ID: 961974938

View in Genome Browser
Species Human (GRCh38)
Location 3:131013805-131013827
Sequence GTTCCATTTCAGCAAGTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 133}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961974938_961974939 -4 Left 961974938 3:131013805-131013827 CCATTAACTTGCTGAAATGGAAC 0: 1
1: 0
2: 2
3: 11
4: 133
Right 961974939 3:131013824-131013846 GAACATGAGAAGTATAAACATGG 0: 1
1: 0
2: 0
3: 25
4: 312

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961974938 Original CRISPR GTTCCATTTCAGCAAGTTAA TGG (reversed) Intronic
902060605 1:13638976-13638998 GTTCAAGTTAAGCAAGTTTATGG + Intergenic
902126888 1:14221907-14221929 CTTCCCTTTCATCAAGTAAATGG - Intergenic
903782502 1:25830394-25830416 GTTCTACTTTAGTAAGTTAAAGG - Intronic
904631391 1:31845356-31845378 GTTCCATTTCTGCATGTCTATGG - Intergenic
905763015 1:40576300-40576322 TTTCCATTTAAGAAAGTGAAAGG + Intergenic
911181747 1:94866999-94867021 GTACCATTTCAGACACTTAAGGG + Intronic
911742080 1:101397395-101397417 GCTCTATTTCAGCAAGTCACAGG + Intergenic
918036864 1:180882171-180882193 GTTCCATTTCAGGTGTTTAACGG + Intronic
918668943 1:187188740-187188762 CTTCCCTCTCAGGAAGTTAAAGG + Intergenic
919301731 1:195778441-195778463 GTTACATTTCAACAAATTATTGG - Intergenic
921442080 1:215199391-215199413 GTTTTATTTCAGCATGTTGATGG - Intronic
923656221 1:235919386-235919408 GTTCCATTTCAGTGACTCAATGG + Intergenic
924540582 1:244977170-244977192 GTTCCAGTTCTGCAAGATGAAGG + Intronic
924669253 1:246106566-246106588 TTCTCATTTCAGAAAGTTAATGG - Intronic
1062929595 10:1344154-1344176 GTCCCATTTCTGTAAGATAACGG + Intronic
1064524066 10:16234795-16234817 GTCCCATTACAGCAAGTCAAGGG + Intergenic
1065425595 10:25599508-25599530 TTTCCATTTCAGCATGTTTAAGG + Exonic
1068574295 10:58666801-58666823 GTGCCATATCAGCAATTGAATGG - Intronic
1069055229 10:63838021-63838043 GTTCCATTGCAGCATTTTCAGGG - Intergenic
1076577319 10:131478165-131478187 GAGGCATTTCAGCCAGTTAAGGG - Intergenic
1079571337 11:21947114-21947136 GTTCTCATTCAGCAAGTCAATGG + Intergenic
1086075032 11:82841495-82841517 ATTACATTTGAGCATGTTAAAGG - Intronic
1088198924 11:107308476-107308498 ATTCCTTTTCAGCAAATAAATGG + Intergenic
1089379408 11:118016700-118016722 GTTGAAGTTCAGCAAGGTAAAGG - Intergenic
1093445818 12:19257011-19257033 GTTCAATTAAAGAAAGTTAATGG - Intronic
1100675376 12:96860652-96860674 GTGCCATTTCAGCAGTTTAGAGG + Intronic
1101824762 12:108211377-108211399 ATTCCAATTCAGCAGGTTCAGGG + Intronic
1103183071 12:118931660-118931682 GTGCCAATTAAGCAAGTTATCGG - Intergenic
1106713542 13:32364436-32364458 TTTCCATAGCAGGAAGTTAACGG - Intronic
1110647966 13:77910836-77910858 GTTCTATTTCAGCAAGTTAGAGG - Intronic
1111768371 13:92564216-92564238 TTTCCATTTCTGCAGGTAAATGG + Intronic
