTGAGTGCAGTGGCTCATGG - Intergenic
1096553138 12:52387225-52387247 AGGGACTCTGCAGTGTCTAGAGG - Intergenic
1096666788 12:53171449-53171471 AGGGAGGGGGCGGTGGCAAGAGG + Intronic
1096975856 12:55698985-55699007 AGGGAGGGGGCAGGGGCTGGGGG - Intronic
1097466999 12:59938718-59938740 AGTGAGAGTTCAGTGGCGGGAGG - Intergenic
1097619177 12:61919316-61919338 AGTGAGAATGCAGGGGGTAGTGG - Intronic
1097714859 12:62955206-62955228 ATGTAGAGTGCAGTGACTAAGGG - Intergenic
1097899388 12:64857899-64857921 TGGGAGAGTGCAGTGACTAGAGG - Intronic
1098405573 12:70122901-70122923 AGAGAGAGTGCAGTGACTAGAGG + Intergenic
1098419114 12:70272740-70272762 AGGGAGAGTGAAGGGATTAGAGG - Intronic
1098635440 12:72778975-72778997 AGGGAAAGTCCACTGGATAGAGG - Intergenic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1101092610 12:101303379-101303401 AGGGAGAGTCCAGAGGTGAGGGG + Intronic
1102356582 12:112241909-112241931 AGAGAGGGTTCAGTGGCTGGAGG - Intronic
1103163878 12:118753559-118753581 AGGCAGATGGCAGTGGGTAGAGG + Intergenic
1103398869 12:120628854-120628876 AGGGATAGTGCAGTAGCCATGGG + Intergenic
1103960260 12:124605114-124605136 AGTTAGAGTGCAGTGCCAAGTGG + Intergenic
1104437196 12:128765753-128765775 AAGGAGGGTGGAGTGGCTGGGGG - Intergenic
1105764405 13:23545133-23545155 AGGGAGGGTGTGGTGGCTGGGGG - Intergenic
1106350213 13:28922631-28922653 AGGGAGAGCGCAATGACTGGGGG - Intronic
1106814046 13:33387650-33387672 AGGGACAGTGCAGTGGCAGCAGG + Intergenic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1108856924 13:54804146-54804168 ACGGAGAGTGGAATGGCGAGAGG + Intergenic
1110076466 13:71250562-71250584 AGGGAGAGTGGTGGGGGTAGGGG + Intergenic
1110464989 13:75790216-75790238 GGGGACAGGGCAGTGGCTGGAGG - Intronic
1110665874 13:78116770-78116792 AGGGAGAATGCAGTGACTGTGGG - Intergenic
1112206662 13:97330418-97330440 AGGGAGGGTCCAGTGCCTAGTGG - Intronic
1112944499 13:104910748-104910770 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1115133883 14:30086206-30086228 AGGGAGAGCACAGTGACTGGGGG + Intronic
1116413091 14:44648980-44649002 AGGGAGAGTTCAGTGATTATGGG + Intergenic
1116888951 14:50249001-50249023 AGGGAGGGTACAGTGGCTGGGGG + Intronic
1117161617 14:52995341-52995363 AGGGAGAGCACAGTGACTATGGG - Intergenic
1117342724 14:54805726-54805748 AGGGTGTGTGGTGTGGCTAGAGG - Intergenic
1117384369 14:55195809-55195831 AGGGAGAGCGCAGTGACTGATGG - Intergenic
1117557959 14:56906099-56906121 AGGGACAGAGCAGTGGCTTAAGG + Intergenic
1117618478 14:57559303-57559325 AGGGAGAGTGTAGCGGGTAATGG - Intergenic
1118040011 14:61906198-61906220 AGGGAGAGGGCTGTGTCTACTGG + Intergenic
1119773432 14:77235436-77235458 AGGGGGACTGCAGTGGGTGGGGG + Intronic
1119773489 14:77235612-77235634 AGGGGGACTGCAGTGGGTGGGGG + Intronic
1119847830 14:77843877-77843899 CTGGAGAGGGCAGTTGCTAGTGG - Intronic
1121441986 14:93955284-93955306 TGGGAGAGTGCAGGGGCTGGTGG - Intronic
1121467213 14:94123587-94123609 AGAGAGAGTGTAGCGGGTAGGGG + Intergenic
1122054283 14:99082013-99082035 AGGGACAGTGCAGGGGGTGGGGG + Intergenic
1122115196 14:99523974-99523996 AGGGTGAGTGCTGGGCCTAGGGG - Intronic
1122271719 14:100571257-100571279 GAGGAGAGAGCAGGGGCTAGTGG - Intronic
1122427470 14:101620267-101620289 AGGAAGCGTGCTGTGGCCAGAGG - Intergenic
1125713138 15:41803444-41803466 AGGCAGGGTGCAGTGGCTTTGGG + Intronic
1125908120 15:43412482-43412504 AGGAAGGCTGCAGTGGGTAGAGG - Intronic
1126277865 15:46905643-46905665 CAGGAGAGTGCAGTGTATAGGGG + Intergenic
1126452453 15:48823566-48823588 AGGGAGAATGCAGTGCCTTGGGG - Intergenic
