ID: 961975619

View in Genome Browser
Species Human (GRCh38)
Location 3:131022168-131022190
Sequence TAAGTAGGATGTCCCTTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 87}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961975614_961975619 12 Left 961975614 3:131022133-131022155 CCATATCTTGGGGCTTCCCTGAG 0: 1
1: 0
2: 2
3: 21
4: 205
Right 961975619 3:131022168-131022190 TAAGTAGGATGTCCCTTGCAGGG 0: 1
1: 0
2: 2
3: 7
4: 87
961975616_961975619 -5 Left 961975616 3:131022150-131022172 CCTGAGTGCAGTGTCTTGTAAGT 0: 1
1: 0
2: 1
3: 11
4: 135
Right 961975619 3:131022168-131022190 TAAGTAGGATGTCCCTTGCAGGG 0: 1
1: 0
2: 2
3: 7
4: 87
961975615_961975619 -4 Left 961975615 3:131022149-131022171 CCCTGAGTGCAGTGTCTTGTAAG 0: 1
1: 0
2: 0
3: 7
4: 129
Right 961975619 3:131022168-131022190 TAAGTAGGATGTCCCTTGCAGGG 0: 1
1: 0
2: 2
3: 7
4: 87
961975610_961975619 25 Left 961975610 3:131022120-131022142 CCTGATGGGGACACCATATCTTG 0: 1
1: 0
2: 1
3: 8
4: 75
Right 961975619 3:131022168-131022190 TAAGTAGGATGTCCCTTGCAGGG 0: 1
1: 0
2: 2
3: 7
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961975619 Original CRISPR TAAGTAGGATGTCCCTTGCA GGG Intronic
900729062 1:4240088-4240110 TAAGTAAGTTCTCTCTTGCATGG + Intergenic
901688502 1:10957945-10957967 AGGGTAGGAGGTCCCTTGCAGGG + Intronic
902554572 1:17239412-17239434 TAAGTAGGATGCCCAGAGCATGG + Intronic
905111465 1:35597708-35597730 GAGGTAGGATGTCTCTTGCCAGG - Intergenic
907091125 1:51727069-51727091 TAAGTATTTTGTCCCTTGTAGGG + Intronic
909154760 1:72059460-72059482 TAAATAGGATTTCACTTGAAAGG - Intronic
916874759 1:168957583-168957605 TAATTAGGATATCTCTTTCATGG + Intergenic
922127377 1:222741352-222741374 AAAGTAAGATGTCCCAGGCATGG - Intronic
923551617 1:234968746-234968768 ATAGTAGGATGTCCCTCACAGGG - Intergenic
924656555 1:245977821-245977843 AAAGTAGTATGTTCCCTGCATGG - Intronic
1067471216 10:46539930-46539952 TAAGTGGGATCTCACTTGTATGG + Intergenic
1078680499 11:13471297-13471319 AAAGAAGAATGTCCTTTGCAGGG + Intergenic
1081539111 11:44017272-44017294 GGAGCAGGATGTCCCATGCAAGG + Intergenic
1082057884 11:47834895-47834917 TGAGGAGGAGGTCCATTGCATGG + Intronic
1084757100 11:71246541-71246563 GAACTAAGATCTCCCTTGCAGGG + Intronic
1087232620 11:95683263-95683285 AAAGTAGGATGAGCCTGGCATGG - Intergenic
1091089401 11:132756040-132756062 CAAGTAGGCTGCCCCTAGCAGGG - Intronic
1106790783 13:33153277-33153299 TTGGTAGAAAGTCCCTTGCATGG + Intronic
1113412976 13:110106707-110106729 TACGTGGGCTGTCCTTTGCACGG + Intergenic
1115434050 14:33353712-33353734 TAAATAGGAAATCCTTTGCAAGG - Intronic
1115516406 14:34189582-34189604 CAAGTAGGATTTCCCTTGAAGGG - Intronic
