ID: 961981488

View in Genome Browser
Species Human (GRCh38)
Location 3:131083967-131083989
Sequence AAGGGCATTCTCAGAGGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 210}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961981488_961981496 19 Left 961981488 3:131083967-131083989 CCATATCCTCTGAGAATGCCCTT 0: 1
1: 0
2: 3
3: 19
4: 210
Right 961981496 3:131084009-131084031 CAAATCTTACCCTGACTCCCAGG 0: 1
1: 0
2: 1
3: 22
4: 335

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961981488 Original CRISPR AAGGGCATTCTCAGAGGATA TGG (reversed) Intronic
904923062 1:34023822-34023844 AAGGGCATACACTGGGGATATGG + Intronic
905311503 1:37052095-37052117 AAGAACATTTTCAGGGGATAGGG + Intergenic
906561913 1:46764523-46764545 AAGGGCACTCTCAGAGACTGGGG - Intronic
906566111 1:46802275-46802297 AAGGGCACTCTCACAGCAAAGGG - Intronic
909744475 1:79076238-79076260 AAGGGGATACTCAGAGAATATGG + Intergenic
909957114 1:81791825-81791847 AAGTGCATTTTCAGAGAAAAAGG + Intronic
911245780 1:95515472-95515494 AAGGCCATTCTCATAGAAAAAGG - Intergenic
911732702 1:101307119-101307141 ATGGCCCTTTTCAGAGGATAAGG - Intergenic
912106955 1:106290878-106290900 AATGCCATTCTCAGAAGATGAGG - Intergenic
912628494 1:111226598-111226620 AAGTCCATTCTCACAGGTTAAGG + Intronic
913261831 1:117005512-117005534 AAGAACATTCTAAGAGGAAAGGG - Intronic
915070868 1:153265208-153265230 AAGGACATTTTCACTGGATACGG - Intergenic
916257259 1:162801810-162801832 AAGGGAGTTCTCAGAGTATCAGG - Intronic
916400745 1:164445962-164445984 GAGGAGATTCTCAGAGGATCTGG - Intergenic
916743858 1:167669429-167669451 AGGCCCATTCTCAGAGGATCAGG - Intronic
917824524 1:178803963-178803985 CAGGGCACTGTCAGTGGATATGG - Intronic
918596840 1:186304327-186304349 AAGCCCATTCTCAGAGAACAGGG + Intronic
920069395 1:203291308-203291330 AAGGGCATTCTCACAGCACATGG - Intergenic
1062981172 10:1724357-1724379 AAGGACACTCTCACAGGATCAGG + Intronic
1063086176 10:2819949-2819971 AAAGGCCTTATCAGAGGCTAGGG - Intergenic
1063957722 10:11282031-11282053 AAGGCCACTCCCAGTGGATATGG + Intronic
1065464147 10:26001359-26001381 AAGGGGTTTTTCAGAAGATAAGG + Intronic
1065705527 10:28468757-28468779 AGAGGCAGTCTCAGAGGATGCGG - Intergenic
1065746667 10:28848537-28848559 GAGGGCATTTTCTCAGGATATGG + Intronic
1066723711 10:38367504-38367526 AAGGGAGTTCTCAGAGTATCAGG - Intergenic
1067454583 10:46409272-46409294 AAGGACCCTCTCAGAGGTTAGGG + Intergenic
1067632619 10:47975367-47975389 AAGGACCCTCTCAGAGGTTAGGG - Intergenic
1068199082 10:53759867-53759889 AAGGGCATTATAAGAAGAAAGGG + Intergenic
1069377192 10:67805062-67805084 TAAGGCATTATCATAGGATAGGG + Intronic
1070670783 10:78375875-78375897 AAAGGCATTCGCAGAGGCTGAGG - Intergenic
1071412795 10:85413296-85413318 CAGGGCATTGTCACAGGATGTGG + Intergenic
1072472149 10:95722822-95722844 AAGGGAATTTTCAGTGGTTAAGG + Intronic
