ID: 961985033

View in Genome Browser
Species Human (GRCh38)
Location 3:131122837-131122859
Sequence CCTGATGGGGAGATGGAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 392
Summary {0: 1, 1: 0, 2: 4, 3: 45, 4: 342}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961985021_961985033 11 Left 961985021 3:131122803-131122825 CCTAGCATGGGCCCTGGATGCTG 0: 1
1: 0
2: 3
3: 31
4: 304
Right 961985033 3:131122837-131122859 CCTGATGGGGAGATGGAGATGGG 0: 1
1: 0
2: 4
3: 45
4: 342
961985025_961985033 0 Left 961985025 3:131122814-131122836 CCCTGGATGCTGGGGAAGAATGA 0: 1
1: 0
2: 1
3: 32
4: 318
Right 961985033 3:131122837-131122859 CCTGATGGGGAGATGGAGATGGG 0: 1
1: 0
2: 4
3: 45
4: 342
961985026_961985033 -1 Left 961985026 3:131122815-131122837 CCTGGATGCTGGGGAAGAATGAC 0: 1
1: 0
2: 1
3: 21
4: 223
Right 961985033 3:131122837-131122859 CCTGATGGGGAGATGGAGATGGG 0: 1
1: 0
2: 4
3: 45
4: 342
961985017_961985033 29 Left 961985017 3:131122785-131122807 CCACAGACTGTTCTTCATCCTAG 0: 1
1: 0
2: 0
3: 11
4: 212
Right 961985033 3:131122837-131122859 CCTGATGGGGAGATGGAGATGGG 0: 1
1: 0
2: 4
3: 45
4: 342

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961985033 Original CRISPR CCTGATGGGGAGATGGAGAT GGG Intronic
900144584 1:1152499-1152521 CCTGATGGGATGATAGAGCTGGG - Intergenic
900144601 1:1152585-1152607 CCTGATGGGATGATAGAGCTGGG - Intergenic
900144780 1:1153402-1153424 CCTGATGGGATGATAGAGCTGGG - Intergenic
900144798 1:1153488-1153510 CCTGATGGGATGATAGAGCTGGG - Intergenic
900149588 1:1172247-1172269 CCTGAGAGGGAGGTGGAGAGAGG - Intergenic
900292672 1:1930082-1930104 ACTGAGGGCGAGATGGTGATAGG + Exonic
900703568 1:4062471-4062493 ACAGATGGGGAGAAAGAGATGGG - Intergenic
901004630 1:6165848-6165870 TTTGATGGGGAAGTGGAGATAGG - Intronic
901200909 1:7466958-7466980 CTTGCTGGTGAGATGGAGAAAGG - Intronic
902198461 1:14815789-14815811 CCTGATGTGGATATGGAGCTGGG - Intronic
902245445 1:15117721-15117743 TCTGATGGGAAGAGGGAGGTGGG - Exonic
902391789 1:16111211-16111233 CCTGAGTGGGAGATGGAGGGAGG - Intergenic
903405129 1:23089435-23089457 CTTGATGGGGAGCTGAAGAGAGG + Intronic
903576494 1:24342672-24342694 CCTGCAGGGGAGAAGGAGAGAGG - Exonic
903577335 1:24346935-24346957 TCTGATGGGGAGTGGGAGAAGGG + Intronic
903653471 1:24934831-24934853 TGTGATGGGGAGAGGGAGCTGGG + Intronic
904043769 1:27598636-27598658 CCCTATGGGTAGATGGAGGTGGG - Intronic
904318751 1:29682844-29682866 CCTGCTGGAGGGATGGAGAAGGG - Intergenic
904906296 1:33899684-33899706 CCTGCTGGGAACATGCAGATTGG - Intronic
905020813 1:34810089-34810111 ACTGATGGGAAGATGGAATTAGG - Intronic
906317615 1:44798504-44798526 ACTGAGGGGGAGTTGGGGATAGG - Intergenic
909996156 1:82282160-82282182 ACTGATGGGGAGAGTGAGAAAGG + Intergenic
912438945 1:109683520-109683542 CCTGATATGTAGTTGGAGATGGG + Intronic
912441467 1:109701965-109701987 CCTGATATGTAGTTGGAGATGGG + Intronic
912474298 1:109925771-109925793 CCTGTTGGGGACATGGAGAGGGG - Intronic