1116125134 14:40774389-40774411 TAAGTATGGTGTCCCTTGAAAGG - Intergenic
1117653137 14:57927090-57927112 TCAGTGGGGTGTCACTTGCAGGG - Intronic
1128704805 15:69831181-69831203 TAAGGAGGAGGTCCCCTTCATGG + Intergenic
1144305270 17:13964514-13964536 CAAGTAGGATGACCCTTGCAAGG + Intergenic
1148940659 17:51208084-51208106 AAAGTAGGAGGGGCCTTGCATGG - Intronic
1149049206 17:52284915-52284937 AAAGAAGTATGTCCTTTGCAGGG + Intergenic
1149359821 17:55883433-55883455 TAATTAGCATCTCCCTTTCATGG - Intergenic
1155077917 18:22378748-22378770 TAACTAGCATCTCCCTTTCAAGG + Intergenic
1155589992 18:27416464-27416486 TAAGTATGATGTTCACTGCAGGG - Intergenic
1156276615 18:35589459-35589481 TCAGTAGGATGTCCCTTTCTTGG + Intronic
1157191437 18:45585603-45585625 TAAGCTGGATCTGCCTTGCAGGG - Intronic
1157778068 18:50412513-50412535 TAAGGAGGAGGTCACTGGCAGGG - Intergenic
1160935933 19:1594634-1594656 TAATTATCATCTCCCTTGCATGG - Intergenic
929887791 2:45893945-45893967 TAAGTTAGAAGTCCCTTGCCCGG - Intronic
929889076 2:45904812-45904834 TCAGGAGAATGTCCCATGCAGGG - Intronic
930445273 2:51463167-51463189 TAAGTTTAATGTCCCTGGCATGG + Intergenic
935037129 2:99388399-99388421 TAAGTATGATGTCAGCTGCAGGG + Intronic
937487644 2:122332408-122332430 TAAATAGGATTTACCATGCAAGG - Intergenic
945796720 2:214373513-214373535 TAAATAGGCTGTCCATGGCAGGG + Intronic
1173085805 20:39915807-39915829 TATGTAGTATATCTCTTGCAGGG - Intergenic
1173403726 20:42746996-42747018 TAAGTAGCATGGCTCTGGCAGGG + Intronic
1174843102 20:53918181-53918203 AAAGCAAGATGTTCCTTGCAGGG - Intergenic
1177779865 21:25610679-25610701 CAAGTAGGATGCCTCCTGCAGGG + Intergenic
1180053503 21:45344809-45344831 CAAGCCGGTTGTCCCTTGCAGGG - Intergenic
952793167 3:37216513-37216535 TAAGTATGATCTGCCTTTCATGG - Intergenic
953072086 3:39530798-39530820 TAACAATGATGTCCATTGCATGG - Intergenic
953237105 3:41116651-41116673 ATAGCAGGACGTCCCTTGCAAGG + Intergenic
953858569 3:46521998-46522020 AAAGTTGGATGTCCCTTACTGGG - Intronic
954836769 3:53476560-53476582 AAAAAAGGATGTCCTTTGCAGGG - Intergenic
956813272 3:72885583-72885605 GCAGTAGGATGTCCCTTGCAGGG - Intergenic
957833790 3:85558741-85558763 TATGTATGAAGTCCCATGCAGGG + Intronic
958688756 3:97433602-97433624 GCAGTAGGATGTACCTTGCAGGG + Intronic
961975619 3:131022168-131022190 TAAGTAGGATGTCCCTTGCAGGG + Intronic
963235783 3:142954158-142954180 GAAGTTGGATCTCCCTTGCTGGG + Intronic
970005474 4:11406691-11406713 TAAGTAAGCTCTCCCTTGCCTGG - Intronic
976122009 4:81793799-81793821 TAGGTAAGATTTCTCTTGCATGG - Intronic
986045508 5:4033455-4033477 TAAAAAGGATGTCCATTGCAGGG - Intergenic
987591223 5:19929653-19929675 TATTTAGGATGTGACTTGCAAGG + Intronic
