ID: 961972583

View in Genome Browser
Species Human (GRCh38)
Location 3:130986101-130986123
Sequence TCACTGCCACCCAGAGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2052
Summary {0: 1, 1: 1, 2: 1, 3: 82, 4: 1967}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961972579_961972583 10 Left 961972579 3:130986068-130986090 CCAGTATGTTGGGATCATAGATG 0: 1
1: 0
2: 2
3: 46
4: 651
Right 961972583 3:130986101-130986123 TCACTGCCACCCAGAGAGCTGGG 0: 1
1: 1
2: 1
3: 82
4: 1967
961972578_961972583 11 Left 961972578 3:130986067-130986089 CCCAGTATGTTGGGATCATAGAT 0: 1
1: 0
2: 1
3: 38
4: 734
Right 961972583 3:130986101-130986123 TCACTGCCACCCAGAGAGCTGGG 0: 1
1: 1
2: 1
3: 82
4: 1967

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961972583 Original CRISPR TCACTGCCACCCAGAGAGCT GGG Intronic
Too many off-targets to display for this crispr