912715953 1:111983670-111983692 GATGGTGGGCAGATGGAGATGGG - Intronic
913351767 1:117869151-117869173 CGTGATGGGGTGAGGAAGATGGG + Exonic
913500833 1:119471269-119471291 CCTGAGGAGGAGATGGAGCAAGG + Intergenic
914259197 1:145984797-145984819 GCTGGTGGGGAGATGGACTTAGG - Intergenic
914831422 1:151173615-151173637 CCTGATGGGGAGATGAAGGATGG + Exonic
915267988 1:154732360-154732382 CCTGCTGGGCACCTGGAGATGGG + Intronic
915461625 1:156073948-156073970 CCTGAGGGGGAGGGGGAGAGGGG + Exonic
915872594 1:159576858-159576880 CATGATGGAGGGCTGGAGATGGG - Intergenic
916065669 1:161133556-161133578 GCGGATGGGGAGATACAGATTGG + Intergenic
917734086 1:177904695-177904717 CTTCATGGGGACATGGAGGTAGG - Intergenic
917900898 1:179542331-179542353 GCTGAGGGGCAGGTGGAGATAGG - Intronic
918421911 1:184372918-184372940 GATGATGGTGAGATGGAGAATGG + Intergenic
920703063 1:208232232-208232254 CCGGCTGGGGAGAGGGAGACTGG - Intronic
921196581 1:212763021-212763043 CCTTATGGGCATATGGAGAAAGG + Intronic
922857361 1:228786380-228786402 TGTGATGGGGAGAGTGAGATAGG - Intergenic
922897920 1:229114852-229114874 CCTGAAGATGAGATGGAGAATGG - Intergenic
922937938 1:229435105-229435127 CCTGGAGTGGAGGTGGAGATGGG + Intergenic
923097541 1:230787614-230787636 CCTGGTGGGGAGATGGAAGTGGG - Intronic
923384475 1:233453002-233453024 TCTTATGGGGAGATGGAGAGGGG - Intergenic
923902040 1:238336553-238336575 CCTGAAAGAGAGTTGGAGATTGG + Intergenic
923976534 1:239270726-239270748 CCTGATCAGGAGAAGGAGGTAGG - Intergenic
924602169 1:245500769-245500791 CCTGATGGCGAGATGCTGAATGG + Intronic
1062906831 10:1185039-1185061 CCTGTCGGGGAGATGGGGAAAGG + Exonic
1063661517 10:8037559-8037581 CCGGAGGGGGAGAGGGAGAAAGG - Intergenic
1067095275 10:43295486-43295508 CCTGAAGGGGAGATGGTGAGGGG - Intergenic
1073190006 10:101644366-101644388 CCTGTTTGGAAGATGCAGATTGG - Intronic
1073253954 10:102139213-102139235 GCTGCTGGGGAGGTGGGGATTGG - Exonic
1073525915 10:104181890-104181912 CCTAATTGGGGGTTGGAGATGGG - Intronic
1074719928 10:116255767-116255789 GCTGCTGGGGAGATGGTGGTGGG - Intronic
1075231096 10:120679039-120679061 TCTTATGGGCAGATGGTGATGGG - Intergenic
1075659030 10:124180625-124180647 TGTGATGGAGAGATGGTGATGGG - Intergenic
1075843047 10:125520638-125520660 ATTGATGAGGAGATGGAGTTTGG + Intergenic
1075849514 10:125575556-125575578 CCTGTTGGGGAGTAGGAGGTAGG - Intergenic
1076394425 10:130128783-130128805 TGGGATGGGGAGTTGGAGATGGG - Intergenic
1076883235 10:133249579-133249601 CCTGGTGGGGACATGGGGCTGGG + Intergenic
1077506121 11:2930706-2930728 CCTGAAGGGCAGGTGGAGGTAGG - Intergenic
1077913407 11:6594331-6594353 CCTGGTGGCCAGATGGAGATGGG - Intergenic
1078354129 11:10621520-10621542 CGTGTTGGGGAGATGCAAATGGG - Intronic
1080782222 11:35440245-35440267 CCTGATTGGGAAAGTGAGATGGG - Intronic
1080838117 11:35959311-35959333 TCTGATTGGGAGTTGAAGATGGG - Intronic
1083164958 11:60878408-60878430 CCTTTTGGGGAGGTGGGGATGGG + Intergenic