1073794315 10:106971277-106971299 CATGGAATTCTGAGAGGATATGG - Intronic
1075166929 10:120077054-120077076 AACGGCATTTTCAGAGGAAGTGG + Intergenic
1076175088 10:128362284-128362306 ATGAGCCTTCTCAGGGGATATGG - Intergenic
1076460367 10:130640127-130640149 AAGTGAATTCTCACAAGATATGG - Intergenic
1076585962 10:131547820-131547842 AGGGGCCTTCTCAGAGGAAAGGG + Intergenic
1076814370 10:132907631-132907653 AAGGGAATTTTGAGGGGATAGGG - Intronic
1078757193 11:14222327-14222349 AAGTGCATCCTATGAGGATATGG - Intronic
1079691385 11:23421942-23421964 AACTGCATTTTCAGAGGAGAGGG + Intergenic
1079743614 11:24096791-24096813 AAGGGCATTCACTCAGGAGAAGG + Intergenic
1079768050 11:24419209-24419231 AAGAGCAATCTCAAAGAATATGG + Intergenic
1080010588 11:27454999-27455021 AAGAGCATTATCAGAAGAGATGG - Intronic
1080820248 11:35799078-35799100 AAGGGAATTCTGAGAGCAGATGG + Intronic
1083777628 11:64902048-64902070 AGGGTCATGCTCAGAGGAGAAGG - Exonic
1084169749 11:67395412-67395434 ATGGGTATCCTTAGAGGATAAGG + Intronic
1085044885 11:73346974-73346996 AAGGCCATTCTCAGGGGAGTGGG - Intronic
1085614210 11:77982796-77982818 AAGTGTATGCTCAAAGGATAAGG + Intronic
1088632176 11:111784392-111784414 AAGGGCATTCTAATAGGAACTGG - Intronic
1088756531 11:112889845-112889867 GAAGGCACTCTCAGAGGATGGGG - Intergenic
1089701463 11:120246648-120246670 AAGGGAATTCCCTGAGGACATGG + Intronic
1091066958 11:132523424-132523446 AAGGGCCTTCTCTGAGTATAGGG - Intronic
1091554256 12:1560381-1560403 AAGGTCATTTTCAGAGGAACCGG + Intronic
1091971928 12:4794535-4794557 ATGGGCATTCTTACAGGAAAAGG - Intronic
1093787386 12:23208204-23208226 AAGGAAGTTCTCTGAGGATAGGG - Intergenic
1095462491 12:42457265-42457287 AAGTACATTCTCAAAAGATAGGG - Exonic
1096806780 12:54145738-54145760 AAGGGCACCCTCAGAGGGCATGG + Intergenic
1097922208 12:65088385-65088407 GGGGCCAGTCTCAGAGGATATGG - Intronic
1099579370 12:84423313-84423335 AAGAACATTCAGAGAGGATAAGG + Intergenic
1099748770 12:86743961-86743983 AAGGGCAGTTTCAAAGTATAAGG + Intronic
1103361687 12:120358519-120358541 AAGGGATTTCTCAGAAGGTAAGG + Intronic
1110396160 13:75031809-75031831 AATGGCATTACCAGAGGAGAAGG - Intergenic
1111916721 13:94368570-94368592 AAAGCCATTATCAGAAGATATGG + Intronic
1113808112 13:113121678-113121700 AAGGCCCTTCTCAGAGGACCAGG + Intergenic
1113946928 13:114049737-114049759 AAGGGTGTTCTCAGAAGAAAGGG - Intronic
1114530262 14:23391072-23391094 AAGGGCACTTAAAGAGGATAAGG - Intronic
1115100413 14:29691479-29691501 AAGGGCTTTCTGAGAGTATGTGG + Intronic
1118339474 14:64882105-64882127 AAGGGCATTGTCAAATAATAGGG + Intergenic
1118459498 14:65975749-65975771 AAGGGCATGATTTGAGGATACGG + Intronic
1118706839 14:68487940-68487962 AAGGGCAAGATCAGAGGATAAGG - Intronic
1119511703 14:75216638-75216660 AAGGTCATGCCCAGAGGATGTGG + Intergenic
1124635166 15:31360510-31360532 AAGGGCTTTCCCAAAGGGTAGGG + Intronic
