ID: 961970801

View in Genome Browser
Species Human (GRCh38)
Location 3:130965078-130965100
Sequence CAGTATCCCTTTAAGAAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 169}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961970801 Original CRISPR CAGTATCCCTTTAAGAAACT TGG Intronic
905113461 1:35616089-35616111 CAGTATCCCTTTTACAAATGTGG + Intronic
905327592 1:37168422-37168444 CAGCTTCCTCTTAAGAAACTTGG + Intergenic
905874061 1:41421204-41421226 CAGTATCCCTTCTACAAAATGGG + Intergenic
906750427 1:48253764-48253786 CAGTTTCCTTTTAAGTGACTTGG - Intergenic
907058603 1:51397358-51397380 CAATATTCCTTTAGAAAACTGGG + Intronic
908084158 1:60612464-60612486 CAATAGCCATTTAAGAAAGTAGG - Intergenic
909903239 1:81164272-81164294 CAGCATTCCTTCATGAAACTGGG + Intergenic
910154867 1:84204771-84204793 CAGTATCCTTGTTAGAAAATTGG - Intronic
914330128 1:146661222-146661244 CTGTATCTCTTTAAGAATCTCGG + Intergenic
917104271 1:171476663-171476685 CATTATTCTCTTAAGAAACTAGG - Intergenic
919081288 1:192869141-192869163 CATTAGGCCTTTAAGAAACCAGG + Intergenic
919555683 1:199049873-199049895 CAACATCCCTTTAAGAGACTAGG + Intergenic
1065259651 10:23911303-23911325 CTTTATCCCTTTGAGATACTAGG + Intronic
1065360290 10:24883322-24883344 CAGGACCCCTTTTGGAAACTGGG - Intronic
1067262523 10:44706720-44706742 CAGTCTTGCTTTAAGAAACCTGG - Intergenic
1068763336 10:60735788-60735810 TACTATCCCTTCAAGATACTTGG - Intergenic
1068763569 10:60738142-60738164 CAGCTTCCCTTTAATAAAATGGG - Intergenic
1070056868 10:72943732-72943754 CATTATCCAGATAAGAAACTCGG + Intronic
1070088893 10:73264267-73264289 CTAAATCCATTTAAGAAACTAGG - Intronic
1070185777 10:74061157-74061179 CAAGATCACTTTAAGAAGCTAGG + Intronic
1077127268 11:946414-946436 CAGTCTCTCTTTCAGAAACAGGG - Intronic
1080996944 11:37615190-37615212 TTGTATCCCTTATAGAAACTAGG + Intergenic
1083469358 11:62872567-62872589 CAGCCTCCTTTTAAGAGACTTGG + Intronic
1083482178 11:62956481-62956503 AAGTATCCCTTTGGGAGACTGGG + Intronic
1086279340 11:85167995-85168017 CAGGATTCCTTGAAAAAACTGGG + Intronic
1088046269 11:105456185-105456207 CAATATTCCTTTAAAAAAATTGG - Intergenic
1089884280 11:121804352-121804374 CTGTTCCCCTTTAAGAAAATAGG - Intergenic
1104596208 12:130121578-130121600 CTATATCCCTTTAAGAATTTGGG - Intergenic
1107002045 13:35559322-35559344 CAGTATCACTTTAACGAACACGG + Intronic
1107706174 13:43108466-43108488 CAGTATTCCTTTACAAATCTTGG + Exonic
1109848485 13:68029647-68029669 CAGTATCCCCTCAATAATCTTGG - Intergenic
1110138850 13:72102351-72102373 CAGTATTCCTTTGATAACCTAGG + Intergenic
1111379267 13:87425173-87425195 CCATTTCCCTTTAAGAAAATGGG + Intergenic
1111478980 13:88796439-88796461 CATTATCCCTTCATTAAACTAGG + Intergenic
1113539660 13:111096323-111096345 CAGAAGACCTTTAAGAAACAGGG - Intergenic
1114643499 14:24240599-24240621 CTGTTTCCCTTTAGGAATCTCGG - Exonic
1114921258 14:27332850-27332872 CAATAACCATTTAAGAAAATAGG - Intergenic
1114994843 14:28335933-28335955 TAGTATCTTTTTCAGAAACTTGG + Intergenic
1116308231 14:43286145-43286167 AAAAATCCCTTTAAAAAACTAGG + Intergenic
1116440800 14:44950592-44950614 CAGTATAGTTTTAAGAGACTGGG + Intronic
1116666138 14:47778083-47778105 CTGTATCCCTTTAAAAACATTGG + Intergenic