1084427512 11:69093726-69093748 CCTCTTGGGGAAATGGGGATGGG + Intergenic
1084525750 11:69697065-69697087 CTTGATTGGCAGATGGAGACAGG + Intergenic
1084625412 11:70302419-70302441 CCTCGTGGGAGGATGGAGATGGG + Intronic
1085052974 11:73389175-73389197 CCTTATGGTGAGCTGGGGATGGG + Exonic
1085921348 11:80961303-80961325 CATGATGGGAATATGGAGATGGG + Intergenic
1087448919 11:98292523-98292545 CATTATGGGGAGATGGAGTTTGG - Intergenic
1088385634 11:109251928-109251950 CCTGATGGGAATGTGGAGAAAGG - Intergenic
1089255256 11:117190601-117190623 CCTGTTGGGGAGAGAGAGAAGGG - Exonic
1091320654 11:134646924-134646946 GGTGCTGGGGAGATGGAGGTGGG + Intergenic
1091678788 12:2511255-2511277 CTTTATGGTGAGATGGAGTTGGG - Intronic
1091758071 12:3068516-3068538 GCTACTTGGGAGATGGAGATGGG - Intergenic
1092225380 12:6745013-6745035 CAGGATGGGGAGATAAAGATGGG - Intergenic
1092937712 12:13379467-13379489 CGTGCTGGAGAGATGGAAATGGG + Intronic
1093859419 12:24144978-24145000 GCTGCTTGGGAGGTGGAGATGGG + Intergenic
1095228692 12:39707365-39707387 GCTGATGAGGATATGGAGAAAGG + Intronic
1095369176 12:41445949-41445971 GCTGGAAGGGAGATGGAGATGGG - Intronic
1097101919 12:56595869-56595891 CCTGAGGGGGAGACGGCGTTGGG - Exonic
1097518871 12:60643731-60643753 CCTGATGGGGGGAATGATATAGG - Intergenic
1098060038 12:66552190-66552212 CCTGAAAGGGAAATGGAGAAAGG + Intronic
1098336881 12:69413516-69413538 ATTGACGGGGGGATGGAGATGGG - Intergenic
1099133689 12:78865545-78865567 TCTGTTGGGGAGAGGGATATGGG + Intronic
1101319248 12:103658784-103658806 CTTGCTGGGGACATGGTGATGGG + Intronic
1102029942 12:109734485-109734507 GCTGCTGGGGAGGTGGAGACGGG - Intronic
1102279436 12:111607414-111607436 CCTGAGGGGGCGATGGAGCTGGG - Intergenic
1102672064 12:114628581-114628603 CTTTGTGGGGAGATTGAGATAGG + Intergenic
1102765417 12:115428635-115428657 ACTGTTGGGGACATGGAGCTAGG + Intergenic
1103038465 12:117675364-117675386 CCTGATTTGCAGATGGAGACTGG - Intronic
1103373681 12:120438493-120438515 CCTGATGCGGAGATGGGGGTAGG - Exonic
1103820594 12:123694706-123694728 CATGTTAGGGAGCTGGAGATAGG + Intronic
1105531394 13:21224024-21224046 GCTGCTGGGGAGGCGGAGATGGG - Intergenic
1105601428 13:21891873-21891895 CCTGAAGGGAAGAGGGAGCTGGG + Intergenic
1106205811 13:27593246-27593268 CGTGATGGGGAGAAAGAGATTGG - Intronic
1106706893 13:32290485-32290507 CCTGATGGGAAGAAAGAGAAAGG + Intronic
1107966777 13:45604404-45604426 CCTGACGGATGGATGGAGATGGG - Intronic
1110702024 13:78559988-78560010 CCTATTGGGCATATGGAGATAGG - Intergenic
1110827477 13:79989506-79989528 CCTAATGGGGAGAGGGACAAGGG - Intergenic
1113076649 13:106473581-106473603 CCTGATGGGGAGACGGGGTCTGG - Intergenic
1113321953 13:109242529-109242551 CCTGGTGGGCAGGTGGTGATTGG + Intergenic
1114055728 14:18965820-18965842 ACTGATGGGGAGATGCAGAAAGG - Intergenic
1114106819 14:19435944-19435966 ACTGATGGGGAGATGCAGAAAGG + Intergenic
1116791772 14:49346942-49346964 CCTGAGGGGCAGAAGGAGAAGGG - Intergenic