1126352226 15:47756244-47756266 AGGGGCATTCTTAGAGGATAAGG - Intronic
1127032518 15:54879830-54879852 AATGGCATTCTCTGAGGTTTGGG - Intergenic
1130175996 15:81571566-81571588 AAAGCCATTCTCTGAGAATAGGG - Intergenic
1130263387 15:82377176-82377198 ACAGGCATTTTCAGAGGAAACGG + Intergenic
1130367856 15:83256854-83256876 CAGGGAGTTCTCAGAGGATTGGG - Exonic
1130442932 15:83973590-83973612 TAGGGCATTCTTAGAAAATAGGG - Intronic
1130470246 15:84219675-84219697 ACAGGCATTTTCAGAGGAAACGG - Intergenic
1130477734 15:84334242-84334264 ACAGGCATTTTCAGAGGAAACGG - Intergenic
1130494031 15:84453888-84453910 ACAGGCATTTTCAGAGGAAACGG + Intergenic
1130536065 15:84785882-84785904 AAGGGTATTCTCAGCGCAGAAGG - Intronic
1130592535 15:85224303-85224325 ACAGGCATTTTCAGAGGAAACGG - Intergenic
1130699735 15:86166374-86166396 AAAGGCATTTCCACAGGATAGGG - Intronic
1130770005 15:86914796-86914818 AAGGGCCCTCTGAGAGGTTATGG + Intronic
1131322557 15:91408784-91408806 AAGGTGATACTCAGAGGAGAAGG + Intergenic
1133451462 16:5907278-5907300 AGGGGCATGCACAGAGGATGAGG - Intergenic
1133981319 16:10635226-10635248 AAGGGCTTTCTCACAGGACAGGG - Intronic
1134400568 16:13906002-13906024 CTGGGCATTCTCAGAGAATCTGG - Intergenic
1138961206 16:62032477-62032499 ATTGGCATTCACAGAGGAAATGG - Intronic
1139268279 16:65659696-65659718 AAGGGCATTCTGGGGGGAGATGG - Intergenic
1141894877 16:86953046-86953068 AAGGGCATTCCCACAGGAGCTGG - Intergenic
1142781916 17:2187911-2187933 AAGGGCAGCCTTAAAGGATATGG + Intronic
1144252988 17:13438325-13438347 AAGGGCATCCTCAGAGGTAGGGG + Intergenic
1146702155 17:34970651-34970673 AAGGGCAGTCTCCTAGAATACGG - Intronic
1148671410 17:49413329-49413351 GAGGGCCTTCTCTGAGGATTTGG - Intronic
1151872630 17:76846724-76846746 AAGGGCTCTCACAGAGCATATGG - Intergenic
1153659839 18:7316951-7316973 AAGGGCATCCTAAGAGCAAAGGG - Intergenic
1154354849 18:13616855-13616877 ATGGGCATGCTCAGAGGCTGTGG - Intronic
1155830596 18:30511517-30511539 AAGGATATTCTCATAGGATGAGG + Intergenic
1158719552 18:59912197-59912219 AAAAGAATTCTCAGAGGAAATGG - Intergenic
1159386970 18:67739774-67739796 AAGGGTATTATCAGAAAATAAGG - Intergenic
1161125349 19:2553213-2553235 AAAGGCATTATCAGAGAACACGG + Intronic
1162791478 19:13065246-13065268 AAGGGCAGGCTCAGAGGACAGGG + Intronic
1163072864 19:14859466-14859488 ATGGACATTACCAGAGGATAGGG + Intergenic
1165182123 19:33980502-33980524 AGAGGCATTCTCAGTGAATAAGG + Intergenic
1168577999 19:57529240-57529262 AAAGGTATCCTCTGAGGATAAGG - Intronic
925110355 2:1330305-1330327 AAGTGCATCCTCTGAGGAGAGGG + Intronic
928119512 2:28573397-28573419 AAGGGCTTTGTCAGAGGAAAGGG + Intronic
931655644 2:64509048-64509070 AAGGGCATTCTCGGATCATGAGG + Intergenic
932573567 2:72950862-72950884 AGGGGCCTTCTCCGGGGATAAGG + Intronic
933060034 2:77725533-77725555 ACCAGCATTCTCAGAGGGTAAGG + Intergenic