1112473737 13:99712154-99712176 CTTCCATAGCAGAAAGTTAATGG - Intronic
1113154031 13:107297440-107297462 CTTCCATTTCTACAAGTTAAAGG + Intronic
1113915072 13:113865401-113865423 CTTCCATGTCAGCTAGTTACTGG + Intergenic
1114837027 14:26214954-26214976 GTTTCATATCAGCATTTTAAGGG + Intergenic
1115114227 14:29860284-29860306 GTTCTATTGCAGCAAGCAAATGG + Intronic
1116644621 14:47510619-47510641 CTTCCATTTCAGGAAGAAAAGGG - Intronic
1117202062 14:53400963-53400985 GGTCCTATTCAGCATGTTAAGGG + Intergenic
1118206237 14:63726713-63726735 GTTCCCTTTATGGAAGTTAATGG - Intronic
1118916710 14:70113840-70113862 GTTCAATTATAGCAAGTTCAAGG + Intronic
1119622368 14:76140838-76140860 GCTCCAATTCAGCAAGTTCTGGG - Intergenic
1124158692 15:27250314-27250336 CTTACATTTAATCAAGTTAAAGG + Intronic
1125299655 15:38241122-38241144 GTTGCCTTTCAGAAATTTAACGG - Intergenic
1126692648 15:51299667-51299689 GTTCCTTTACAGGAATTTAATGG + Intronic
1130980704 15:88810186-88810208 GTCCCATTCCAGCCAGTAAAGGG + Intronic
1134629955 16:15749425-15749447 CTTCCATGTCACCAAGTTGATGG + Intronic
1135243862 16:20837185-20837207 GTTGCATTTGAGAAACTTAATGG + Intronic
1136995301 16:35184826-35184848 GTTCCATTTCAGCCAGAGATTGG + Intergenic
1138626514 16:58256236-58256258 GTTGAATTCTAGCAAGTTAAAGG + Intronic
1140688355 16:77455414-77455436 GTTACATTTCAGCCATTAAATGG - Intergenic
1147473569 17:40687383-40687405 TTTCCAATTCAGGAAATTAAAGG - Intergenic
1149775814 17:59356102-59356124 CTTCCATTTAAGAAAGTTCAAGG + Intronic
1152442912 17:80320063-80320085 GTTCCAGTTCAGCAGGTTTTGGG + Intronic
1153118774 18:1694204-1694226 GTTACAGATAAGCAAGTTAAGGG - Intergenic
1153555314 18:6306754-6306776 TTTCCATTTCAGTAAGTATAAGG - Intronic
1155191093 18:23431245-23431267 GCTCCATTTCACCAACTAAAAGG - Intronic
1155769142 18:29674456-29674478 GATCCTTTTCAGCAAGCAAATGG + Intergenic
1158156603 18:54432748-54432770 TTACCATTTCTGCAAGTTAAAGG - Intergenic
1158504507 18:58034562-58034584 GTTCAATTTTTGCAAGATAAGGG - Intergenic
1167530987 19:50016376-50016398 GTTCCCTTGCAGCAAGGTAGAGG + Intronic
929972416 2:46594170-46594192 GTACTATTTTAGCAATTTAAAGG + Intronic
930661788 2:54062051-54062073 ATTCCATTTCAGGAAAGTAAAGG + Intronic
933975753 2:87508002-87508024 CCTCCATTTCAGCAAATCAAAGG - Intergenic
935444781 2:103144617-103144639 GTTCCATGTCCGCAAATTCAGGG + Intergenic
936318073 2:111442811-111442833 CCTCCATTTCAGCAAATCAAAGG + Intergenic
936382116 2:111995535-111995557 GTTCCATTTCAGCACCAAAAGGG - Intronic
942598461 2:177616171-177616193 GTTGCAATCCAGAAAGTTAAAGG + Exonic
943048515 2:182887726-182887748 GTTTCATTTCACCAAGTTGTAGG + Intergenic
945021016 2:205571721-205571743 GTTTCATTTCAAGAAATTAATGG - Intronic