1117353216 14:54901427-54901449 CAAGATGGGGTGATGGAGAGTGG - Intronic
1117983250 14:61362843-61362865 CCTGAAGGGGATGTGGACATTGG + Intronic
1118792560 14:69108453-69108475 CCTTATGGAGAGACGGAAATGGG + Intronic
1118812527 14:69285758-69285780 CCTGAGGGACAGATGGAGAGGGG - Intronic
1119051629 14:71375339-71375361 ACTCATGGGCAGATGGATATTGG - Intronic
1119545720 14:75469942-75469964 CCTGATGCGAAGCTGGAGAGGGG + Exonic
1119705176 14:76778883-76778905 TCTGTTAGGGAGATGGAGTTGGG - Intronic
1120483130 14:85077500-85077522 CCTGTTGGGGGGATGGGGAGAGG - Intergenic
1120886011 14:89452371-89452393 CGTGCTGGGGAGATGGGGATGGG - Intronic
1121627711 14:95398707-95398729 CCTGCTGGGGAGCTGGTCATAGG + Intergenic
1122298422 14:100718416-100718438 CGGGATAGGGACATGGAGATGGG - Intergenic
1122666463 14:103333885-103333907 CTTGAGGGGGAGATGGTGGTTGG - Intronic
1202891244 14_KI270722v1_random:160063-160085 ATTGATAGGGAGATGGAGACAGG + Intergenic
1123499588 15:20867422-20867444 ACTGATGGGGAGATGCAGGAAGG + Intergenic
1123556840 15:21441152-21441174 ACTGATGGGGAGATGCAGGAAGG + Intergenic
1123593063 15:21878388-21878410 ACTGATGGGGAGATGCAGGAAGG + Intergenic
1124075398 15:26439107-26439129 CCTGGTAAGGAGAGGGAGATGGG - Intergenic
1127331276 15:57942582-57942604 TTTGATGGGGAGAAGGAGCTAGG - Intergenic
1128330215 15:66750788-66750810 CCTTATGGGGTGAGGGAGCTGGG + Intronic
1129063763 15:72883672-72883694 TGAGATGGGGAGATGGAGGTGGG - Intergenic
1129384037 15:75185843-75185865 ACTGAGGGGGAGATGGAGAACGG + Intergenic
1129542156 15:76359216-76359238 CCTTATGGAGAGATGGGGCTGGG - Intronic
1130137890 15:81197074-81197096 CCTGCTGGGCAGATGGAGAGAGG + Intronic
1130841713 15:87706953-87706975 ACTGATGAGGAGATGGTGTTAGG - Intergenic
1131220784 15:90582266-90582288 CCAGGTGGGGAGGTGGGGATGGG + Intronic
1131740979 15:95390972-95390994 GCTACTTGGGAGATGGAGATTGG + Intergenic
1202965183 15_KI270727v1_random:168341-168363 ACTGATGGGGAGATGCAGGAAGG + Intergenic
1132519007 16:378891-378913 CCTGGTGCGGGGATGGAGAAGGG + Intronic
1132729532 16:1354648-1354670 CCTGATGTGGGGATGGGGGTGGG - Intronic
1135685994 16:24498793-24498815 TTTGATGGTGAGGTGGAGATTGG - Intergenic
1136028267 16:27484065-27484087 TCTGCTGGGGAGATGGACCTTGG - Intronic
1137357797 16:47783339-47783361 CCAGATGGGGAGCTGGAGAGTGG - Intergenic
1137518925 16:49175107-49175129 TGGGATGGGGAGATGGAGGTAGG - Intergenic
1137518943 16:49175208-49175230 TGGGATGGGGAGATGGAGGTAGG - Intergenic
1138453247 16:57106168-57106190 CCAGAGGGTGAGTTGGAGATGGG + Intronic
1138482874 16:57315604-57315626 CCAGCTGGGGAGATGTAGAGAGG - Intergenic
1138582832 16:57952807-57952829 CCTGCTGCGGAGATGGAAAGAGG - Intronic
1138843490 16:60537879-60537901 CCTGAAGGGGACAGGGAGAATGG - Intergenic
1139350559 16:66332481-66332503 GCTGATGGGGTGATGGGGATGGG - Intergenic
1139673877 16:68509821-68509843 CCTGATGGGGAGCTGTTGCTTGG + Intergenic
1140699185 16:77565596-77565618 TCTGGTGTGGAGGTGGAGATAGG - Intergenic