1126838874 15:52696248-52696270 TGGGAGAGAGGAATGGCTAGAGG - Intronic
1127493203 15:59484558-59484580 AGGGAGAGTGCAGTGTTTATGGG + Intronic
1130641105 15:85676265-85676287 AGGCAGAGAGCAGTGGCAATAGG + Intronic
1131524068 15:93138807-93138829 AGGGACAGTTCAGCTGCTAGAGG + Intergenic
1131872285 15:96775397-96775419 AGAGAGAGGGCTGTGGTTAGGGG - Intergenic
1132932478 16:2465998-2466020 GGTGAGAGTGGAGTGGCTAAAGG - Intergenic
1134330821 16:13249780-13249802 AGCTAGAGTGCAGTGGCATGTGG + Intergenic
1134549420 16:15132212-15132234 AGGGGGAGGGGAGGGGCTAGGGG + Intronic
1134549468 16:15132329-15132351 GGGGAGGGGGCAGGGGCTAGGGG + Intronic
1134815187 16:17199893-17199915 AGGCAGAGGGCATTGGGTAGAGG + Intronic
1135464695 16:22675329-22675351 AGGGAGGAGGCAGTAGCTAGTGG + Intergenic
1136676615 16:31914175-31914197 ACGGAGAGCACAGTGACTAGGGG - Intronic
1136922410 16:34343974-34343996 AGGGAGTGTGCAGTGGTGGGGGG - Intergenic
1136982163 16:35067832-35067854 AGGGAGTGTGCAGTGGTGGGGGG + Intergenic
1138023681 16:53505649-53505671 AGAGAGAGAGCAGTGGTCAGGGG - Intergenic
1138316833 16:56077530-56077552 ACGGAGAGAGCAGTGACCAGAGG + Intergenic
1138509740 16:57501548-57501570 AGGGAGAGTGTTCTGGGTAGAGG + Intergenic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1139769477 16:69262271-69262293 AGTGAGAGTTCAGAGGGTAGGGG + Intronic
1141590511 16:85065713-85065735 AGGGACAGGGCTGTGGTTAGAGG + Intronic
1141621446 16:85238589-85238611 AGGGGGAGTGCAGAGGCTGGCGG - Intergenic
1142339464 16:89511496-89511518 AGGGAGAGTGCCGTGCCCACTGG + Intronic
1142760015 17:2036630-2036652 AGGGCAAGGGCAGTGGCTGGGGG - Exonic
1144486577 17:15670519-15670541 GGGGTGAGGGCAGTGGATAGTGG - Intronic
1144914443 17:18711768-18711790 GGGGTGAGGGCAGTGGATAGCGG + Intronic
1145246659 17:21274050-21274072 AGGGTGGGTGCAGTGGCTTGGGG - Intergenic
1145943624 17:28757677-28757699 AGGGCAAGTGCAGTGGCTGTGGG + Exonic
1145981445 17:29014558-29014580 AGGCAGATTGCTGAGGCTAGTGG - Intronic
1146794886 17:35773916-35773938 GGGCAGAGTGAAGTGTCTAGAGG - Intronic
1147167011 17:38598894-38598916 ATGGAGAAGGGAGTGGCTAGAGG - Intronic
1148124852 17:45231316-45231338 AGGGAGGCTGCAGAGGCTGGGGG + Intronic
1148690209 17:49522793-49522815 AGACAGAGGGCAGTGGCCAGAGG + Intergenic
1148698578 17:49575496-49575518 AGGGAGAGGGTGGTGGCCAGGGG - Intergenic
1148746709 17:49922396-49922418 AGGCAGAGGGCAGAGGGTAGAGG - Intergenic
1149332596 17:55601997-55602019 AGAGAGAGCTCAGTGGCTTGTGG - Intergenic
1150555740 17:66252614-66252636 ACGGAGATTGCAGTGAGTAGAGG + Intronic
1150830172 17:68512021-68512043 AGGGAGAGTGGGGTGGACAGAGG + Intronic
1151715331 17:75828120-75828142 GGGGAGAGGGCAGTGCCTGGTGG + Intronic
1157042779 18:44060334-44060356 AGAGAGAGTGGAGTGGCAAGGGG + Intergenic
1157100425 18:44724197-44724219 AGGGAAGTTGCAGTGGTTAGAGG + Intronic
1157275461 18:46308146-46308168 AAGGAGAGTGCAATGGATATTGG - Intergenic
1157549382 18:48570755-48570777 AGAGTGAGTGCAGGGGGTAGGGG + Intronic
1158430628 18:57383175-57383197 AGGAATAGTGCAGTGGCCGGGGG - Intergenic
1159564856 18:70036979-70037001 AGGGAGAGAGCAGCGACTGGGGG + Intronic
1159680210 18:71340722-71340744 AGGAAGAGTGGGGTGGCAAGGGG + Intergenic
1160301933 18:77689734-77689756 CGTGAGACTGCAGTGCCTAGGGG - Intergenic
1160459425 18:79026677-79026699 CGGGAGAGTGAAATGGGTAGGGG - Intergenic
1160517771 18:79487985-79488007 AGGGAGTGGGCAGTGGCTCCAGG - Intronic
1160693128 19:469266-469288 CTGGAGAGTGCAGTGGCTCATGG + Intronic
1160846989 19:1170397-1170419 GGCGAGAGTGCAGAGGCGAGGGG + Intronic
