ID: 961983841

View in Genome Browser
Species Human (GRCh38)
Location 3:131111012-131111034
Sequence CTGTGTACATACATTTATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 460
Summary {0: 1, 1: 0, 2: 0, 3: 44, 4: 415}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961983840_961983841 1 Left 961983840 3:131110988-131111010 CCAAAGCTACTGACTGTAAAACT 0: 1
1: 0
2: 2
3: 16
4: 157
Right 961983841 3:131111012-131111034 CTGTGTACATACATTTATATTGG 0: 1
1: 0
2: 0
3: 44
4: 415
961983839_961983841 2 Left 961983839 3:131110987-131111009 CCCAAAGCTACTGACTGTAAAAC 0: 1
1: 0
2: 0
3: 23
4: 195
Right 961983841 3:131111012-131111034 CTGTGTACATACATTTATATTGG 0: 1
1: 0
2: 0
3: 44
4: 415

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961983841 Original CRISPR CTGTGTACATACATTTATAT TGG Intronic
900664178 1:3803050-3803072 CTGCGTCCATCCATTTAAATGGG + Intergenic
903171102 1:21554323-21554345 GTGTGTATATATATATATATGGG - Intronic
905246111 1:36615117-36615139 CTTTGTACACACATCTATGTCGG - Intergenic
906481259 1:46200638-46200660 CTGGTTACATTCATTTATAGTGG - Intronic
907720757 1:56969885-56969907 GTGTGTATATACATTTTTCTGGG + Intergenic
907785360 1:57606375-57606397 ATGTGTATATATATATATATAGG - Intronic
908052667 1:60249466-60249488 ATATGTACATATATATATATGGG - Intergenic
908421383 1:63961921-63961943 TTGTGTACATATATTGAAATAGG + Intronic
908591575 1:65642235-65642257 CTGTGTACATGCTTTTAAAATGG - Intergenic
908672591 1:66564480-66564502 TTGTGTACATTTGTTTATATTGG - Intronic
908908498 1:69044674-69044696 GTGTGTATATACTTATATATTGG + Intergenic
908954333 1:69603224-69603246 CTGTGTATATAACTTTATTTGGG - Intronic
908984485 1:70000436-70000458 TTGTGTACATACATCTGTAATGG + Intronic
908994178 1:70131766-70131788 CAGTGTCTATACATTTACATGGG + Intronic
909661149 1:78084142-78084164 CTGTGCTCATACATTGCTATTGG + Intronic
909961530 1:81850754-81850776 CTGAGAAAATACATTTTTATTGG + Intronic
911564478 1:99447023-99447045 CTGTGTACTTTCATTTCTCTTGG - Intergenic
913409059 1:118530912-118530934 CTATGTACAGACATTTTTCTAGG - Intergenic
914506622 1:148295347-148295369 CTGTGTACACTCATCTGTATTGG + Intergenic
915785382 1:158606220-158606242 ATATGTACATACAGTCATATGGG + Intergenic
915824770 1:159063804-159063826 CTGTGCAGGTCCATTTATATGGG + Intronic
915847330 1:159280184-159280206 GTGTGTATATATATATATATGGG + Intergenic
917309087 1:173658959-173658981 ATGTGTATATACATCTATATGGG - Intronic
917363806 1:174206308-174206330 TTGTGTACATGCATACATATTGG + Intronic
918532530 1:185539009-185539031 GTGTATACATATATGTATATCGG - Intergenic
919317420 1:195990759-195990781 ATATGTATATATATTTATATAGG + Intergenic
919411659 1:197252201-197252223 CTGTGTCCATAAAGTTTTATTGG - Intergenic
919580103 1:199360997-199361019 GTGTGTATATATATATATATAGG + Intergenic
921258662 1:213365907-213365929 CTGTTTACATAAAGTTTTATTGG - Intergenic
921511499 1:216036422-216036444 ATGTGTACATATACATATATAGG - Intronic
922159764 1:223070607-223070629 CTTTGTATATATATATATATAGG + Intergenic
922463596 1:225830983-225831005 CAGTGTCCATAAATTTTTATTGG + Intronic
923231273 1:231988782-231988804 GTGTGTAGGTACATTTTTATGGG - Intronic
923519312 1:234723678-234723700 GTGTGTGCATACATGTATAATGG + Intergenic
923638832 1:235730499-235730521 GTGTGTGTATACATATATATGGG + Intronic
924029742 1:239874263-239874285 CTGTGTATATAGATATATATAGG - Intronic
924621194 1:245662484-245662506 GGGTGTACATATATATATATTGG - Intronic
924920068 1:248619673-248619695 ATTTGTATATACATATATATGGG - Intergenic
1064025131 10:11842814-11842836 ATGTATACATACATATATTTGGG - Intronic
1064672077 10:17725390-17725412 GTGTATACATATATATATATAGG + Intergenic
1065851013 10:29788996-29789018 CTATCTATTTACATTTATATTGG + Intergenic
1066047778 10:31608756-31608778 GTGGGTACATACAGTTAGATAGG - Intergenic
1066439851 10:35428040-35428062 CAATGTACATACATATGTATAGG - Intronic
1066547190 10:36512550-36512572 CATTGCACATACAGTTATATTGG + Intergenic
1067390787 10:45861518-45861540 ATGTGTACACACATACATATAGG + Intergenic
1067500684 10:46802332-46802354 ATGTGTACACACATACATATAGG - Intergenic
1067593900 10:47537568-47537590 ATGTGTACACACATACATATAGG + Intronic