1141141446 16:81499382-81499404 TCTGAAAGGGAGCTGGAGATTGG - Intronic
1141574204 16:84953711-84953733 CCGGGTGGAGAGATGGAGACGGG + Intergenic
1141587686 16:85045861-85045883 CCAGATGGGCAGATGGAAGTGGG - Intronic
1143114490 17:4574975-4574997 CCTGATGGTGGGCTGGGGATGGG - Intergenic
1144685421 17:17222962-17222984 CCAGAAGGGGAGGTGGAGACAGG - Intronic
1144890150 17:18489800-18489822 CCTCATGGGCATAGGGAGATGGG - Intronic
1145019347 17:19417372-19417394 ACAGATGGGAAGAGGGAGATTGG + Intergenic
1145043770 17:19596281-19596303 CCTGATGTGGAGTTGGTGCTAGG + Intergenic
1145142066 17:20454517-20454539 CCTCATGGGCATAGGGAGATGGG + Intronic
1145808654 17:27751962-27751984 CCTCATGGGCATAGGGAGATGGG - Intergenic
1145994146 17:29096018-29096040 CCAGCTGGGGAGATGGTGGTTGG + Intronic
1146833007 17:36086043-36086065 CCTGATAGGGAACTGGAGAATGG - Intergenic
1147135026 17:38429303-38429325 CCTGATGGGGGGATGGGGCTGGG - Intronic
1147381224 17:40057355-40057377 GCTGCTCGGGAGATGGAGGTAGG + Intronic
1148134357 17:45282790-45282812 CCTGATTAGGAGATGGGGACCGG - Intronic
1148281861 17:46354489-46354511 CCGGATGGAGAGAGGGAGAGTGG - Intronic
1148304086 17:46572428-46572450 CCGGATGGAGAGAGGGAGAGTGG - Intronic
1148966163 17:51437856-51437878 CCTGGGAGGGAGATGGAGAAGGG + Intergenic
1149391459 17:56195647-56195669 CTTGATGAGGAGAAGGAAATGGG - Intronic
1151499178 17:74478028-74478050 GCGGATGGGGAGAGGGAGGTGGG - Intronic
1151501278 17:74490863-74490885 CCTGAAGCGGAGATGGGGAGGGG + Intergenic
1151557608 17:74854542-74854564 GGTGATGGGGAGATGGTTATGGG - Intronic
1152579541 17:81159964-81159986 CCCGAGGGTGAGATGGGGATAGG + Intronic
1153188837 18:2516083-2516105 CCAGATGTGGTCATGGAGATTGG + Intergenic
1153245070 18:3065574-3065596 CCTGCTGGGGAGCTAAAGATGGG - Intergenic
1153917490 18:9758799-9758821 CCTCATGGGGAGATAGACAGGGG - Intronic
1154457645 18:14544297-14544319 ACTGATGGGGAGATGCAGGAAGG + Intergenic
1155385753 18:25275646-25275668 GCTGATGGGGAGAAGGAAAGAGG - Intronic
1158256993 18:55562552-55562574 ACTGCTGGGGAGATAGAGAGGGG - Intronic
1158447346 18:57532846-57532868 CCTGATAGGGAGATGGAGAGAGG - Intergenic
1160127469 18:76189601-76189623 CAGGATGGGGAGATGGAAAGTGG - Intergenic
1160899320 19:1419292-1419314 CCTGGTGGGGCGGTGCAGATGGG + Intronic
1161251769 19:3284628-3284650 CGGGATAGGGAGAGGGAGATGGG + Intronic
1161636220 19:5390898-5390920 AGTAATGGGGAGATGGAGAGGGG - Intergenic
1162015200 19:7841759-7841781 CAGCATAGGGAGATGGAGATGGG + Intronic
1162877005 19:13627852-13627874 ACTGATGTGGAGATGAAGCTTGG - Intergenic
1163592787 19:18203814-18203836 ACTGATGGGCTGATGGAGGTGGG - Intronic
1164529949 19:29041047-29041069 CCTGACGGGCAGGTGGAGACAGG + Intergenic
1165143887 19:33719365-33719387 CTTGCTGGGGAGATGGGGACTGG + Intronic
1165259444 19:34599317-34599339 ACAGATGGGGAGAAGGAGAAAGG - Intronic
1166091137 19:40509897-40509919 CCTGGAGGTGAGATGGGGATGGG - Intronic
1166313980 19:41978405-41978427 GCTGATGGGGAGATGGAATGCGG - Intronic