992278669 5:75149885-75149907 TAGGAACCATGTCCCTTGCAGGG - Intronic
997046647 5:130326895-130326917 TAAATATCATGTCCTTTGCAGGG - Intergenic
999838322 5:155398468-155398490 TAAGAAGGATATCACTTTCAAGG + Intergenic
1004167018 6:13265801-13265823 TAAGGAGGATGACCCTGCCATGG - Intronic
1008944994 6:57087874-57087896 TAAGTAGGTTTTCTCTTTCAGGG + Intronic
1009407276 6:63327654-63327676 TAAGTAGGATATGCCTTGGCTGG + Intergenic
1013378531 6:109543150-109543172 AAAGTAGGATCACCCTTGAATGG + Intronic
1014707576 6:124766574-124766596 TGAGTATGAAATCCCTTGCAAGG - Intronic
1017075432 6:150613297-150613319 TAAGAAGGATCTGACTTGCAAGG - Intronic
1018367643 6:163137918-163137940 TCAGTACCATGCCCCTTGCAGGG - Intronic
1019377374 7:700027-700049 GAGGTAGGATCTCTCTTGCATGG + Intronic
1020518315 7:9154005-9154027 TAAGAAGGAAGACCCGTGCAGGG - Intergenic
1020994966 7:15251878-15251900 TAACTAGCATGCCTCTTGCAAGG - Intronic
1027403799 7:77836648-77836670 AAAAAAGGATGTCCTTTGCAGGG + Intronic
1028493010 7:91434348-91434370 TAAGTATGTAGTCTCTTGCATGG + Intergenic
1028864407 7:95691252-95691274 TCAGAAGGATGCCCCTTCCATGG - Intergenic
1032776279 7:135116824-135116846 TCAGTAGGCTGTCCCTTTCCTGG + Intronic
1033810133 7:145002274-145002296 AAAGTATGAATTCCCTTGCAGGG + Intergenic
1034434203 7:151055388-151055410 TAAGTGGGAGGTCCCTTTCGGGG - Intronic
1037508738 8:19560110-19560132 TAAGTAGAATGTAACCTGCACGG + Intronic
1044997648 8:97852357-97852379 GCAGTAGGATGTAGCTTGCAGGG - Exonic
1045282166 8:100758582-100758604 TTAGTAGTAGATCCCTTGCAGGG + Intergenic
1047175596 8:122537684-122537706 TCAGGAGGCTGTCCCTTGCATGG - Intergenic
1047197939 8:122738387-122738409 TAAACAGGATGTGTCTTGCATGG - Intergenic
1047725093 8:127677371-127677393 GAAGTAGAAGGTTCCTTGCAGGG - Intergenic
1047846900 8:128815989-128816011 TTAATAGGATGTCTCTTCCAGGG - Intergenic
1048502952 8:134995241-134995263 GAAAAAGGATGTCCTTTGCAGGG - Intergenic
1049129270 8:140822457-140822479 AAAATAGTATCTCCCTTGCAAGG - Intronic
1052644072 9:31209400-31209422 TAATAAGCATGTCCCTTTCATGG - Intergenic
1056594057 9:87990732-87990754 TAAGTAGGATGTTACTTGTAGGG + Intergenic
1056944496 9:90983062-90983084 TATGTAACATGTCCCATGCACGG - Intergenic
1186472653 X:9833501-9833523 TAATTAGGAGGTCCGATGCAGGG - Intronic
1188121078 X:26308634-26308656 TAAAAAGGATGTCCTTAGCATGG - Intergenic
1189921873 X:45910186-45910208 TAAGTATGAAGTCCCTTTAATGG - Intergenic
1193719391 X:84970806-84970828 TGAGTATGATGACCCTTGGATGG + Intergenic
1198580233 X:138055729-138055751 TGAGTAGGATGCCACATGCATGG + Intergenic
1198826046 X:140699041-140699063 TGAGTAGGAATTACCTTGCATGG + Intergenic
1200742855 Y:6872718-6872740 CAAGTAGGATATTCTTTGCAAGG + Intronic