ID: 961974938 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:131013805-131013827 |
Sequence | GTTCCATTTCAGCAAGTTAA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 147 | |||
Summary | {0: 1, 1: 0, 2: 2, 3: 11, 4: 133} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
961974938_961974939 | -4 | Left | 961974938 | 3:131013805-131013827 | CCATTAACTTGCTGAAATGGAAC | 0: 1 1: 0 2: 2 3: 11 4: 133 |
||
Right | 961974939 | 3:131013824-131013846 | GAACATGAGAAGTATAAACATGG | 0: 1 1: 0 2: 0 3: 25 4: 312 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
961974938 | Original CRISPR | GTTCCATTTCAGCAAGTTAA TGG (reversed) | Intronic | ||