ID: 961974938

View in Genome Browser
Species Human (GRCh38)
Location 3:131013805-131013827
Sequence GTTCCATTTCAGCAAGTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 133}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961974938_961974939 -4 Left 961974938 3:131013805-131013827 CCATTAACTTGCTGAAATGGAAC 0: 1
1: 0
2: 2
3: 11
4: 133
Right 961974939 3:131013824-131013846 GAACATGAGAAGTATAAACATGG 0: 1
1: 0
2: 0
3: 25
4: 312

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961974938 Original CRISPR GTTCCATTTCAGCAAGTTAA TGG (reversed) Intronic