1067641011 10:48045681-48045703 ATGTGTACACACATACATATAGG + Intergenic
1067872492 10:49974586-49974608 ATGTGTACACACATACATATAGG - Intronic
1068079511 10:52302501-52302523 ATGTGTACATATGTGTATATAGG - Intergenic
1068190770 10:53649725-53649747 GTGTGTATATATATTTATACAGG + Intergenic
1068394216 10:56440602-56440624 TAATGTACAGACATTTATATAGG + Intergenic
1069006550 10:63323830-63323852 GTGTATACATATATATATATAGG + Intronic
1069207994 10:65717137-65717159 CTGTGTACCTACATTCAATTGGG - Intergenic
1070063379 10:73008472-73008494 GTGTGTACACATATGTATATAGG - Intronic
1071120815 10:82276192-82276214 TTGTGTTAATAGATTTATATAGG - Intronic
1071169216 10:82843896-82843918 CTATGTAGATAGGTTTATATTGG - Intronic
1071279627 10:84088547-84088569 CTGTTTATTTACATTTATAATGG - Intergenic
1072080855 10:92030059-92030081 CTGTGTGCATACATATGTATGGG + Exonic
1074701212 10:116094321-116094343 GAGTGTATATACATATATATGGG + Intronic
1074730092 10:116362231-116362253 GTGTGTACACACATGTACATAGG + Intronic
1074933152 10:118150183-118150205 ATGTGTACATAACTTTACATGGG - Intergenic
1076283150 10:129267504-129267526 CAGTGTAGGTACATTTATATGGG + Intergenic
1077706835 11:4494838-4494860 CTGTGTACATCAATTTAAATGGG + Intergenic
1078062070 11:8054765-8054787 CTGTGTTCATACATGTGCATGGG + Intronic
1078765521 11:14293202-14293224 CTGTGTACATAAAATTTTATTGG - Intronic
1079236388 11:18693599-18693621 CTGTGAACATACACTTCTCTGGG + Intronic
1079795880 11:24802400-24802422 CTGTATAGACACATTTATGTTGG + Intronic
1079837539 11:25352011-25352033 ATGTGTATATATATTTATACAGG - Intergenic
1081503486 11:43690279-43690301 CTGTGTACAGACATTGTTCTAGG - Intronic
1083069085 11:59958154-59958176 ATGTGTTCAAACATTTATTTAGG - Intergenic
1084993481 11:72952136-72952158 CTGTGTACTTTAACTTATATTGG + Intronic
1085836875 11:79966450-79966472 ATGTGTACATGCATGCATATGGG - Intergenic
1086056216 11:82650211-82650233 ATGTGTATATACATATATATAGG - Intergenic
1087495192 11:98882199-98882221 GTATATACATACATATATATGGG - Intergenic
1088408243 11:109504644-109504666 CCGTGTACATTCTTTTATCTGGG + Intergenic
1088905090 11:114149272-114149294 ATGTGTACATATATATACATCGG - Intronic
1090613297 11:128491337-128491359 CTGTGTAGATAGATTTTTAGTGG - Intronic
1090870856 11:130746178-130746200 CTGTGCACATGCATATTTATTGG - Intergenic
1091087747 11:132739318-132739340 CTCTGTAAATACATTTTTATGGG + Intronic
1092611177 12:10174674-10174696 CTGTGTACATACATAGAAATAGG - Intronic
1092973266 12:13719244-13719266 CACTGTACATATATTTATAGAGG - Intronic
1095170171 12:39025751-39025773 CTGTTTGAGTACATTTATATGGG + Intergenic
1096322073 12:50623376-50623398 GTGTGTAGATACATATATTTTGG - Intronic
1097083742 12:56452257-56452279 CTGTATGATTACATTTATATGGG - Intronic
1097490785 12:60268445-60268467 GTGTGTATATATATGTATATGGG - Intergenic
1097943354 12:65337653-65337675 CTGTGTACATTTATTTAAAGTGG - Intronic
1099047160 12:77736241-77736263 ATGTATACACACACTTATATGGG + Intergenic
1099113244 12:78588884-78588906 ATATGTACATATATGTATATAGG + Intergenic
1099548762 12:84016841-84016863 TTGTGTGCATACATTTCTATGGG - Intergenic
1099785687 12:87260361-87260383 ATGTGTATATATATATATATAGG - Intergenic
1101090965 12:101284844-101284866 GTATGTACAAACATTTATAGAGG + Intronic
1101181837 12:102227154-102227176 GTGTGCAAATACATCTATATGGG + Intergenic
1104160432 12:126174438-126174460 ATGTTTACATACATATATAACGG - Intergenic
1104596505 12:130123930-130123952 GTGTGTGTATACATATATATGGG + Intergenic
1105268815 13:18850285-18850307 TTGTGAACATAGACTTATATGGG - Intergenic
1105736721 13:23279120-23279142 ATTTGTACATATATTGATATAGG + Intronic
1106156674 13:27164596-27164618 CAGTTTATATACATTTATTTAGG - Intronic
1106441635 13:29778793-29778815 ATGTGTACATGCATTTTTATAGG - Intronic
1107704165 13:43082843-43082865 GTGTGTATATATATATATATAGG - Intronic
1108428589 13:50330692-50330714 ATATGTATATACATATATATGGG + Intronic
1109437109 13:62317681-62317703 CCGGGTGCATACTTTTATATTGG + Intergenic
1109859933 13:68184160-68184182 CAGTGTATCTACATTTTTATGGG - Intergenic
1110085460 13:71373462-71373484 CTGTGTATATTTGTTTATATGGG + Intergenic
1110254827 13:73421589-73421611 CTGTGTAGATAAATGTGTATTGG + Intergenic
1110447323 13:75600686-75600708 CTTTGTAAATATATCTATATCGG - Intronic