946142722 2:217705369-217705391 GTTCAAGTTCTGCAAGATAAAGG + Intronic
1168745709 20:238095-238117 TTTTCATTTCAGCAACTTAGAGG + Intergenic
1170403667 20:16013641-16013663 CTTCCATTTTAGTAAGTAAATGG + Intronic
1175267931 20:57713792-57713814 GTCCTGTTTCAGCAGGTTAAGGG + Intergenic
1178980874 21:37263869-37263891 GCTCCATTGCAGCCAGCTAAGGG + Intronic
1179231639 21:39509161-39509183 TTTCCTTCTCAGCATGTTAAAGG - Intronic
1184010766 22:41746398-41746420 GTTCAATCTCAGCACGTTATGGG - Intronic
951155494 3:19348365-19348387 GTGCCCTTTCAGCATGTTGATGG + Intronic
951579920 3:24151735-24151757 GTTCAGTTTCAGGAAGTGAATGG + Intronic
951645427 3:24885270-24885292 ATCCCATTTCAGCCACTTAAAGG - Intergenic
956981075 3:74638677-74638699 GTTTCATTGCAGCATGATAAAGG - Intergenic
957375941 3:79357380-79357402 GTTTCATGTCAGAGAGTTAATGG + Intronic
957459415 3:80497524-80497546 GTGCCATGTAAGCATGTTAAAGG - Intergenic
959282182 3:104358261-104358283 GTTGCATTTGAACACGTTAATGG + Intergenic
959699319 3:109283416-109283438 GTTCCATGTCAGCTAGGCAATGG - Intergenic
960696208 3:120399288-120399310 GTTCTATGTCATTAAGTTAAAGG - Intronic
961974938 3:131013805-131013827 GTTCCATTTCAGCAAGTTAATGG - Intronic
963737099 3:149030811-149030833 GTTCCCTTTGAGCAAGAAAACGG + Exonic
963871732 3:150423076-150423098 GTTCCATTTGAACACGTTAAAGG + Exonic
965550555 3:169960920-169960942 CTTCCATCTCAGCAAGTGGAAGG - Intergenic
966632828 3:182097428-182097450 GTTCCAGTGCAGCCAGTTCAGGG + Intergenic
967795045 3:193590858-193590880 GTTCAATTTCAGAAAGATGAAGG + Intronic
967853184 3:194097430-194097452 GTTCCATTTCATCAAGGAGAAGG - Intergenic
968187623 3:196643975-196643997 CTTCAACTTCAGCAAGTTAGCGG + Intronic
969882337 4:10185266-10185288 GTCCCAGTAAAGCAAGTTAACGG + Intergenic
973706274 4:53583898-53583920 GTTCTATTTCATCATGTTTATGG - Intronic
973927839 4:55757747-55757769 GATCCATTTATGCAAATTAAGGG - Intergenic
980744805 4:137000220-137000242 TTTTCATTTCAGTAAGTAAATGG + Intergenic
981789855 4:148523733-148523755 TTTCCTTTTCAGCAAGTGAAAGG - Intergenic
983343840 4:166501962-166501984 GTTCTATTTCTGCAAAGTAAGGG - Intergenic
988328061 5:29797111-29797133 GTATCATTTCAGAAAATTAATGG + Intergenic
990070239 5:51773588-51773610 GATCCACTTCAGCAAGCCAATGG - Intergenic
993374902 5:87139456-87139478 GTTCAATGTCAGCAAGTAAAGGG + Intergenic
995800339 5:115987185-115987207 CTTCCACTTTAGCAAGTAAAAGG - Intronic
995902660 5:117088511-117088533 TTTCCATGTCAACAATTTAAAGG - Intergenic
997707084 5:135965917-135965939 GTTCAAGTTCATCAAGTTACTGG + Intergenic
1003347660 6:5285649-5285671 GTTCCATATCAGCAGCTTTAGGG + Intronic
1004400862 6:15287571-15287593 GTTACATTTCAGCAAGAGATTGG + Intronic
1007144775 6:39617412-39617434 GTTCCTTTTCAGCAAGTTGATGG - Intronic
1009478698 6:64128330-64128352 GCTCCATTTTAGAAAGTTCATGG - Intronic