1161159576 19:2754516-2754538 AGGGAGACAGCAGAGGGTAGAGG + Intergenic
1161258259 19:3321645-3321667 AGGGAGAAGCCACTGGCTAGGGG + Intergenic
1161497392 19:4594527-4594549 AGGCTGAGTGCAGTGGCTCACGG + Intergenic
1162494935 19:11018340-11018362 AGGCAGAATGCAGTGGGGAGGGG - Intronic
1165063129 19:33214576-33214598 AGGGAGTCTGCTGTAGCTAGAGG - Intronic
1165424162 19:35736834-35736856 GGGGGGAGTGCAGTGGCAGGAGG + Intronic
1167609999 19:50502350-50502372 AGGGAGAGTGAGGTTGCGAGTGG - Intergenic
1167793469 19:51694446-51694468 AGGGAGGGAGCAGGGGCTGGGGG - Intergenic
1168076969 19:53985880-53985902 AGGGAGAGGGAACTGGTTAGGGG + Exonic
1168544337 19:57238112-57238134 AGGCCGAGTGCAGTGGCTCACGG - Intergenic
924998747 2:386926-386948 AGGGAGAGCGCAGAGGGCAGAGG - Intergenic
925588470 2:5486942-5486964 AGAGAGAGTGCAGTGATTATGGG + Intergenic
925975568 2:9139817-9139839 GGGGAGAGTGCAGGGGCAAAGGG - Intergenic
927491115 2:23521548-23521570 AGGCAGAGAGGAGTGGCTACTGG - Intronic
929011119 2:37446066-37446088 TGGCAGAGTGCAGGGGCTGGGGG + Intergenic
930439784 2:51391220-51391242 AGGGAGAGTACAGTGACTGGGGG - Intergenic
932073786 2:68644768-68644790 AGGGAGAGAGCAGGGGACAGGGG + Intronic
932220979 2:69998834-69998856 TGGGAGAGGGCACTGGCTAGAGG + Intergenic
932389408 2:71372450-71372472 AGGGACAGCGCAGTAACTAGGGG - Intronic
932517456 2:72367732-72367754 AGGGAGAGTGCAGCAACTGGGGG + Intronic
933722818 2:85409270-85409292 AGGCAGAGAGCAGGGGCTAGGGG + Intronic
934777228 2:96947182-96947204 AGGGAGGGTGCAGCCACTAGGGG + Intronic
934947907 2:98555225-98555247 AGGAAGTCTGCAGTGGCAAGAGG + Intronic
935437954 2:103056898-103056920 AGGGAGAGTGCCGTGACTAGGGG - Intergenic
935662841 2:105484860-105484882 GGGGAGAGTCCAGTGGCGGGGGG - Intergenic
935712593 2:105912541-105912563 AGGGAGTGTGCCATGGCAAGGGG + Intergenic
936706382 2:115079712-115079734 AGTGAGAGAGAAGTGTCTAGAGG + Intronic
937613670 2:123893905-123893927 AGGGAGAGTGCAGATACTGGGGG - Intergenic
937929156 2:127191485-127191507 CGGGAGGGTGCAGTGGCTGCGGG + Intronic
938390311 2:130899660-130899682 ATGGAGAGGACTGTGGCTAGAGG + Intronic
938991464 2:136634277-136634299 AGGGAGGATACAGTGGCAAGGGG - Intergenic
939611150 2:144312511-144312533 AGTGAGAGAGCAGTAGGTAGAGG - Intronic
939708027 2:145479185-145479207 AGGAAGACTGCAGTGACTAAGGG - Intergenic
940285163 2:152026658-152026680 AGGCCGAGTGCAGTGGCTCATGG - Intronic
941047642 2:160694739-160694761 AGGGAGAGTGCAGTGACTGGTGG - Intergenic
942481742 2:176395430-176395452 AGTGAAAGTGCCATGGCTAGAGG - Intergenic
942668590 2:178349306-178349328 AGGGTCAGTGAGGTGGCTAGGGG - Exonic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
943099656 2:183472223-183472245 AGGGAGAGTGCAGTGACTATGGG - Intergenic
943867047 2:192938491-192938513 AGGGAGAGTGCAGTGACTGAGGG - Intergenic
944427437 2:199598167-199598189 AGGGCTAGTGCAGTAACTAGGGG - Intergenic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944660450 2:201917213-201917235 AGGGAGAGTGCAGACATTAGTGG + Intergenic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
946059319 2:216928085-216928107 AAGGAGAGTGGAGTGGTTAAGGG - Intergenic
946421060 2:219565118-219565140 AGGGAGAGTCCAGTGGCCCAGGG - Intronic
946507612 2:220318271-220318293 TAGGAGACTGCAGAGGCTAGAGG + Intergenic
946709757 2:222493614-222493636 AGGCTGAGTGCAGTGGCTCATGG - Intronic
947911987 2:233807688-233807710 AGGGTGAGGGCAGGGGCCAGTGG - Intronic
948632996 2:239313893-239313915 AGGGACGGTGCAGTGGTAAGAGG - Intronic
948774555 2:240277081-240277103 AGGGAGAGAGCAGTGACTGTGGG + Intergenic
