ID: 961974938 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:131013805-131013827 |
| Sequence | GTTCCATTTCAGCAAGTTAA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 147 | |||
| Summary | {0: 1, 1: 0, 2: 2, 3: 11, 4: 133} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 961974938_961974939 | -4 | Left | 961974938 | 3:131013805-131013827 | CCATTAACTTGCTGAAATGGAAC | 0: 1 1: 0 2: 2 3: 11 4: 133 |
||
| Right | 961974939 | 3:131013824-131013846 | GAACATGAGAAGTATAAACATGG | 0: 1 1: 0 2: 0 3: 25 4: 312 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 961974938 | Original CRISPR | GTTCCATTTCAGCAAGTTAA TGG (reversed) | Intronic | ||