1110595000 13:77310406-77310428 CTTTGTAAATAAAGTTATATTGG + Intronic
1110877807 13:80532044-80532066 CATTTTAAATACATTTATATGGG - Intergenic
1111316309 13:86565268-86565290 CTGTTTATATACATATATTTGGG + Intergenic
1111416950 13:87959226-87959248 CTGTGAACATCCATGTACATAGG + Intergenic
1111563025 13:89977702-89977724 CTGTTTTCATAGATTTATTTAGG - Intergenic
1111611244 13:90610628-90610650 ATTTGTATATATATTTATATAGG - Intergenic
1113233923 13:108248076-108248098 TTTTGTACCTATATTTATATGGG - Intergenic
1114752992 14:25226963-25226985 CTGTGTTCATTCATTTCTTTAGG - Intergenic
1115255699 14:31399143-31399165 ATGTGGACATACAGTTATACTGG + Intronic
1116006956 14:39303622-39303644 ATTTGTAAATATATTTATATGGG - Intronic
1118735630 14:68699303-68699325 CTGTGGACAAATATTTATAGTGG - Intronic
1118976414 14:70681092-70681114 CTGTGAACATATATATATATAGG - Intergenic
1120204765 14:81575754-81575776 CTGTGTATATACGTGTGTATGGG - Intergenic
1120597025 14:86453101-86453123 CTGTGTACATAACTCTATAATGG - Intergenic
1121569745 14:94938518-94938540 CTGTGTGCATGCATGTCTATGGG + Intergenic
1121569758 14:94938714-94938736 CTGTGTGCATGCATGTCTATGGG + Intergenic
1202893259 14_KI270722v1_random:179697-179719 GTGTGTATATACATATGTATGGG - Intergenic
1124043577 15:26126960-26126982 CTGTGCAAATACAGTTTTATTGG + Intergenic
1124468208 15:29959465-29959487 ATGTCTACTTACATTTGTATTGG + Intronic
1126028267 15:44470425-44470447 CTGTGTGTATATATTTACATTGG + Intronic
1126166262 15:45656590-45656612 CTATACACATACATTAATATTGG - Intronic
1126275244 15:46871006-46871028 CTATGTACATACATATAGACAGG - Intergenic
1126326748 15:47486715-47486737 CTGAGTACGTACATTTTTATAGG + Intronic
1126360272 15:47838392-47838414 CTATGTATTTACATTTATCTGGG + Intergenic
1126580940 15:50242153-50242175 ATGTGTACATGCATTTTTCTTGG - Exonic
1126745718 15:51824614-51824636 CTGTGTGCATACAGTTTTACAGG - Intergenic
1127270917 15:57401131-57401153 CTGTGTATATAAATTTTTGTTGG + Intronic
1129032142 15:72627171-72627193 CTTTTTAAATACATTTATTTAGG - Intergenic
1129099802 15:73250189-73250211 GGGTGTATATACATATATATGGG - Intronic
1129406910 15:75325911-75325933 CTTTTTAAATACATTTATTTAGG - Intergenic
1129470111 15:75748775-75748797 CTTTTTAAATACATTTATTTAGG - Intergenic
1129734913 15:77954361-77954383 CTTTTTAAATACATTTATTTAGG + Intergenic
1130602000 15:85282101-85282123 ATGTATACACACATATATATAGG - Intergenic
1131644002 15:94322527-94322549 TTTTGTAAATAAATTTATATTGG - Intronic
1132967012 16:2662390-2662412 CTGTGTCCATCCATTTAAATGGG + Intergenic
1133143007 16:3762098-3762120 CTGTGCTCATTCGTTTATATAGG + Intronic
1133453144 16:5920306-5920328 CTCTCTACATACAATTATATGGG - Intergenic
1133910567 16:10062316-10062338 TTTTGTACATAAATTTTTATTGG - Intronic
1134110089 16:11509883-11509905 CTGTGTACTTACAGATACATAGG - Intronic
1134285371 16:12857113-12857135 CTATGTATATAAATATATATCGG - Intergenic
1135342172 16:21658446-21658468 CTGTGTAATTCCAATTATATGGG - Intergenic
1136457296 16:30387868-30387890 CAGTGTGTATACATATATATAGG - Intronic
1137310319 16:47250358-47250380 ATATGTATATATATTTATATAGG - Intronic
1137965091 16:52923626-52923648 ATATGTATATACATATATATGGG - Intergenic
1138871881 16:60899966-60899988 CTCTGTACACACTTTTTTATTGG + Intergenic
1139291820 16:65865765-65865787 ATGTGTATGTACACTTATATAGG - Intergenic
1139488752 16:67274569-67274591 GTGTGTATATATATATATATGGG - Intergenic
1139738359 16:69013318-69013340 CTGTGTACATATTTTTAAAATGG - Intronic
1145107443 17:20130736-20130758 CTTTGTAGGTATATTTATATGGG - Intronic
1146573409 17:33971622-33971644 GTGTGTCCTTACATGTATATGGG - Intronic
1147468084 17:40627593-40627615 CTGAGTACACAAATTTATAATGG + Exonic
1147601532 17:41749019-41749041 GTGTGTGCATATATATATATGGG - Intergenic
1147837010 17:43340513-43340535 CTGTGTTCATCCATTTGAATGGG + Intergenic
1148099311 17:45078483-45078505 CTGTGTATATATATATATACAGG - Intronic
1148763723 17:50025338-50025360 GTGTATACATACATGTATACAGG - Intergenic
1149053945 17:52340137-52340159 GTGGGTACATATATATATATGGG + Intergenic
1149140985 17:53433433-53433455 CTCTGTACATAAAATTATTTTGG - Intergenic
1149654190 17:58301744-58301766 CTGAGTATATACATATATACAGG + Intronic