1169083544 20:2813381-2813403 AGGGAGAGAGTGGTGGTTAGGGG - Intergenic
1169101162 20:2950951-2950973 AGGGAGTGGGCAGGGGCAAGAGG - Intronic
1169229064 20:3874930-3874952 AGGGTGAGCCCAATGGCTAGAGG + Exonic
1169717143 20:8632563-8632585 ATGGAGAGTGCAGTGGAAAAGGG + Intronic
1170024264 20:11871986-11872008 AGGGAGTGTGCAGAAGCTGGGGG - Intergenic
1170668266 20:18405886-18405908 AGGGAGAGCACAGTGACTGGGGG + Intronic
1171343607 20:24449050-24449072 AGGGTGAGTGCAGGAGCTGGGGG - Intergenic
1171819704 20:29823564-29823586 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1171898116 20:30829615-30829637 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1172129783 20:32647980-32648002 AGGGTGAGAGAAGTGGGTAGGGG - Intergenic
1172589194 20:36105653-36105675 AGGGAGAGAGAAGTGGCCAGTGG - Intronic
1173718929 20:45236254-45236276 GGGAAAAGTGCAGTGGCTACTGG + Intergenic
1173830767 20:46085767-46085789 AGGAAGAATCTAGTGGCTAGAGG + Intronic
1173895495 20:46547654-46547676 AGGGAGAGTTCGGTGGCTTTTGG + Intronic
1174253199 20:49234724-49234746 AGAGAGAGTGCAGGGACGAGGGG - Intronic
1174865361 20:54130582-54130604 AGGGATTGGGCAATGGCTAGTGG + Intergenic
1175985798 20:62763679-62763701 AGGGAGAGTGCAGGAGTGAGGGG + Intergenic
1176096704 20:63347646-63347668 GGGGCGAGGGCAGTGGCCAGCGG - Intronic
1177264935 21:18770308-18770330 AGGGAGAGATCAGTGTCGAGTGG + Intergenic
1178365539 21:31986346-31986368 AGAGAGAGTGCAGGGGTTGGAGG - Intronic
1178756467 21:35354704-35354726 AGGCAGTGAGCAGGGGCTAGGGG + Intronic
1178940623 21:36902215-36902237 AGGAATGGGGCAGTGGCTAGAGG + Intronic
1179585389 21:42371043-42371065 AGGGTGTGGGCAGTGGCTGGAGG - Intergenic
1179585528 21:42371653-42371675 AGGGAGTGAGCAGTGGCCGGAGG - Intergenic
1180071244 21:45436794-45436816 AGGGAGGGAGCTGTGGCTACTGG + Intronic
1180323704 22:11348255-11348277 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1180998049 22:19975246-19975268 AGGGACAGGGCAGTGCCTATTGG - Intronic
1181008775 22:20028077-20028099 AGGTAGGGTGCAGTGGCTCATGG - Intronic
1181725887 22:24810646-24810668 GGGGAGAATGCAGGGGCTGGTGG + Intronic
1182722040 22:32410988-32411010 AGGGAGAGCGCAGTGGTTCATGG - Intronic
950202843 3:11057068-11057090 GGGGAGAGTGCAGTGGCCAAAGG - Intergenic
953019688 3:39105544-39105566 TAGGAGAGGGCAGTGGTTAGGGG - Intronic
953391663 3:42537371-42537393 AGGGAGGGTGGGGTGGCAAGGGG - Exonic
953458486 3:43062777-43062799 AGGGTGGGGGCCGTGGCTAGGGG - Intergenic
953461925 3:43088455-43088477 AGGAAGAGGGCAGTGGCTGCTGG - Intronic
953899494 3:46831706-46831728 AGGGAGATTGCACTGCCTGGGGG - Intronic
954726275 3:52613635-52613657 ATGGAAAGTACAGTGGCCAGGGG - Intronic
954991512 3:54844350-54844372 AGGCAGAATGCAGTGGGTTGAGG + Intronic
956118871 3:65945888-65945910 AGAGACAGAGCAGTGGCTAAAGG + Intronic
959191072 3:103112399-103112421 AGGGAGACTGCAGTGACTGGGGG + Intergenic
961077817 3:123998093-123998115 AGGCAGAGGGGAGTGGCTAAGGG - Intergenic
961306753 3:125963242-125963264 AGGCAGAGGGGAGTGGCTAAGGG + Intergenic
961443531 3:126967042-126967064 AGGGAGGGGGCAGTGGGCAGAGG - Intergenic
961649061 3:128408454-128408476 TGGGAGTGTGCAGGGGCTGGAGG - Exonic
961753735 3:129113985-129114007 AGGTGGAGTGCAGTGGCGCGAGG - Intronic
961964544 3:130888635-130888657 AGGGAGAGTGCAGTGGCTAGTGG - Intronic
963115655 3:141726882-141726904 TGGCTGGGTGCAGTGGCTAGTGG - Intergenic
963820502 3:149887170-149887192 AGCGAGAGCACAGTGACTAGAGG + Intronic
963951704 3:151209016-151209038 AAGTGGAGTGAAGTGGCTAGTGG + Intronic