1117147200 14:52847191-52847213 CATTATCCTTTTAACAAATTGGG - Intergenic
1119271290 14:73307525-73307547 CAGTATTCCTTAAACAAACCAGG - Intronic
1119907405 14:78318326-78318348 CAGTTTCCACTTAAGAAAGTTGG - Intronic
1120410289 14:84145530-84145552 CAGTATCCTTTCAAAATACTTGG + Intergenic
1121428137 14:93867927-93867949 CAGTTTCCCTTATAGAAATTAGG + Intergenic
1121957758 14:98229481-98229503 CTCAATCTCTTTAAGAAACTTGG - Intergenic
1124286952 15:28409938-28409960 CAGTTTCCCTTCAACAAAATCGG + Intergenic
1124295749 15:28501689-28501711 CAGTTTCCCTTCAACAAAATCGG - Intergenic
1125095424 15:35844763-35844785 CAGTTTCCCTTTAAGGAACTGGG + Intergenic
1127324171 15:57878802-57878824 CAGTGTCCCTTCATCAAACTGGG + Intergenic
1140003426 16:71049685-71049707 CTGTATCTCTTTAAGAATCTCGG - Intronic
1140897604 16:79338824-79338846 CACTAACCCTTTGAGAAATTAGG - Intergenic
1143354702 17:6317670-6317692 CAGTATCCCTGTCTGACACTGGG + Intergenic
1144317716 17:14079006-14079028 CAGTCTCCCTTTTCAAAACTTGG + Intronic
1149412365 17:56421519-56421541 CACTCTCCCTTTAAGAAACTTGG + Intronic
1150248744 17:63694526-63694548 CAGTCTCCAGTTTAGAAACTGGG - Exonic
1150725802 17:67650400-67650422 CAGGATGCCTTTTAGGAACTGGG - Intronic
1150970117 17:70018305-70018327 CAGTGTTCCTCTAAGCAACTGGG + Intergenic
1150985070 17:70186628-70186650 CAGTAGGCATTTAAGAAACATGG - Intergenic
1153798306 18:8645712-8645734 AATTTTCACTTTAAGAAACTAGG + Intergenic
1154037822 18:10822780-10822802 CATACTCCCTTTTAGAAACTTGG - Intronic
1156057228 18:33021631-33021653 TGGTATCCTTTCAAGAAACTTGG - Intronic
1159089016 18:63825287-63825309 CAGTATCCCTTTGAGACTCCAGG - Intergenic
1159116942 18:64125367-64125389 CAGTATCTATTTTAGAGACTTGG - Intergenic
1163397613 19:17073240-17073262 CAGGATCTCTTTAAGGAACATGG - Intronic
1164407473 19:27964826-27964848 CAGAAGCCTTTTAAGAAAATAGG + Intergenic
1165868803 19:38955847-38955869 CAGTTTCCCTTTCTGAAAATGGG + Intronic
1166431185 19:42729432-42729454 CTGTGTCCCTTTAAGAGACCAGG - Intronic
1166434309 19:42754642-42754664 CTGTGTCCCTTTAAGAGACCAGG - Intronic
1166444192 19:42844668-42844690 CTGTGTCCCTTTAAGAGACCAGG - Intronic
1166447156 19:42868410-42868432 CTGTGTCCCTTTAAGAGACCAGG - Intronic
1166451632 19:42907231-42907253 CTGTGTCCCTTTAAGAGACCAGG - Intronic
1166463869 19:43015425-43015447 CTGTGTCCCTTTAAGAGACAAGG - Intronic
1166470023 19:43072009-43072031 CTGTGTCCCTTTAAGAGACCAGG - Intronic
1166481161 19:43175524-43175546 CTGTGTCCCTTTAAGAGACCAGG - Intronic
1166483632 19:43194649-43194671 CTGTGTCCCTTTAAGAGACCAGG - Intronic
1166490743 19:43258511-43258533 CTGTGTCCCTTTAAGAGACCAGG - Intronic
925028028 2:624982-625004 CATTATTACTTTGAGAAACTTGG - Intergenic
926689236 2:15721614-15721636 CAGCATCCCTTTCAGACACTCGG + Intronic
929540213 2:42813490-42813512 CAACATCACTTTAAGACACTGGG - Intergenic
931130743 2:59332583-59332605 CACTATCCCTTTAAGCCAATGGG + Intergenic
933357387 2:81229444-81229466 CAGTATCACTGGAAGAAACAAGG + Intergenic
935290182 2:101603585-101603607 CAGTATGCCTTTAAGCAGTTAGG - Intergenic
936961997 2:118085807-118085829 CAGTAAGCCTCTAAGAACCTTGG - Intergenic
939688500 2:145228423-145228445 TAGTAAGGCTTTAAGAAACTGGG - Intergenic
941151268 2:161918689-161918711 CCTTGTTCCTTTAAGAAACTTGG + Intronic