935676140 2:105596334-105596356 AAGGGCATAGTCACAGGAGATGG - Intergenic
935958338 2:108400232-108400254 CAGGGCAATCTCAGAGGTCAGGG + Intergenic
937059115 2:118968467-118968489 AAAGGCTTTCTCAGACTATATGG + Intronic
937413643 2:121697490-121697512 GAGGGCAGCCTCAGAGGCTAAGG + Intergenic
938096803 2:128469517-128469539 AAGGGCTTTCTTGGAGGAAAAGG - Intergenic
938250731 2:129813650-129813672 AATGGGATTCTCAGAACATAGGG + Intergenic
938899443 2:135787481-135787503 AAAGGCATTTTCAGAAGAAAGGG + Intergenic
939246815 2:139635801-139635823 AAGTGCTTGCTCAGAGGATAGGG + Intergenic
940069226 2:149666148-149666170 AGGGGAATTCTGAGAGGCTAAGG - Intergenic
941426968 2:165359363-165359385 AATGGGATACTCAGAGAATAAGG - Intronic
943588152 2:189764665-189764687 ATGGGCATTCTCAAAAAATATGG + Intergenic
945407794 2:209470909-209470931 AAGGGCATGTTCAGGAGATATGG - Intronic
946349681 2:219141793-219141815 AAGTGAAGTCTCAGAGGATCAGG + Intronic
946920561 2:224576943-224576965 GAAAGCATTCTCAAAGGATATGG - Intronic
947724829 2:232390572-232390594 AATGGCATTCTCAGACACTAAGG + Intergenic
1170113267 20:12828165-12828187 AAGGGGTTTCTCTGAGGATGTGG - Intergenic
1170896596 20:20420510-20420532 AAGGTCATTCTCAGAAGTTCTGG - Intronic
1174787170 20:53443921-53443943 AAGGGCATTCGCAGAGTGGATGG + Intronic
1175522011 20:59608057-59608079 AAGGGCACTCTCATAGATTACGG - Intronic
1178840171 21:36132324-36132346 AAGGGCATGTTAAAAGGATAAGG + Intergenic
1179283962 21:39960139-39960161 AAGTTGATTTTCAGAGGATAAGG - Intergenic
1179295680 21:40060292-40060314 AATGTCTTTCTCAGAGGCTAGGG + Intronic
1183252623 22:36741038-36741060 AAGGGCATTCTCAGGGAAGATGG - Intergenic
1184458481 22:44624478-44624500 AAGGTCATTCTCACAGGTTCAGG - Intergenic
1184823701 22:46932669-46932691 TGTGGCATTCTCTGAGGATAGGG + Intronic
1184847692 22:47099214-47099236 AAGGGCATACACAGAGGGAAGGG + Intronic
949742244 3:7249972-7249994 AAGGACATGGTCAGAGGACATGG + Intronic
951700741 3:25494015-25494037 AAGGGCAGGCTCAGGGGATTAGG + Intronic
953724387 3:45384923-45384945 ATGGCCATTGCCAGAGGATAGGG - Intergenic
955500528 3:59578515-59578537 ATGGGAACTCTCAGAAGATAAGG - Intergenic
955776519 3:62439644-62439666 AAGGGCATTCTCAGTAGGGATGG + Intronic
955788180 3:62561629-62561651 AAGGGCAATCTTAGAGGTTATGG - Intronic
956732820 3:72212372-72212394 AAAGGGCTTCTCAGAGGCTAGGG + Intergenic
957468818 3:80631902-80631924 AAGGGAATCCTCTGAGGAGATGG - Intergenic
957795669 3:85003094-85003116 ATGGAGATTCTCAAAGGATACGG - Intronic
959114258 3:102157298-102157320 CAGAGCATTTTCAGAGGAAAGGG - Intronic
959460598 3:106621284-106621306 AAGGGCATGTCCAAAGGATATGG + Intergenic
959483095 3:106897280-106897302 AAGGGACTTCTAAGAGGCTAGGG + Intergenic
960992647 3:123321985-123322007 CTGGCCATTCTCAGAGGACAAGG - Intronic
961096041 3:124157856-124157878 AGGGGCATTCGCAGGGGAAAGGG - Intronic