1151129308 17:71879656-71879678 CTATGAACATTCATTTATGTAGG - Intergenic
1151353524 17:73545398-73545420 GTGTGTGCATTCATTTATTTAGG - Intronic
1153324663 18:3805994-3806016 CTGTAAAGATACATTTATTTAGG + Intronic
1154419208 18:14209712-14209734 TTGTGAACATAGACTTATATGGG + Intergenic
1154939461 18:21096500-21096522 CTGTCTACAAATATTTATGTTGG + Intronic
1155134046 18:22969876-22969898 ACGTGTGCATACATTTATTTAGG + Intronic
1155175232 18:23296015-23296037 TTGTGTAAATTCATTTATTTTGG + Exonic
1155195183 18:23467577-23467599 CTGTGTAAATTCATTAATCTTGG - Intronic
1156024594 18:32637670-32637692 GTGTGTATATATATATATATAGG - Intergenic
1156380045 18:36550208-36550230 TTGTGTATATATATATATATAGG + Intronic
1156973862 18:43192726-43192748 GTGTGTATATATATATATATGGG - Intergenic
1157069296 18:44387133-44387155 CTGTGTACATGTATGTATGTTGG - Intergenic
1159496233 18:69210485-69210507 CTGTATAGTTACATTTATTTTGG + Intergenic
1159834020 18:73314266-73314288 CTGTGTGTATACATTTGTAAAGG + Intergenic
1159871196 18:73761222-73761244 ATGTGTACATACTTTTAAAATGG + Intergenic
1160743837 19:700945-700967 CTGTGGATATACATTTATTGGGG - Intergenic
1163259975 19:16183165-16183187 TTGTGTTCATTCATTTATCTAGG + Intergenic
1163785342 19:19272299-19272321 CTGTGTACAAAGATTTGTCTTGG - Intronic
1164083687 19:21882375-21882397 CTGTGTCCATCCATTTAAATGGG + Intergenic
1164499525 19:28804560-28804582 GTATGTACACACATGTATATAGG - Intergenic
1166322762 19:42028804-42028826 CTTTGTACATAAAGTTTTATTGG + Intronic
925654409 2:6129944-6129966 TTATTTACATATATTTATATAGG - Intergenic
927298409 2:21482103-21482125 ATGTGTATATACATTGATATGGG + Intergenic
928498287 2:31858545-31858567 CTATGTATATAGATATATATTGG - Intergenic
928692585 2:33816297-33816319 GTGTATACGTATATTTATATAGG - Intergenic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
929087528 2:38183114-38183136 CTGTCTACATGGATTTGTATTGG - Intergenic
930873208 2:56187147-56187169 ATGGGTACATATATTTATTTTGG + Intronic
931254730 2:60560319-60560341 GTGTGTTCCTACATATATATAGG + Intergenic
931281316 2:60794640-60794662 CAGTTTATATAGATTTATATGGG + Intronic
932235429 2:70117023-70117045 CTTTGTACGTACATTTACACTGG - Intergenic
932918481 2:75882840-75882862 ATCCGTACATACATTTTTATAGG - Intergenic
933106753 2:78337756-78337778 CTGTATATATGCATTTATAATGG - Intergenic
933325241 2:80827311-80827333 GTGTATACATACATATGTATGGG + Intergenic
933343869 2:81058251-81058273 GTGTGCACATATATTTACATTGG + Intergenic
933556154 2:83833405-83833427 ATGTGTACGTATATGTATATAGG - Intergenic
934116219 2:88797461-88797483 ATGTGTGCATACATTGCTATAGG - Intergenic
934626937 2:95867380-95867402 ATGTGTGCATACATTGCTATAGG + Intronic
934806623 2:97233909-97233931 ATGTGTGCATACATTGCTATAGG - Intronic
934830886 2:97523266-97523288 ATGTGTGCATACATTGCTATAGG + Intronic
935168138 2:100587636-100587658 GTGTGTGTATACATATATATGGG - Intergenic
935999992 2:108817745-108817767 CTCTGTATATACATTGATTTTGG + Intronic
936384456 2:112016535-112016557 ATGTTTAAATACATTGATATTGG - Intronic
936619974 2:114085338-114085360 TTGTGTACTTACATTTTTCTAGG + Intergenic
936804099 2:116304858-116304880 CTGCATCCATCCATTTATATTGG - Intergenic
937784866 2:125884945-125884967 GTGTGTATATACACATATATTGG - Intergenic
939122234 2:138131256-138131278 CTGTATTCATTCATTTATACTGG - Intergenic
939397350 2:141648153-141648175 CTGTGAAGAAACATTCATATTGG + Intronic
941261052 2:163297841-163297863 CTGTGGACTTATTTTTATATCGG + Intergenic
941678341 2:168368186-168368208 ATGCATACATATATTTATATGGG + Intergenic
942566482 2:177269236-177269258 CTGTGCATATATATTTATATAGG - Intronic
942719220 2:178931361-178931383 CTATGAACATTCATGTATATGGG - Intronic
942746266 2:179236840-179236862 CTATTTACATACATTTATTTTGG - Intronic
943541036 2:189214461-189214483 CTTTATACATACATACATATAGG + Intergenic
943945026 2:194049946-194049968 ATGTATATATACATGTATATAGG - Intergenic
944998464 2:205321501-205321523 TTGTGCATATACATTCATATGGG - Intronic
945127624 2:206530196-206530218 CAGTGTCCATACAGTTTTATTGG + Intronic
945217229 2:207446762-207446784 CTATGTACATATATGTATATAGG + Intergenic
945724459 2:213458675-213458697 CTGTGTACACAGTTGTATATTGG + Intronic