1009564037 6:65287512-65287534 GTTGCATTTCAGGAAGGAAAAGG - Intronic
1010772504 6:79847677-79847699 ATGCCATTTCAGTAAGTTATCGG + Intergenic
1012693366 6:102346520-102346542 GTTCCATTTCTGCAAGTTTTGGG - Intergenic
1013074977 6:106763351-106763373 GAGCCATTCCAGCAAATTAATGG + Intergenic
1013233563 6:108176990-108177012 ATTTCATTTCAGCAAGTTTGGGG + Intronic
1014248672 6:119094260-119094282 CTTCCATGACAGCAAGTAAAGGG - Intronic
1016258194 6:142135431-142135453 GTTCAATTTCTTCAAGTTAATGG - Intergenic
1018001019 6:159578673-159578695 GGTGCATTTCAGCAAATCAAAGG + Intergenic
1018140027 6:160822282-160822304 GTTGCATTTCAGGAAGAAAAAGG - Intergenic
1018607813 6:165617105-165617127 TTTCCATTTAAGGATGTTAAAGG - Intronic
1022287682 7:28970028-28970050 GCTCCATTTTAGAAAATTAAAGG - Intergenic
1024837206 7:53535719-53535741 GTGCCATTTCCTCAAGTTACTGG + Intergenic
1024964252 7:55007581-55007603 GTTCTATTTCTGCAATTGAATGG - Intergenic
1025029052 7:55541041-55541063 GTTCCTTATCAGCTAGATAATGG - Intronic
1025096344 7:56098395-56098417 GTTGCATTTCAGTAAGTTGGAGG - Intergenic
1030215376 7:107039764-107039786 GTTACATATAAGCAAGTTGATGG + Intergenic
1030503790 7:110393916-110393938 TTACCATATCAACAAGTTAAAGG + Intergenic
1030805074 7:113907288-113907310 TTTACATTTCAGCATATTAAGGG + Intronic
1031034198 7:116769751-116769773 GTTCAATTTCAGCAGGTCATTGG - Exonic
1031473912 7:122199923-122199945 GTTTCACTTCTGCAAGATAAGGG + Intergenic
1032454214 7:132059654-132059676 TTTCCTTTTCAGCGATTTAATGG + Intergenic
1032691089 7:134287485-134287507 GTTCCATTCCAGCAATTAAATGG - Intergenic
1033035573 7:137873138-137873160 TTTCCAGGCCAGCAAGTTAATGG + Intergenic
1034758146 7:153642347-153642369 TTTCAATTTCAGCAGGTTCATGG - Intergenic
1041798922 8:61776842-61776864 TTTCCATCTCAGCAAGATAGAGG - Intergenic
1047302093 8:123622276-123622298 GCTCCATTTTTGCAATTTAATGG - Intergenic
1047909741 8:129515157-129515179 GTTCCTTTTCAGAACTTTAATGG - Intergenic
1050738154 9:8788054-8788076 GTTCCATTACATCAAAATAAGGG + Intronic
1050831752 9:10022542-10022564 ATTACATTTCAGCAAGTAACTGG + Intronic
1050867252 9:10518451-10518473 GTTTCATTCCATCAAGTTTAAGG + Intronic
1056347686 9:85715797-85715819 GTTGCATTTCACCAAGTTTGTGG + Intronic
1058788482 9:108416525-108416547 GGTGCAGTTGAGCAAGTTAAAGG + Intergenic
1187819831 X:23275596-23275618 GTTCTAATTCAGCAAGTCCAGGG + Intergenic
1194661320 X:96630813-96630835 GTTCCTTTTCTGTAAGTGAATGG + Intergenic
1195159784 X:102160042-102160064 GTTGCATTTCTGTAAGTTACAGG + Intergenic
1196281650 X:113829601-113829623 GTTATATTTCAGTAAGTTAGGGG - Intergenic
1196539280 X:116885748-116885770 GATCCATTTCAGCAACTCAATGG + Intergenic
1196549492 X:117005676-117005698 AGTCCCTTTCAGCAAGTTGATGG + Intergenic