961981488 3:131083967-131083989 AAGGGCATTCTCAGAGGATATGG - Intronic
962396596 3:135019991-135020013 AAGGGCATTCTCAGCTGTTGAGG - Intronic
963571719 3:147006120-147006142 AAGGGCATTATAAAATGATAAGG - Intergenic
963708281 3:148716042-148716064 AAAGGCATTTCCATAGGATACGG - Intronic
967065462 3:185911325-185911347 AAGGGCATTCTCAGGGGAGAGGG - Intergenic
967074738 3:185991807-185991829 AAGGGCATTCTCAGGGGAGAGGG - Intergenic
967997581 3:195178481-195178503 AAGGGCACACACAGAGGATTTGG + Intronic
968135501 3:196216993-196217015 GAAGGCATTCGCAGAGGAAATGG + Intronic
974796731 4:66762371-66762393 AAGTGCTTTCTCAAAGGGTAAGG - Intergenic
975669307 4:76764603-76764625 AAGGGCATTTTCACTGGATATGG + Intronic
975712307 4:77173090-77173112 AAGGGCACTCCCAGAGGCTGGGG - Intronic
978322809 4:107516530-107516552 GAGTGCATTCTCATAGGATTTGG + Intergenic
979626848 4:122854686-122854708 AAGGGCCTTCTCAGAAGTTTTGG + Intronic
981280530 4:142953467-142953489 AATGGCAGTCTCAGAGTATCTGG + Intergenic
982009114 4:151089890-151089912 AAGGTAATACTGAGAGGATAAGG + Intergenic
982377370 4:154708070-154708092 GATTGAATTCTCAGAGGATAGGG + Intronic
985810282 5:2078177-2078199 CAGGGCACTCTCAGAGGTCAAGG - Intergenic
988393974 5:30673697-30673719 AAAGGCATTTTAAGAGGAAAGGG - Intergenic
988547246 5:32170161-32170183 AAGGACAATCTCACACGATATGG + Intronic
988964976 5:36406963-36406985 AAGGGGATTCCCAGAAGAAATGG + Intergenic
989134551 5:38140667-38140689 GGAGGCATTCTCAGAGGATGGGG - Intergenic
990150414 5:52811189-52811211 CATGTCATTCTCAGAGGATATGG + Intronic
990619156 5:57541360-57541382 AAGAGCATTCTGAGAGGAGCTGG - Intergenic
991767971 5:70009110-70009132 AATGGCAGTCTCAGAAGAGATGG - Intergenic
991847205 5:70884188-70884210 AATGGCAGTCTCAGAAGAGATGG - Intergenic
993709622 5:91211850-91211872 AAGGGCAGAGTCAGAGGAAAGGG - Intergenic
995035466 5:107529445-107529467 AACTGGATTCTCAGAGGATCTGG + Intronic
998982022 5:147714813-147714835 AAGGACATTTTCAGTGGGTATGG - Intronic
1001859110 5:175037686-175037708 ATGGGCTTTCTCAGAGGATCAGG + Intergenic
1002005331 5:176228337-176228359 AAGGGGCTTCTCATAGGATTTGG + Intergenic
1002221043 5:177682288-177682310 AAGGGGCTTCTCATAGGATTTGG - Intergenic
1003189833 6:3864773-3864795 GAGAGCTTTCTCAGAGGAAATGG - Intergenic
1003752732 6:9079292-9079314 AAGGGCATTCATGGAGGACAGGG - Intergenic
1006574642 6:35035867-35035889 AAGGGCAGTCACTGAGGACATGG - Intronic
1008066986 6:47060669-47060691 AAGGGCATTCTGAGAAGAAATGG - Intergenic
1008293572 6:49749925-49749947 AGGGGCATTATCAGATAATATGG + Intergenic
1008580562 6:52903109-52903131 AAGGGCATTCTCAGGGCACTGGG + Intronic
1008682645 6:53890240-53890262 AATAGCATTCTTAGAGGAGAAGG + Intronic
1008715734 6:54287872-54287894 TAGGGAATTCTCAGAATATAAGG + Intergenic
1008849595 6:56009051-56009073 AAGGTCATTACTAGAGGATAAGG - Intergenic
1010167674 6:72936035-72936057 AAGGGCATTACCAGAAGAGATGG - Intronic