946480128 2:220047579-220047601 ATGTGTACATGCATGTACATAGG + Intergenic
948517459 2:238512730-238512752 CTGTGTAAATAAAGTTTTATTGG - Intergenic
948538909 2:238671290-238671312 CTATATACATCCATTTTTATTGG + Intergenic
1169170624 20:3461859-3461881 GAGTATACATACATTTCTATTGG - Intergenic
1170606832 20:17881024-17881046 GTGTGTAGATACATATATATAGG + Intergenic
1170951688 20:20942260-20942282 ATGCATACATACATATATATAGG + Intergenic
1171170193 20:23009040-23009062 ATGTGTACATATATACATATAGG - Intergenic
1171283468 20:23919786-23919808 ATGTGTACATACATGTATGTGGG - Intergenic
1171889312 20:30694281-30694303 GTGTGAACATAGACTTATATGGG - Intergenic
1173885677 20:46457004-46457026 CTGTGTACATTCTTTGATGTTGG + Intergenic
1173950028 20:46984753-46984775 GTGTGTGTATACATATATATAGG + Intronic
1176854098 21:13949581-13949603 TTGTGAACATAGACTTATATGGG - Intergenic
1177394494 21:20514934-20514956 ATGTATAAATACATATATATAGG + Intergenic
1177525491 21:22285672-22285694 CTGTATATATATATCTATATAGG - Intergenic
1177999485 21:28143554-28143576 CTGTCTACATATTTTTAAATGGG + Intergenic
1178693263 21:34767803-34767825 ATGTGTAAATCCATTTATAGAGG + Intergenic
1178910922 21:36672815-36672837 GTGTATACATATATATATATAGG - Intergenic
1179292761 21:40033061-40033083 CTGGTTACATACATCTGTATTGG - Intronic
1179618533 21:42597280-42597302 ATATGTATATACATCTATATGGG + Intergenic
1180290203 22:10843082-10843104 CTGTCTTCATACATTTATTGAGG + Intergenic
1180493001 22:15872503-15872525 CTGTCTTCATACATTTATTGAGG + Intergenic
1181527456 22:23498257-23498279 GTGTGTATATATATATATATAGG - Intergenic
1183907972 22:41057142-41057164 CAGAGTACATACTTTTATATAGG - Intergenic
1183934373 22:41253777-41253799 CTGTAAATAGACATTTATATTGG + Intronic
1184933748 22:47702552-47702574 CTTTATAGATACATTTATTTAGG + Intergenic
949248998 3:1960131-1960153 CTGTGTAGTTGCATTTATCTTGG - Intergenic
951393839 3:22140136-22140158 CTCTGTACATAAATGTTTATAGG + Intronic
951424213 3:22524139-22524161 ACGTATACATACATTTCTATTGG - Intergenic
952001056 3:28786203-28786225 CTATATATATAAATTTATATAGG + Intergenic
955067931 3:55548440-55548462 CTGTGTAGACACATTTAGAGGGG - Intronic
955877596 3:63509205-63509227 ATGTGTATATACATATGTATGGG + Intronic
956147759 3:66208744-66208766 GTGTATATATATATTTATATGGG + Intronic
956327343 3:68068904-68068926 CTATGCACATACAATAATATGGG - Intronic
956888007 3:73579840-73579862 GTGTGTATATATATTTATATGGG + Intronic
957126135 3:76163551-76163573 ATATGTATATACATATATATAGG + Intronic
957721163 3:84001321-84001343 GTGTGTGCATATATATATATAGG + Intergenic
957795530 3:85000819-85000841 CTATGTATGTACATTTGTATAGG + Intronic
957954494 3:87167333-87167355 CTGTATATATACATATAGATAGG - Intergenic
959015594 3:101130552-101130574 ATATGTACATACATCTATATAGG + Intergenic
959193319 3:103143423-103143445 CACTATACATACATGTATATAGG + Intergenic
959379377 3:105623627-105623649 ATGTGTACATATGTATATATGGG - Intergenic
959770205 3:110085949-110085971 CTGTCTATATTCATATATATAGG - Intergenic
959949147 3:112159938-112159960 CAGTGTACATGTATTTTTATAGG + Intronic
959991411 3:112636303-112636325 CAGAGTACATATATTTAAATGGG - Intronic
960554449 3:119011967-119011989 GTGTATACACACATATATATAGG + Intronic
961608720 3:128119032-128119054 CTGTGGAAATACATTTCTGTTGG - Intronic
961983841 3:131111012-131111034 CTGTGTACATACATTTATATTGG + Intronic
962713255 3:138105105-138105127 GTGTTTACATATATATATATTGG - Intronic
963109692 3:141677323-141677345 CCATGTACATACATTCATGTTGG - Intergenic
963152988 3:142066279-142066301 ATCTATACATACATTTATAGTGG - Intronic
963908402 3:150793619-150793641 GTAAGTACATACATTTATGTGGG - Intergenic
963958111 3:151277826-151277848 ACTTGTACATACACTTATATAGG - Intronic
964098496 3:152962096-152962118 GTGTATACATACATGTACATAGG + Intergenic
964723259 3:159789085-159789107 CTGTATACATACACATATACAGG - Intronic
965201314 3:165661906-165661928 CTGTGTATTGATATTTATATAGG + Intergenic
965387182 3:168058797-168058819 AAGTGTATATACATATATATTGG + Intronic
965452886 3:168859960-168859982 ATGTGTATATACGTTTTTATAGG - Intergenic
966070965 3:175877499-175877521 CTGTATAAATACATTTCTTTAGG - Intergenic
966107599 3:176355913-176355935 GTGTGTACACAAATTTTTATAGG - Intergenic