1167284574 19:48591788-48591810 CCTGATGGGCAGAGGGACAGAGG + Intronic
1168105390 19:54162973-54162995 CCTGAAGGAAAGATGGAGCTGGG - Intronic
1202666665 1_KI270708v1_random:126901-126923 ATTGATAGGGAGATGGAGACAGG + Intergenic
925194021 2:1908712-1908734 GCTGATGGGGAGAGGGAGGGTGG + Intronic
925713850 2:6767519-6767541 CCTGATGGGGATTTGGGGAAGGG - Intergenic
926546193 2:14243232-14243254 TCTGATGGGAAAATGGTGATGGG - Intergenic
926929590 2:18023701-18023723 TCTGCTGGGGAAATGGAGAAAGG - Intronic
927557494 2:24046106-24046128 CCTGTTGGGGAGGTGGGGGTGGG + Intronic
928246033 2:29627661-29627683 CTTGAAGGGGAGATGGGGGTGGG + Intronic
929802589 2:45117087-45117109 GCTGCTGGTGAGATGGGGATGGG + Intergenic
929804244 2:45130721-45130743 CTTGAAGGGGAGATGGACAAGGG + Intergenic
932687165 2:73881404-73881426 AGTGATGGGGAAATGGAGAAAGG - Intergenic
932941791 2:76175293-76175315 CATGATGGAGTGATGGAAATAGG - Intergenic
934762333 2:96863618-96863640 CCAGATGGAGAGAGTGAGATGGG + Intronic
935027077 2:99287101-99287123 GCTGATGGGGAGAGGGAAACTGG + Intronic
936521284 2:113213360-113213382 GGTGATGGGGAGAGGGAGAAGGG + Intergenic
937080055 2:119134488-119134510 ACTGATGGGGAGAAGGAAACTGG - Intergenic
938214621 2:129500681-129500703 CCTGCAGTGCAGATGGAGATAGG - Intergenic
938473906 2:131590421-131590443 TCTGATGGGGAGATGCAGAAAGG - Intergenic
939304965 2:140400221-140400243 CCTGATGGGGACTTCCAGATTGG - Intronic
940790105 2:158023108-158023130 CCTGATTGGGAGGTGGGGGTGGG + Intronic
941072652 2:160971662-160971684 GATGAGGGGGAGATTGAGATTGG + Intergenic
941416296 2:165225540-165225562 CCTTAGGAGGAGATGGAGAGAGG + Intergenic
942213376 2:173693886-173693908 CCTGTTGGGGGGATGGGGTTGGG - Intergenic
943663371 2:190583179-190583201 CTTGATGGGCAGAAGGAGAGAGG + Intergenic
944666379 2:201962734-201962756 GGTGATGGGGAGGTGGGGATGGG + Intergenic
944831440 2:203536918-203536940 CCTGTTGGGGGGATGGAGAGGGG + Intergenic
945065401 2:205943968-205943990 ACAGATGGAGAAATGGAGATAGG - Intergenic
946250216 2:218406817-218406839 CACGATGGGGAGGTGGAGCTGGG - Intergenic
946628429 2:221640397-221640419 GCTGATGAGGATATGGAGAAAGG - Intergenic
947138005 2:226994254-226994276 GATGCTGGGGAGAGGGAGATAGG + Intronic
947524314 2:230869139-230869161 CCTCATGGGGAGAGGGAACTTGG - Intronic
948320042 2:237061699-237061721 CAAGATGGGGAGATGGAGGAAGG + Intergenic
948550884 2:238772487-238772509 CTTGATGGGAAGGTGGAGATGGG + Intergenic
1170763737 20:19273418-19273440 CCTGATGGAGAAAGGGAGAGGGG - Intronic
1171736548 20:28792869-28792891 CCTGAAAGTGATATGGAGATTGG - Intergenic
1172476080 20:35238790-35238812 CCGGTTGGAGAGATGGAGAGTGG - Intronic
1172772213 20:37388375-37388397 GCTGATTGGGAGATGGGGGTGGG + Intronic
1174230142 20:49039718-49039740 ATTGATGGGGAGATGGGGAGGGG - Intergenic
1174443416 20:50574347-50574369 CCTCATGGGGAGATGGGGGTGGG - Intronic
1175990291 20:62785324-62785346 CCGGGTGGGGAGATGGAGGGTGG + Intergenic