965403756 3:168245960-168245982 AGGGAGAGTGAAGTGGCATGTGG + Intergenic
969173682 4:5383682-5383704 AGGGTGAGTCCACTGCCTAGTGG - Intronic
969610182 4:8223319-8223341 AGGCAAAGTGCAGTGGGCAGAGG - Intronic
969963621 4:10972066-10972088 AAGGAAAGAACAGTGGCTAGAGG - Intergenic
970368813 4:15387579-15387601 AGGGGGATTCCAGTGACTAGTGG + Intronic
970442356 4:16092789-16092811 AGAGAGAGCACAGTGGCTGGGGG + Intergenic
970963233 4:21897959-21897981 AGGGAAAGTGCAGTGATTATGGG + Intronic
972278568 4:37582066-37582088 AGGGAGAGTACAGTGATTTGGGG - Intronic
972386837 4:38575108-38575130 ATGGAGAGTCCAGTGGCCAGCGG - Intergenic
973387222 4:49520658-49520680 AGGGTGAGGGTTGTGGCTAGGGG + Intergenic
973719835 4:53711891-53711913 ATGGAAGGTGCAGTGGCAAGAGG - Intronic
974027520 4:56746748-56746770 AGGGAGAGGGAAATGGCAAGAGG - Intergenic
975740925 4:77428077-77428099 AGGAAAAGGGCAGTGGCTAGAGG - Intronic
976381662 4:84406358-84406380 AGGGTGAGTGCAGAGGGCAGAGG + Intergenic
976578004 4:86698824-86698846 TGGGAGATAGCAGTAGCTAGGGG + Intronic
977325803 4:95573082-95573104 AAGGAAAGTGCAGTGACTGGAGG - Intergenic
979241597 4:118452026-118452048 GGCTAGAGTGCAGTGGCAAGTGG + Intergenic
979675328 4:123403068-123403090 AAGGAGAGGGCAGTGGTTAAAGG - Exonic
980158476 4:129133567-129133589 AGGGACAGTGCTGGAGCTAGAGG + Intergenic
981871197 4:149487737-149487759 AAGGAGAGTGCAGTGACTAGGGG - Intergenic
982683486 4:158459943-158459965 AAGGAGAGTGCAGTGGCTGGGGG - Intronic
982932570 4:161428075-161428097 AAGGAGAGTGCAGTGGTTTTAGG + Intronic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
984850993 4:184152357-184152379 AGGGAGGGGGCAGTGGAGAGGGG - Intronic
985896695 5:2753056-2753078 AGAGAGAGCGCAGTGGCCTGGGG + Intronic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
986268460 5:6210874-6210896 AGGCTGAGTGCAAAGGCTAGGGG + Intergenic
986450367 5:7857537-7857559 AGGAAGAGAGCAGGGTCTAGGGG - Intronic
986631304 5:9776246-9776268 AGGGAGAGTGCAGTGACTACAGG - Intergenic
986848249 5:11780504-11780526 CTGGAGAGTGCAGAGGCTATGGG + Intronic
987616003 5:20275877-20275899 AGGGAGAGTGCAGTGATTTGGGG + Intronic
987645777 5:20671244-20671266 AGGGAGAGTGAAGTGACTGTGGG + Intergenic
987709243 5:21487606-21487628 AGCTGGAGTTCAGTGGCTAGTGG - Intergenic
988750369 5:34186546-34186568 AGCTGGAGTTCAGTGGCTAGTGG + Intergenic
989068006 5:37483013-37483035 AGCTGGAGTTCAGTGGCTAGTGG - Intronic
989470276 5:41808694-41808716 ACATAGAGTGCAGTGGCAAGGGG - Intronic
990827817 5:59922044-59922066 AGGGAGAGTGCAGCGACTGGGGG + Intronic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
991359144 5:65802216-65802238 AGGGCAAGTGGAGTGGCAAGGGG + Intronic
991738630 5:69649745-69649767 AGCTGGAGTTCAGTGGCTAGTGG + Intergenic
991759568 5:69906682-69906704 AGCTGGAGTTCAGTGGCTAGTGG - Intergenic
991787768 5:70211436-70211458 AGCTGGAGTTCAGTGGCTAGTGG + Intergenic
991790205 5:70229486-70229508 AGCTGGAGTTCAGTGGCTAGTGG + Intergenic
991818089 5:70525862-70525884 AGCTGGAGTTCAGTGGCTAGTGG + Intergenic
991838797 5:70781748-70781770 AGCTGGAGTTCAGTGGCTAGTGG - Intergenic
991936601 5:71808081-71808103 AGGGTGAGTGGAGTGGGCAGGGG + Intergenic
993013630 5:82511206-82511228 AGGGAGACTGGAGAGGCTGGTGG + Intergenic
993233462 5:85270127-85270149 GGGGAGAGGGCAGGGGCTGGAGG - Intergenic
993279264 5:85904750-85904772 AGGGAAAGTGCAGTGACTGAGGG + Intergenic
993287454 5:86017133-86017155 ATGGAGAGTACAGTGACTGGAGG - Intergenic
993416378 5:87638500-87638522 AGGGAGGGTGAAGTGGGTGGGGG + Intergenic