942996251 2:182263910-182263932 CAGAGTCCCTTTAGGAAAATGGG - Intronic
943505365 2:188749655-188749677 CAGTTTTCCTTTAAGAAATCAGG + Intronic
943968871 2:194376467-194376489 CACAATCCATTTAAGAAACCAGG - Intergenic
944045622 2:195408079-195408101 CAGAATCTCTTCAAGAAAATGGG + Intergenic
1173707007 20:45117454-45117476 CAGTATCCTATTATGAAACATGG + Intergenic
1173760226 20:45553360-45553382 TAGTATCCCTTTCTGCAACTTGG + Intronic
1174579969 20:51564366-51564388 CAGTTTCCCTTTTGGAAAGTGGG - Intergenic
1180619920 22:17154180-17154202 CAGTGTTTCTTTAAGAAACTTGG + Intronic
1182248916 22:28983970-28983992 CAGCAGCCCTTCAGGAAACTGGG - Intronic
1182767354 22:32767274-32767296 TAATATTCCTTTAAGAAACGTGG - Intronic
949178304 3:1093849-1093871 CAGTATCCCATTAACATAATGGG - Intronic
951678039 3:25264284-25264306 CAGTATGCCTTCAAGAACCCTGG + Intronic
954736667 3:52713186-52713208 CAGTATCTGTTTAACATACTAGG - Intronic
955163532 3:56488488-56488510 CAGTTGCCTTTTAAGCAACTAGG - Intergenic
956111803 3:65877521-65877543 CAGCATGCCTCTAAGACACTTGG + Intronic
956221489 3:66908814-66908836 CATCATCCCTCAAAGAAACTTGG + Intergenic
959079895 3:101789173-101789195 AGCTATCACTTTAAGAAACTAGG - Intronic
960122260 3:113958715-113958737 TATAATGCCTTTAAGAAACTGGG - Intronic
961970801 3:130965078-130965100 CAGTATCCCTTTAAGAAACTTGG + Intronic
962234520 3:133695701-133695723 CAGTATCACTTTAACACAGTTGG + Intergenic
962864319 3:139434734-139434756 CATTATTCCTTGAAGAAGCTGGG - Intergenic
963432732 3:145230262-145230284 CAGTATCCCCTTCTGAAGCTGGG + Intergenic
965042601 3:163529860-163529882 AAGTATCCAATTAAAAAACTGGG + Intergenic
965605458 3:170493925-170493947 CATTATCCCTAAAGGAAACTTGG - Intronic
967538627 3:190638112-190638134 CGGTAGTCCATTAAGAAACTTGG - Intronic
968399178 4:274972-274994 CATTATTCCTTACAGAAACTGGG - Intronic
968429625 4:549068-549090 CAGTTACCCTTCAGGAAACTGGG - Intergenic
970920394 4:21387463-21387485 CAGTCTCTCTTCATGAAACTTGG + Intronic
971520912 4:27549225-27549247 CAGTATCCCTTTCAGGTAATAGG - Intergenic
974507799 4:62799451-62799473 CAGTAACACATTCAGAAACTGGG - Intergenic
974620885 4:64352273-64352295 CAATTTCTCTTGAAGAAACTAGG + Intronic
974894131 4:67918061-67918083 CAGTCTACCATTAAGGAACTAGG - Intronic
979206210 4:118041098-118041120 CAGTTTCCTTCTAAGAAAATGGG - Intronic
979837799 4:125394901-125394923 CAGCATCCCTTGTAGAAAATAGG - Intronic
980067590 4:128206771-128206793 CATTATCCCTTTGACAAACGTGG + Intronic
981438773 4:144758250-144758272 CAGCATCCCTTCAACAAATTAGG + Intergenic
981961981 4:150552173-150552195 CAGTTTCCCTGTCAGGAACTGGG - Intronic
981962141 4:150553519-150553541 CAGTTTCCCTGTTAGGAACTGGG - Intronic
985111533 4:186551672-186551694 TAGTATCCCTGTAAGAAAAGTGG + Intronic
986252693 5:6075211-6075233 CACTATTCCTTTTAGAAAGTTGG + Intergenic
987250051 5:16090538-16090560 CAGTTTCCCTTTACAAAGCTGGG - Intronic
987850610 5:23348989-23349011 CCTTATGCCTTTAAGAAACAAGG - Intergenic
988384942 5:30550879-30550901 CAGAATCTCTTTAAGAAAAAAGG - Intergenic
994202437 5:96993114-96993136 CAGTACCCACTTAAGAAATTGGG + Exonic
995476192 5:112550967-112550989 CAGTATCACTCTGGGAAACTAGG - Intergenic
997399181 5:133589318-133589340 CAGTCTCCCTTTCAGAAGCAAGG - Intronic