1176159153 20:63639938-63639960 CTTGGTGGGGAGAGGGAGATGGG + Exonic
1176343203 21:5716970-5716992 CCTGATGGGGCTATAGAGGTGGG - Intergenic
1176475457 21:7149121-7149143 CCTGATGGGGCTATAGAGGTGGG - Intergenic
1176501624 21:7607486-7607508 CCTGATGGGGCTATAGAGGTGGG + Intergenic
1176537524 21:8115039-8115061 CCTGATGGGGCTATAGAGGTGGG - Intergenic
1176816512 21:13609041-13609063 ACTGATGGGGAGATGCAGGAAGG - Intergenic
1177630649 21:23723257-23723279 TCTGATGGGGTGGTGGGGATGGG + Intergenic
1177917145 21:27102951-27102973 TCTGGTGTGGACATGGAGATGGG + Intergenic
1178376265 21:32070097-32070119 CCTAATGGGAAAATGGAGAATGG - Intergenic
1179033046 21:37736657-37736679 CCCGATGGGGAGATGGAGAGAGG + Intronic
1180474205 22:15688371-15688393 ACTGATGGGGAGATGCAGAAAGG - Intergenic
1181065421 22:20303455-20303477 CCTGGTGGGGAGGAGGAGGTCGG + Intergenic
1181170616 22:21007150-21007172 GCTAATGGGGAGGTGGAGGTGGG - Intergenic
1181778661 22:25177887-25177909 CTTGGTGGGGAGAGGGAGATGGG + Intronic
1182072829 22:27475593-27475615 CCTGATGGGGGGAAGGACAGGGG + Intergenic
1182277533 22:29200166-29200188 CCTGAGGGGGACAGGGAGACTGG + Intergenic
1182413003 22:30202931-30202953 CCTGAGGTGGAGAAGGAGCTTGG + Intergenic
1182748258 22:32622264-32622286 CCAGAGGAGGAGGTGGAGATGGG - Intronic
1183407616 22:37638240-37638262 CCTGTTGGGAAAAGGGAGATGGG + Intronic
1183658947 22:39207152-39207174 CCTCCTGGGGAGATGGGGCTTGG + Intergenic
1184205348 22:42998956-42998978 CAGGATGGGGAGCTGGAGATGGG - Intronic
1184944570 22:47794038-47794060 GCTGATGGGGAGATGGGCAAGGG - Intergenic
1185190466 22:49433096-49433118 CCTGCCGGGGAGAGGGAGTTGGG + Intronic
1203242468 22_KI270733v1_random:31395-31417 CCTGATGGGGCTATAGAGGTGGG - Intergenic
949606024 3:5654787-5654809 TTTGATGGAGAGATGGAGAGGGG + Intergenic
949677596 3:6474609-6474631 ACTGATGGGAAGGAGGAGATGGG - Intergenic
950167808 3:10814907-10814929 CTTTCTGGGGAGATGGAGGTTGG + Intergenic
950722434 3:14892883-14892905 CCTGATGGGGAGCTGGACTATGG - Intronic
950812125 3:15659011-15659033 CCTGATGGGGAACTGGACATGGG - Intergenic
952857519 3:37784434-37784456 CCTGATGGAGAGATGGGGAAGGG - Intronic
952909610 3:38171159-38171181 CCTGTTGGGAAAATGGAGAGAGG - Intronic
954871614 3:53771533-53771555 CCTGCTGGGGAGAATGAGGTTGG + Intronic
955064473 3:55522730-55522752 CCTGAGTGGGAGCTGGAGATGGG - Intronic
957089225 3:75712709-75712731 ATTGATAGGGAGATGGAGATAGG - Intronic
959570883 3:107882492-107882514 TCTGATGGGGACATGCAGATTGG + Intergenic
960057436 3:113285334-113285356 CCAGATGGGGAGGTGGGGCTGGG - Intronic
961578414 3:127857414-127857436 TCTGGTGGGGTGGTGGAGATTGG + Intergenic
961985033 3:131122837-131122859 CCTGATGGGGAGATGGAGATGGG + Intronic
962010676 3:131387518-131387540 CCTGATGCACAGATGCAGATTGG + Intronic
963017533 3:140840131-140840153 CCTGTTGATGAGATGGAGAAAGG + Intergenic
963956483 3:151260065-151260087 ACTGCTGGGGATATGGTGATGGG + Intronic
964063931 3:152558686-152558708 CCTGATGGAGTCATGCAGATAGG + Intergenic