993703232 5:91142987-91143009 AGGGCGAGTGGAGTGGCGAGGGG + Intronic
994421364 5:99528949-99528971 AGCTGGAGTTCAGTGGCTAGTGG - Intergenic
994485678 5:100385365-100385387 AGCTGGAGTTCAGTGGCTAGTGG + Intergenic
995290372 5:110444374-110444396 AGGGAGAGCTCAGTGACTGGGGG - Intronic
995310695 5:110707348-110707370 AGGGAGAGTGCAGTAACTGCAGG + Intronic
996459424 5:123724728-123724750 AGGGAGAGTGCAGCGACCGGGGG + Intergenic
996775793 5:127131066-127131088 AGGGAGAATGGAGAGGCAAGAGG + Intergenic
997647343 5:135490131-135490153 CAGGAGAGTGCGGTGGCTCGGGG + Intergenic
998201517 5:140127321-140127343 GGGGAGTGTGCACTGGCTGGAGG + Exonic
998894739 5:146787538-146787560 AGGGAGAGGGGAGAGGCGAGAGG - Intronic
999559448 5:152785117-152785139 AGGGAGAGTGCACTGACTGTGGG + Intergenic
999900833 5:156085400-156085422 AGGGAGAGGGGAGTGGGGAGAGG - Intronic
1000266399 5:159641874-159641896 AGGGTGAGTGGAATGGCGAGGGG - Intergenic
1000484798 5:161828280-161828302 AGGGAATTTGTAGTGGCTAGTGG - Intergenic
1000699118 5:164426175-164426197 TGGGTGAGTGCAGAGGGTAGGGG + Intergenic
1001265445 5:170270934-170270956 AGGGACAGTGCAGTTTGTAGAGG + Intronic
1001403676 5:171461217-171461239 AGGGGGAGGGCAGTGGGGAGGGG + Intergenic
1001403685 5:171461235-171461257 AGGGGGAGGGCAGTGGGGAGGGG + Intergenic
1002334953 5:178471169-178471191 AGGGACAGTGCAGTTCCCAGAGG + Intronic
1003346433 6:5272218-5272240 AGGGTGAGTGCAGTGGGATGAGG + Intronic
1003541892 6:7025441-7025463 AGGGTGGGTGCAGAGGCTGGTGG - Intergenic
1004767171 6:18742757-18742779 AGGTAGAGTCCAGTGGCGAGTGG + Intergenic
1005548437 6:26892849-26892871 AGCTGGAGTTCAGTGGCTAGTGG + Intergenic
1006143849 6:31946592-31946614 AGGCAGAGTGCAGAGGTTTGAGG + Exonic
1007169310 6:39851576-39851598 CTGGTGTGTGCAGTGGCTAGGGG + Intronic
1007769705 6:44183089-44183111 AGGGAGAGAGAAGTGGGGAGGGG - Intronic
1008175629 6:48264898-48264920 AGGGGGAGATAAGTGGCTAGGGG - Intergenic
1009019196 6:57933951-57933973 AGCTGGAGTTCAGTGGCTAGTGG + Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1015531548 6:134226071-134226093 GGCTAGAGTGCAGTGGCAAGTGG - Intronic
1015569295 6:134604724-134604746 AGGGACAGAGCAGTGGCAGGTGG - Intergenic
1015578934 6:134702470-134702492 AGAGAGAGTGCAGTGACTGTGGG - Intergenic
1015707465 6:136103793-136103815 AGGGACAGAGCAGTAGCTACTGG - Intronic
1015746622 6:136516500-136516522 AGGGAGAGTGAAGTGGAGAGAGG + Intronic
1016086684 6:139923444-139923466 AGGGAGATAGCAGTGGCTGCAGG - Intergenic
1017672610 6:156779941-156779963 AGGGAACGTGCTGTGGCTAAAGG - Intronic
1017751245 6:157492208-157492230 AGGGAGACTACAGTGGCTGGGGG - Intronic
1018689363 6:166332539-166332561 AGGCTGGGTGCAGTGGCTCGTGG - Intronic
1019144679 6:169969116-169969138 AGGGAGAGTGGAGTCTCTGGAGG + Intergenic
1019381342 7:725953-725975 AGGGAGAGGGCAGTGCTTATTGG - Intronic
1020255098 7:6498398-6498420 AGGATGAGTTCAGTGGCCAGTGG - Intronic
1020708088 7:11570779-11570801 AGGGAGACAGCAGTGGGTAGGGG + Intronic
1021123629 7:16825635-16825657 AGGGAGAATGCAGTGATTATGGG + Intronic
1022355019 7:29606557-29606579 AGAGAGAGGGCAGTGGATGGAGG - Intergenic
1023139328 7:37085226-37085248 AGGGAGTCTGCAGTAGTTAGGGG - Intronic
1023646163 7:42318271-42318293 AGGGAGAGTGCAGTGGTTGTGGG + Intergenic
1023998149 7:45174560-45174582 AGGGATGGTGCAGTGGCTATAGG - Intronic
1024562756 7:50658327-50658349 GGGGAAAGTGCATTGTCTAGTGG + Intronic
1024705956 7:51959785-51959807 AGGAAGAATGCAGTGACTGGGGG - Intergenic
1024956469 7:54926456-54926478 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1026231126 7:68485033-68485055 AGGGAGACTGCAGAGGGTAGTGG + Intergenic