999081223 5:148845443-148845465 CAGTATGCATTTAATAAAATTGG + Intergenic
1001570940 5:172730069-172730091 CAGTTTCCCTATACGAAAATTGG - Intergenic
1004595646 6:17096955-17096977 AGGTATCCCTTTAAGAGAGTTGG - Intergenic
1007143896 6:39607881-39607903 CAGTATCCCTTTAATGATTTTGG + Intronic
1007261899 6:40569767-40569789 CAATTTGCCTTTAAGGAACTTGG - Intronic
1008734519 6:54526765-54526787 GAATATCCGTTTAAGAAAATAGG - Intergenic
1009038042 6:58141810-58141832 CTGTATGACTTTATGAAACTTGG + Intergenic
1010252567 6:73723282-73723304 AAGTATCCATTTAAAAAATTTGG + Intronic
1011893780 6:92198959-92198981 CATTAACCCTTTGAGATACTAGG + Intergenic
1012898917 6:104984194-104984216 CAGTATGCGTTTAAAAAAATAGG + Intronic
1015250339 6:131120741-131120763 CATTATCCTTTTGAGAAACTAGG + Intergenic
1016027164 6:139299325-139299347 CATGTTCCCTGTAAGAAACTTGG + Intergenic
1017379016 6:153805755-153805777 CAGTATTGCTTCAAGAAAATAGG - Intergenic
1019003617 6:168777790-168777812 CAGTATATCTTCAATAAACTTGG - Intergenic
1021256097 7:18394201-18394223 GAGTGTCCCTTTAACAAACAAGG - Intronic
1027598917 7:80213736-80213758 CAGTATGCCTTAAAAAAACAGGG + Intronic
1028210313 7:88066394-88066416 AAGTAGCCATTTAAGAAGCTTGG + Intronic
1032590771 7:133190277-133190299 CAGTATTCCTTCAAGTAGCTAGG - Intergenic
1032832323 7:135640759-135640781 CAGGATGTCTTAAAGAAACTGGG + Intronic
1035114836 7:156515926-156515948 CAGTTTCCCTCTAAGAAATGGGG + Intergenic
1037250271 8:16885328-16885350 CAGAATGCCTTAAAGAATCTAGG + Intergenic
1037510669 8:19578674-19578696 CAGTGCCTTTTTAAGAAACTTGG - Intronic
1038693203 8:29781846-29781868 CACTGTCCCTTTGAGAAACCAGG + Intergenic
1043974809 8:86572632-86572654 CTCTCTCCCTTTAAAAAACTGGG + Intronic
1046270600 8:111891393-111891415 GAGTATCCCTTTAAGGAAGGAGG - Intergenic
1047025896 8:120824318-120824340 AAGTCTCCATTTATGAAACTGGG - Intergenic
1049909668 9:253171-253193 CAGTGTCCCTGTATGAAATTAGG + Intronic
1050105218 9:2158329-2158351 CAGTGTGCCTTTAAGAAAAGAGG + Intronic
1050743787 9:8853965-8853987 TATTATCACTTTAAGAAAATAGG + Intronic
1051857016 9:21580040-21580062 CAGTTTTGCTTCAAGAAACTGGG - Intergenic
1055771943 9:79726826-79726848 CAATCTCCCTTGAAAAAACTAGG - Intronic
1057860224 9:98635070-98635092 CATTATTCCTTAAAGGAACTGGG - Intronic
1058901748 9:109448116-109448138 CAGTATCCCATGAAGCAATTAGG - Intronic
1058980019 9:110160411-110160433 AAGAAGCCCTTTAGGAAACTAGG - Intronic
1058990469 9:110250942-110250964 AAGTTTCCATTTAAGAAGCTTGG - Intronic
1059844879 9:118264049-118264071 CAGTGTTGCTTTAAGTAACTAGG + Intergenic
1059957211 9:119530150-119530172 CAGTAGCCCCTTAAGAAATGAGG - Intergenic
1060723242 9:125991967-125991989 CATTATCCTTTTAACAAACCTGG - Intergenic
1191025555 X:55909154-55909176 CACTGTCCCTTTAAGAAGCCAGG - Intergenic
1191057358 X:56255590-56255612 CAACATCCCTTCAAAAAACTGGG - Intronic
1192597736 X:72429160-72429182 GAGTATCCCTGTAAGGAAATAGG - Intronic
1197326427 X:125099853-125099875 AATTATCCTTTTAATAAACTTGG + Intergenic
1197951511 X:131902500-131902522 CAGCATCCTTTTAAGAAAAGGGG + Intergenic
1198766834 X:140088771-140088793 CAGTATACCATTACGAAAATGGG - Intergenic
1199721425 X:150545361-150545383 CAATATCCCTTTCAGAATCAAGG + Intergenic