967015483 3:185478012-185478034 CTATCTAGATACAATTATATTGG + Intronic
970894414 4:21085757-21085779 TTGTCAAAATACATTTATATTGG - Intronic
970936969 4:21583628-21583650 CTTTAAACATAAATTTATATTGG - Intronic
971800036 4:31277527-31277549 TTGTGTACATCCATTTATGAGGG - Intergenic
971825651 4:31618686-31618708 ATGTGTGCATATATGTATATAGG - Intergenic
971947530 4:33300612-33300634 CTGTTTTCATAAATTTTTATTGG - Intergenic
972013186 4:34209762-34209784 ATGTGTATATATATATATATGGG - Intergenic
972069054 4:34992019-34992041 GTTTGAAAATACATTTATATAGG + Intergenic
972204108 4:36750082-36750104 ATGTGTATATACATGCATATTGG - Intergenic
972849474 4:43031368-43031390 CCGAGTACAGACATGTATATAGG - Intergenic
973228318 4:47811778-47811800 TTTTGTACATACAGTTTTATTGG + Intronic
974199915 4:58623888-58623910 CTGTTTACTCACATTTATCTGGG + Intergenic
974428790 4:61770203-61770225 CTGTTTACCTACATTTATAGAGG + Intronic
974615707 4:64277826-64277848 ATGTGTACTTTGATTTATATAGG + Exonic
975010952 4:69350583-69350605 ATGTGTATATATATATATATAGG - Intronic
975041569 4:69751091-69751113 ATGTTTACAGTCATTTATATTGG - Intronic
975042955 4:69767843-69767865 CTGTGCACAGGAATTTATATGGG - Intronic
975248235 4:72145435-72145457 ATAAGTACATATATTTATATAGG - Intronic
975253340 4:72205595-72205617 CTATGTATATATATTTATATGGG + Intergenic
975377984 4:73667547-73667569 CTGCGTCCATCCATTTAAATGGG + Intergenic
975400720 4:73935520-73935542 CTGTGTGTATATATGTATATAGG + Intergenic
976019026 4:80597042-80597064 TTGTGTGCATATATGTATATTGG + Intronic
977077242 4:92470953-92470975 CTGTCTACATACAGTATTATTGG + Intronic
977267907 4:94877966-94877988 GTGTGTATATGCATTTACATTGG + Intronic
977817543 4:101432393-101432415 CTTTCTTTATACATTTATATAGG - Intronic
978865928 4:113511430-113511452 ATGGGTACATACATTAATAAAGG + Intronic
979670923 4:123359560-123359582 TTATGTACTTACATTTGTATGGG + Intergenic
980222513 4:129937667-129937689 ATGTGTACACACATTTCTAAAGG - Intergenic
980319523 4:131251508-131251530 CTGTGTACACATACGTATATTGG - Intergenic
980593787 4:134926701-134926723 CTGGGTACATATATATATATAGG + Intergenic
980642029 4:135593705-135593727 CTGTGTACACAGGTTAATATAGG + Intergenic
980858345 4:138467983-138468005 GTGTGTATATATATTTTTATTGG + Intergenic
983447370 4:167870590-167870612 GTGTGTATATATATATATATGGG + Intergenic
983799960 4:171915129-171915151 ATATGAACATACATTTTTATAGG - Intronic
983974527 4:173916896-173916918 CTGAGTACCTCCATTTATAAAGG + Intergenic
984426711 4:179596954-179596976 CTATATACATACATTTAAAAGGG - Intergenic
984430891 4:179647590-179647612 ATATGTACATACATTTCTACTGG - Intergenic
985203893 4:187512458-187512480 CTGTTTAAATACATTTCTACAGG + Intergenic
985632289 5:1020325-1020347 GTGTATACATACATGTATAGAGG + Intronic
986089141 5:4486500-4486522 CTGTGAAAATAAATTTATACTGG - Intergenic
986098961 5:4587539-4587561 CTGTGTTCTCAAATTTATATGGG - Intergenic
987151692 5:15047028-15047050 ATGTATACATATATGTATATGGG - Intergenic
987287009 5:16466620-16466642 CTGTGTACCCTCATGTATATAGG + Intergenic
987517242 5:18926943-18926965 CTTTGTACATATATGTATATAGG - Intergenic
987705357 5:21456960-21456982 GTGTGTATATATATATATATGGG + Intergenic
988248076 5:28714754-28714776 CTGTGATCATTCAATTATATAGG + Intergenic
988950604 5:36255400-36255422 CTGTGTACTTATAATAATATAGG - Intronic
989207082 5:38821620-38821642 ATGTGTATATACATGTATATAGG - Intergenic
989367508 5:40673383-40673405 GTGTGTATCTACATGTATATAGG + Intergenic
990242090 5:53826028-53826050 CTGTGTGATTACATTTATATGGG + Intergenic
990439545 5:55831167-55831189 CTGTGTGCATACATATCTTTTGG + Intergenic
990996189 5:61734436-61734458 CTGTGTATTTAGATTTATAAAGG + Intronic
991023976 5:62009831-62009853 CTGTGTATCTACTTTTATGTTGG - Intergenic
991389482 5:66126869-66126891 CTGTATGCAAACATTTATAGTGG + Intergenic
991452892 5:66771487-66771509 GTGTGTAAATATATTTCTATCGG + Intronic
992055389 5:72983868-72983890 ATATATATATACATTTATATTGG + Intronic
992552710 5:77874491-77874513 CTGTGTAATTACATTTCAATGGG - Intergenic
992998358 5:82354905-82354927 CTGTTGACATATATTTACATAGG + Intronic
993978323 5:94510828-94510850 CTCTGCACAGACATTTATACAGG - Intronic
994781154 5:104092357-104092379 CTGTATACATATATGTGTATAGG - Intergenic