1026404185 7:70047993-70048015 TGGGAGAGTGTCTTGGCTAGAGG + Intronic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1029042610 7:97593395-97593417 AGGGAGAGTGCAGTGGCTGTGGG - Intergenic
1029367311 7:100124933-100124955 AGGGAGAGTGCAGGCTTTAGAGG - Exonic
1031243857 7:119281647-119281669 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1031753665 7:125611459-125611481 AGAGAGAGTGCAGTGATTATGGG + Intergenic
1031862198 7:126993674-126993696 AGGGAGAGCACAGTGACTGGGGG + Intronic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034847914 7:154464261-154464283 AGGGAGAATGCAGTGACTGTGGG - Intronic
1035548122 8:499409-499431 AGGGACAGTGGTGTGGTTAGTGG - Intronic
1035817934 8:2561463-2561485 AGGGAGGGTGCAGAGGCTCAGGG - Intergenic
1036571027 8:9979984-9980006 AGGGAGGAGGCAGTGGCTGGAGG + Intergenic
1037902115 8:22694501-22694523 AGGGGGAGGGCAGAGACTAGGGG - Intergenic
1038921714 8:32092176-32092198 TGGCAGGGTGCAGTGGCTCGTGG + Intronic
1041310633 8:56512913-56512935 GGGGACAGTGCAGTGGGAAGGGG - Intergenic
1041744881 8:61197878-61197900 AGGGAGAGAACAGTGACTATAGG - Intronic
1042338848 8:67657834-67657856 AGGGAGAGTGCACTGGCATGAGG - Intronic
1043079972 8:75754838-75754860 AGGGAGAGTGCAGTGACTATGGG + Intergenic
1043164390 8:76885267-76885289 AGGGATAGTGGAGAGGCAAGTGG - Intergenic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1044516068 8:93140300-93140322 AGGCCGGGTGCAGTGGCTAATGG + Intronic
1044725612 8:95192147-95192169 GGGGACAGAGCAGTGGCTTGAGG - Intergenic
1044774831 8:95677437-95677459 AGGGTGAGTGCAGCAGCAAGGGG + Intergenic
1045347871 8:101310879-101310901 GGGGAGAGTGAAGAGGCTGGAGG - Intergenic
1046804177 8:118462413-118462435 AGGGACTGTGCAGGGGATAGTGG + Intronic
1047288474 8:123508341-123508363 GGGGAGGGAGCAGTGGCAAGGGG + Intronic
1047349646 8:124061600-124061622 AGAGAGAGTGCAGAGGTGAGAGG + Intronic
1047364988 8:124203500-124203522 TGGTATAGTACAGTGGCTAGGGG - Intergenic
1048387922 8:133930552-133930574 GGGGAAAGTTCTGTGGCTAGGGG + Intergenic
1049478189 8:142806592-142806614 AGGGAGAGTGCAGAGGGGAGGGG - Intergenic
1049538619 8:143194768-143194790 AGGGCCAGTGCAGGGGCTGGTGG + Intergenic
1049580115 8:143407267-143407289 AAGGAGAGCTCAGTGGCTGGTGG + Intergenic
1050248062 9:3713005-3713027 TGGAAGAGTGCAGTGACTGGGGG + Intergenic
1051345609 9:16148094-16148116 AGGGAGAGTGCAGTGGGTGGGGG + Intergenic
1051352415 9:16210237-16210259 AGGGAGAGTGCATGGGAGAGAGG + Intronic
1051464941 9:17367190-17367212 AGGGAGAATGCAGTGACTGTTGG + Intronic
1052367896 9:27633853-27633875 TGGGAGATTGCAGTGGCAAAGGG - Intergenic
1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054256202 9:62815755-62815777 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054335103 9:63799859-63799881 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1056492946 9:87125758-87125780 ATGGAGGGAGCAGTGGTTAGAGG - Intergenic
1056720259 9:89065144-89065166 GGGCAGAGTGAAGTAGCTAGGGG + Intronic
1057549301 9:96040214-96040236 AGGAAGAGTGCAGAGGCTGGCGG - Intergenic
1058285363 9:103170065-103170087 AGGGAGAGGGCAGTGACTGTGGG - Intergenic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1060060756 9:120457310-120457332 AGGGAGAGTGCAGTGGGCTGTGG - Intronic
1060201778 9:121655572-121655594 GGGGACAGAGCAGTGGTTAGTGG + Intronic
1060304380 9:122397773-122397795 AGGGAGAGTGTAGTGGTTGTAGG + Intergenic
1060520120 9:124289581-124289603 AGGCAGTGTGCAGGGGCTGGAGG + Intronic
1060796593 9:126516248-126516270 AGGGAGAGAGCTGTGCGTAGAGG + Intergenic