1013492649 6:110664101-110664123 GAGGTCATGCTCAGAAGATATGG - Intronic
1016871618 6:148823359-148823381 AAAGGCATTCTTAGAGCAAAGGG - Intronic
1017565094 6:155675279-155675301 AAGTACATTCTTAGAGGATAGGG + Intergenic
1019653940 7:2177833-2177855 AAGGGCAGTCTCAGTGGCTCTGG + Intronic
1019877697 7:3829346-3829368 AAGGGCATACAGAGAGGAGAAGG + Intronic
1023962052 7:44935343-44935365 ATGGGCATTCTCTGAGGGCAAGG + Intergenic
1024290133 7:47797212-47797234 AAGGGCGATCTCAGGGGAGAGGG - Intronic
1028532417 7:91852132-91852154 AAGGGCTTCCACAAAGGATAGGG + Intronic
1030668965 7:112313839-112313861 AATGGCTTTCTCAAAGGAAAGGG - Intronic
1034868250 7:154658872-154658894 AAGGTCATTCTCAAAGGTCAAGG + Intronic
1035698477 8:1620176-1620198 AAGGACAGTTTCAGTGGATATGG - Intronic
1037115069 8:15216126-15216148 AATTGCATTCTCTGGGGATATGG + Intronic
1041525908 8:58805261-58805283 GAGGGCATTCTCAGAGTTTCAGG + Intergenic
1041873770 8:62664409-62664431 AAGGGCAATTTCAGAGGACAGGG - Intronic
1042079622 8:65037128-65037150 AAGGGCTTTATAAGAGGATGGGG - Intergenic
1047824893 8:128562652-128562674 AAGGGCATTCTGAGTGAATCTGG + Intergenic
1050018878 9:1263325-1263347 AAAGACATTCACAGAGGACAGGG - Intergenic
1050602778 9:7269381-7269403 AAGGTCAGCCTCAGAGGAAATGG + Intergenic
1050838670 9:10117710-10117732 AAGGGCATTTTCACAGGAACTGG + Intronic
1051364931 9:16315208-16315230 AAAGGCCTGCTCTGAGGATAAGG - Intergenic
1056733690 9:89186226-89186248 AAGGCCCTTCTCTGAGGACAGGG - Intergenic
1059557636 9:115297340-115297362 ATGTGCTTTCTCAGAGGATAGGG - Intronic
1060732435 9:126047037-126047059 AAGGGCATTCTGAGGGCATGGGG + Intergenic
1060891668 9:127193138-127193160 CAGGGAATTATCAGAGGAGACGG + Intronic
1061335961 9:129936308-129936330 GAGTGCATTCTTAGAGGAAAGGG - Intronic
1186834874 X:13427773-13427795 AAGGGCATTCCCAGGGGAGAGGG - Intergenic
1187937605 X:24351142-24351164 AAGGCAATTTTCAGAGGAGAAGG - Intergenic
1188256078 X:27963141-27963163 AAAGGGATTTTCAGAGCATATGG + Intergenic
1188538121 X:31219643-31219665 ATGGGTGTTCTCAGAGAATACGG - Intronic
1191668938 X:63731209-63731231 GGGGGCCTTCTGAGAGGATACGG - Intronic
1192303526 X:69932743-69932765 AAAGGTAATCTCAGAGGATTAGG - Intronic
1192422784 X:71048644-71048666 AAGGACATTTTCAGAGGTGATGG + Intergenic
1194011457 X:88567381-88567403 TGGGGCATTCTCAGAGGAGTAGG + Intergenic
1195242405 X:102965536-102965558 AAGGGTATTCCCAGTGTATAGGG + Intergenic
1196394924 X:115249327-115249349 AAGGGCTTTTTTAGTGGATATGG - Intergenic
1197379616 X:125723304-125723326 AAGTGCATTTTCAGAGATTAAGG + Intergenic
1199966522 X:152824964-152824986 AAGGGAAATTGCAGAGGATAGGG - Intergenic
1200225177 X:154413150-154413172 AAGGGCACTCCCTGGGGATATGG + Intronic
1201645663 Y:16228254-16228276 ACAGGCATTCCCAGAGGAAATGG + Intergenic
1201657150 Y:16357060-16357082 ACAGGCATTCCCAGAGGAAATGG - Intergenic