994872019 5:105363090-105363112 TTGTGTCCTTAAATTTATATTGG - Intergenic
995663766 5:114517649-114517671 ATGTATCCATACATTTATCTGGG + Intergenic
995763476 5:115589084-115589106 TTCTGTAAATACATTTTTATTGG + Intronic
996148272 5:120002081-120002103 CTGGATAAATACATTTTTATGGG - Intergenic
996263779 5:121508958-121508980 ATCTGCAGATACATTTATATTGG - Intergenic
997755244 5:136390176-136390198 CTGTGTAGTTGCATTTATATTGG + Intronic
997912611 5:137890572-137890594 CTGTGTACTTACATATACATAGG - Exonic
998423827 5:142010900-142010922 CAGTGTCCATACAGTTTTATTGG + Intronic
998951511 5:147397173-147397195 GTGTGTATATATATATATATAGG - Intronic
999116168 5:149165327-149165349 CTTTGTATATAAATTTTTATTGG + Intronic
1001432301 5:171672478-171672500 CTTTGTACATACTTTAACATAGG - Intergenic
1002260288 5:177988830-177988852 ATGTGTATATATATATATATGGG - Intergenic
1002963475 6:1939566-1939588 GTGTGTATATATATGTATATAGG - Intronic
1003243352 6:4363440-4363462 CTATGTACATTCTTTTATATCGG - Intergenic
1003876222 6:10439840-10439862 GTGTGTATATACATTTAGAGAGG - Intergenic
1004622745 6:17345528-17345550 GTGTGTACATACAAACATATTGG + Intergenic
1004956762 6:20735871-20735893 AGGTGTACAAACATTTCTATAGG - Intronic
1005320908 6:24652722-24652744 GTGTGTATATATATATATATAGG - Intronic
1005388932 6:25313681-25313703 CTGTATATATACAGTTATTTGGG + Intronic
1005725667 6:28645307-28645329 CTGTGTGTATACATGTATATAGG + Intergenic
1006691237 6:35888447-35888469 CTGTGTATATATCTGTATATAGG + Intronic
1006810223 6:36815584-36815606 CTGTGTAAATAAATTTCTGTTGG + Intronic
1008334788 6:50289501-50289523 ATGTGTATCTATATTTATATAGG - Intergenic
1009808414 6:68631810-68631832 ATGTGTGCATATATATATATGGG + Intergenic
1010304950 6:74309025-74309047 CAATGTACATATATATATATAGG - Intergenic
1011885460 6:92089504-92089526 CATTGTAAATAGATTTATATAGG + Intergenic
1012050536 6:94337069-94337091 CAGTGTAAATATATATATATAGG + Intergenic
1012389842 6:98725835-98725857 ATGTGTACGTATCTTTATATAGG + Intergenic
1012876035 6:104727105-104727127 GTGTGTATATATATGTATATGGG + Intergenic
1013477590 6:110523357-110523379 ATGTACACATACATATATATGGG + Intergenic
1013914334 6:115316662-115316684 ATGTGTACATACATGTATGTGGG + Intergenic
1016166850 6:140956421-140956443 CTTTGTGCATACATTAATACTGG + Intergenic
1017274091 6:152545620-152545642 CTGTTTACATAATTATATATAGG + Intronic
1017383003 6:153851524-153851546 CTTTATACATATATATATATAGG + Intergenic
1018929367 6:168230345-168230367 GTGTGTACATACATATATGTAGG + Intergenic
1020378756 7:7518278-7518300 ATGTGAACTTACATTTATAATGG + Intronic
1020947846 7:14637605-14637627 ATGTGTATATACACATATATAGG - Intronic
1021290584 7:18838831-18838853 CTGTGAAGCTACATTTATAGTGG + Intronic
1021504541 7:21367299-21367321 CTGTGTAAATAAAGTTTTATTGG - Intergenic
1023009660 7:35914957-35914979 ATGTGTACATAAATATATGTAGG - Intergenic
1024081165 7:45856518-45856540 ATGTGTACATAAATATATGTAGG + Intergenic
1025123335 7:56325239-56325261 ATGTGTACATAAATATATGTAGG - Intergenic
1025728771 7:64091632-64091654 GTGTGTATATATATATATATGGG + Intronic
1025868899 7:65411927-65411949 CTATGTACATATGTTAATATTGG - Intergenic
1026372662 7:69717243-69717265 CTGTGTATATTTATTTATATGGG + Intronic
1026414791 7:70168246-70168268 CTGTCTACAAACATTTATGCAGG + Intronic
1027333110 7:77121026-77121048 CTGTGTACACACACTTTTCTAGG - Intergenic
1027537072 7:79416541-79416563 CTGTGTACCGAAATATATATGGG + Intronic
1027899029 7:84085082-84085104 CTTTATACATACATTTAGAAAGG + Intronic
1028051606 7:86194976-86194998 CCCTGTCCATACATTTAAATGGG - Intergenic
1028871355 7:95773841-95773863 CTGTGTACATACTTTAATTGTGG + Intronic
1029782680 7:102750275-102750297 CTGTGTACACACACTTTTCTAGG + Intronic
1030060737 7:105618881-105618903 CAGTGTACTTACATTTTAATAGG - Intronic
1030959232 7:115893692-115893714 CTCTGTACAAAAATTTATTTGGG - Intergenic
1031063313 7:117076377-117076399 GTGTATACATACACATATATTGG - Intronic
1031313775 7:120231821-120231843 CTCCCTACATACATTTATTTGGG + Intergenic
1031346897 7:120678258-120678280 CTGTATGCATTCAATTATATAGG + Intronic
1031356691 7:120796067-120796089 CTTTGTAAATACATTTTTTTTGG - Intronic
1031636918 7:124112616-124112638 CTGAGTACATCCCTTTAAATTGG - Intergenic