1061059545 9:128243595-128243617 ATGGAGTGTGCAGTGGCATGGGG + Intronic
1061911772 9:133728828-133728850 AGGGAGAGATGAGTGGCTAGAGG + Intronic
1062097288 9:134709938-134709960 TGGGAGGGTCCAGTGGCTGGGGG + Intronic
1062221637 9:135419251-135419273 AGGGAGAGGGCAGTGGTGGGTGG - Intergenic
1062252044 9:135603188-135603210 AGGGGGAGCACAGTGGTTAGGGG - Intergenic
1203371376 Un_KI270442v1:308829-308851 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1186172446 X:6891667-6891689 AGGCAGAAGGCAGTGGCTTGTGG - Intergenic
1186369034 X:8927717-8927739 AGGGAGACAGCAGTGGCGGGAGG - Intergenic
1186507325 X:10103518-10103540 GGGGAGAGAGCAGTGGCAAGTGG + Intronic
1186602034 X:11048606-11048628 AGGGAGAGCACAGTGTCTGGGGG - Intergenic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188651420 X:32635146-32635168 AGGGAGATTGCAGTGATTATAGG - Intronic
1188897346 X:35685821-35685843 AGGGAGATAGCAGTGACTGGGGG + Intergenic
1189044599 X:37576949-37576971 AGAGAGAGAGCAGGGGATAGAGG + Intronic
1189354258 X:40299197-40299219 AGGGAAAGGGCAGAGGCTAAGGG - Intergenic
1189373743 X:40450073-40450095 AGTGACAGTGCAGTGGCCAGAGG - Intergenic
1190061584 X:47215065-47215087 AGGTAGAAGGCAGTGGCAAGAGG - Exonic
1190263191 X:48811905-48811927 AGGAAGAGGGCAGTGGGTACAGG - Intronic
1190340168 X:49290138-49290160 AAGCAGAGTGCAGTGGGAAGTGG + Intronic
1190374467 X:49775451-49775473 AGGGAGAGTGCAGCAACTGGGGG - Intergenic
1190626534 X:52343260-52343282 AAGCAGAGTGCAGTGGGAAGTGG + Intergenic
1190765967 X:53475872-53475894 AGGGAGTATGGAATGGCTAGTGG + Intergenic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1193896935 X:87126496-87126518 AGGGAGAGTGCAGTGATTATGGG + Intergenic
1194310554 X:92301089-92301111 AGGGAGGCTGCAGTGGGGAGAGG + Intronic
1194388930 X:93292459-93292481 AGGGAGAATGCAGTGACTGGGGG + Intergenic
1194569749 X:95540664-95540686 AGGGAGAGAGGAGTGGAGAGTGG + Intergenic
1194842077 X:98754821-98754843 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1195489469 X:105450215-105450237 AGGGCGAGTGCAGTGACTTGGGG - Intronic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1195670027 X:107461881-107461903 AGGGAGAGTAAGGAGGCTAGGGG - Intergenic
1196357470 X:114810559-114810581 AGGGAGAATGCAGTGACTGTGGG - Intronic
1196485704 X:116204163-116204185 AGGGAGAGTGCAGCAACTGGGGG - Intergenic
1196707804 X:118730678-118730700 AGGGAGACTTCACTGGGTAGGGG + Intronic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197375882 X:125681738-125681760 AGTGAGAGTGCAATGACTGGAGG + Intergenic
1197457903 X:126700979-126701001 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1197623650 X:128779835-128779857 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1198761890 X:140040932-140040954 AAGGAGAGCTCAGTGACTAGGGG - Intergenic
1198770683 X:140126903-140126925 AGGGAGAGTGTAGTGACTAGGGG - Intergenic
1198870873 X:141176487-141176509 AGGGGGAGAGCAGTGGCTCCTGG + Exonic
1199325091 X:146489933-146489955 AGGGAGAGTACAGTGACTGAGGG + Intergenic
1199393177 X:147305732-147305754 AAGGACAGTGCAGTGACTTGGGG + Intergenic
1199431839 X:147770667-147770689 AGAGAGAGTTCAGTGGCTGTGGG + Intergenic
1200204750 X:154307816-154307838 AGGGAGGGAGATGTGGCTAGAGG + Intronic
1200234714 X:154462694-154462716 AAGGAGAGGGCAGGGGCAAGTGG - Intronic
1200618837 Y:5415375-5415397 AGGGAGGCTGCAGTGGGGAGAGG + Intronic
1202389309 Y:24353851-24353873 GGCTAGAGTGCAGTGGCAAGTGG + Intergenic
1202481478 Y:25316274-25316296 GGCTAGAGTGCAGTGGCAAGTGG - Intergenic