1031671384 7:124550884-124550906 CTTTATACATAGAATTATATAGG - Intergenic
1032425124 7:131816443-131816465 CTGTGTAAACACATGTGTATGGG + Intergenic
1032632389 7:133668270-133668292 CTGTATGTATACATTTTTATTGG - Intronic
1033876559 7:145826481-145826503 ATATATACATACATATATATAGG + Intergenic
1036395350 8:8365789-8365811 GTGTGTATATATATATATATAGG - Intronic
1037436762 8:18871151-18871173 CTGTGTTCATACATGTATGTCGG + Intronic
1037632277 8:20669021-20669043 GTGTTTGCATAAATTTATATAGG + Intergenic
1038444003 8:27590673-27590695 CTGTGTGATTCCATTTATATGGG + Intergenic
1039131827 8:34273594-34273616 CTGTGTACATACATGTACTGTGG + Intergenic
1039215948 8:35271757-35271779 ATGTATACATATATTTACATAGG + Intronic
1039847979 8:41339403-41339425 CATTGTACATTCTTTTATATTGG + Intergenic
1040482633 8:47840844-47840866 CTGTGTAAAAATATTTACATAGG + Intronic
1041865235 8:62565319-62565341 ATATGCACATACATATATATTGG - Intronic
1042433432 8:68735480-68735502 CTTTGCAAAGACATTTATATTGG + Intronic
1043219235 8:77637554-77637576 ATGTGTATATATATGTATATGGG + Intergenic
1043842997 8:85130876-85130898 CTTTGTAAATACACTTTTATTGG - Intronic
1045039083 8:98203874-98203896 GTGTGTACATACACATATGTAGG + Intronic
1045747861 8:105444940-105444962 ATATTTACATACATTTATATTGG - Intronic
1046336105 8:112789492-112789514 CAGTGTTCATACAATTAGATTGG - Intronic
1046500571 8:115071075-115071097 GTGTGTATATATATATATATGGG - Intergenic
1047580974 8:126214822-126214844 TTGTCAACATACATTTATCTTGG + Intergenic
1050003705 9:1105412-1105434 ATGTGTATATACGTATATATGGG - Intergenic
1050216077 9:3325505-3325527 TTATGTATATACATTTAAATGGG - Intronic
1051378038 9:16424629-16424651 GTGTGTACATATATGTATATGGG + Intronic
1051494009 9:17698488-17698510 CTGTGTGAATATGTTTATATTGG + Intronic
1052477392 9:28977661-28977683 CTGTATACATACATGTAAAATGG + Intergenic
1052895657 9:33745834-33745856 CTATGTGCCTACTTTTATATTGG - Intergenic
1054841043 9:69740179-69740201 GTGTATACATATATGTATATAGG + Intronic
1054992940 9:71351514-71351536 CTGTTGACAGACATTTAAATTGG - Intronic
1057753745 9:97812863-97812885 ATATGTACACACATATATATAGG + Intergenic
1057996876 9:99827286-99827308 GTGTGTATATATATATATATGGG + Intronic
1058306640 9:103451316-103451338 ATGTGTATATATATATATATAGG - Intergenic
1059369259 9:113812456-113812478 TTGTGTTCATGCATTTATAAAGG - Intergenic
1185775028 X:2795596-2795618 ATGTGTATATATCTTTATATAGG + Intronic
1185919216 X:4070638-4070660 CTGAGTACAGTCATTGATATAGG - Intergenic
1186085159 X:5980245-5980267 ATGTATGCATACATTTATACTGG + Intronic
1186671958 X:11776517-11776539 GTGAGCACAGACATTTATATAGG + Intergenic
1187140522 X:16588719-16588741 GTGTGTACAGGCATTTATTTTGG + Exonic
1188606672 X:32039968-32039990 CTGTGAATATATATTTATATAGG - Intronic
1189269551 X:39741357-39741379 CTGTATACATATATGTGTATGGG + Intergenic
1190589671 X:51987024-51987046 TTGTGTATATATATTTATAATGG + Intergenic
1191751795 X:64550369-64550391 CTGAATGCATACATTAATATTGG - Intergenic
1192052327 X:67735976-67735998 CTGTATACATATTTTGATATGGG + Intergenic
1192982984 X:76366961-76366983 CTCTATGCATGCATTTATATGGG + Intergenic
1193647832 X:84089978-84090000 CTTTGAACATACATGAATATAGG + Intronic
1193998282 X:88393605-88393627 CAGTTTACAGACATTTAAATAGG - Intergenic
1194333262 X:92612581-92612603 TTCTGTATATACATGTATATTGG + Intronic
1195131114 X:101853581-101853603 GTGTGTGCATGTATTTATATTGG + Intronic
1195240915 X:102950969-102950991 TTGTGTGCATCCATTTATCTAGG - Intergenic
1196492429 X:116283939-116283961 GTGTGTATATATATATATATAGG - Intergenic
1197136260 X:123063462-123063484 CTGTGTAAATAAATATATATGGG - Intergenic
1198578745 X:138039697-138039719 CAGTTTATATACATTTTTATAGG - Intergenic
1199134277 X:144232484-144232506 TTGTGCCCTTACATTTATATTGG + Intergenic
1199150330 X:144477061-144477083 ATGTATACATATATTTATAAAGG + Intergenic
1200641945 Y:5731608-5731630 TTCTGTATATACATGTATATTGG + Intronic
1200786949 Y:7269157-7269179 GTGTGTATATATATATATATGGG - Intergenic
1201295334 Y:12457840-12457862 ATGTGTATATATCTTTATATAGG - Intergenic
1201707987 Y:16957827-16957849 CTGCGTACATCCATTTAAATGGG - Intergenic
1201736842 Y:17273254-17273276 ATATGTATATATATTTATATAGG + Intergenic