964821186 3:160771788-160771810 CCAGATGGGAATATAGAGATGGG + Intronic
965205953 3:165719470-165719492 CCTAATGGGCAGTTGGGGATGGG + Intergenic
965962641 3:174446896-174446918 TCTGATGAGAAGATGAAGATAGG + Intronic
966470408 3:180282649-180282671 GCAGATGCTGAGATGGAGATAGG - Intergenic
966607823 3:181839180-181839202 CCAAATGGGGAGATGGGGGTGGG + Intergenic
969863516 4:10056326-10056348 ACTGCTGGGGAGGTGGAGGTGGG + Intergenic
969935128 4:10672805-10672827 GGTGCTGGGTAGATGGAGATGGG - Intronic
970255290 4:14162426-14162448 CAAGTTGGGGTGATGGAGATTGG + Intergenic
970373691 4:15434662-15434684 GCTGAAGGTGAGATGGAGAGTGG - Intronic
970815917 4:20156081-20156103 CCCGAAGGGGAGCTGGATATGGG - Intergenic
970870974 4:20816501-20816523 CCTGCTGGGGATAAGGAAATTGG - Intronic
971265806 4:25095489-25095511 GCTGCTGGGGAGATGGAGTGAGG - Intergenic
971307519 4:25496603-25496625 CCTGAGGTGAAGATGGAGAATGG + Intergenic
972256144 4:37357862-37357884 TCTGAAGGGGAGATGGAAAGAGG + Intronic
973896118 4:55414834-55414856 CCTGATGGTTAGATTGAGGTAGG + Intronic
974074575 4:57157048-57157070 GCTGATGCTGAGATGGAGTTTGG + Intergenic
976861215 4:89669338-89669360 ACTGGTGGGGATATGGAGAAAGG - Intergenic
978072427 4:104490677-104490699 CCTGAAGGGGAGAGGGAGTGAGG + Intronic
978077988 4:104557070-104557092 ACGGATGGGTGGATGGAGATGGG + Intergenic
978437073 4:108697198-108697220 CCTAGTGGGGAAATGGAGACAGG + Intergenic
978826842 4:113034742-113034764 CATGATGGGGAAATGTAGTTTGG + Intronic
980437069 4:132791099-132791121 GCTGGTGGGGTAATGGAGATTGG - Intergenic
981854700 4:149274337-149274359 CCTACTGGGGAGATGTAGAGTGG + Intergenic
981989992 4:150907174-150907196 ACTGATGTGGAGGAGGAGATTGG - Intronic
983098107 4:163589784-163589806 CCTGATGGGAAGTTGGGGCTTGG + Intronic
984413027 4:179419920-179419942 CCTCATGGGGAGGTGCAGTTAGG - Intergenic
985692223 5:1319702-1319724 CCTGGTCGGGGGAGGGAGATGGG + Intronic
985819807 5:2151872-2151894 CCTGTTGGGGAGCTGGGGAAAGG + Intergenic
988437285 5:31191204-31191226 CCTGAGGAGGAGATAGAGCTAGG + Intergenic
989130928 5:38106004-38106026 CCTGCCAGGGTGATGGAGATAGG + Intergenic
989687809 5:44110071-44110093 CCTGAAGGGGAGCTGGAAAGGGG - Intergenic
991114090 5:62934055-62934077 CATGATGGGGAGAGGCAAATGGG + Intergenic
992031328 5:72724358-72724380 ACTGATGGGGAGGTGAAGACCGG - Intergenic
992269447 5:75051043-75051065 CCTGAGGGGAGGATGGAGAATGG - Intergenic
993501632 5:88673220-88673242 CCTTCTGGGGAGAGGGAGAAGGG + Intergenic
993983882 5:94574063-94574085 CCCTATGGGCAGATGGAGATAGG + Intronic
995060962 5:107811450-107811472 CCTGATGGCAAGTTGGAAATGGG + Intergenic
997067673 5:130581136-130581158 CCTGAAGGGGACAGGGAGAATGG + Intergenic
997235963 5:132272003-132272025 CCTGATGGGGGGAACGAGACAGG - Exonic
998298874 5:140999171-140999193 CCTGATGGGGAGAGGGTCCTTGG + Intronic
998762290 5:145445868-145445890 GCTGGTGGGGATATGGAGAAGGG + Intergenic
999290501 5:150422337-150422359 CCTGATGGGGAGATGGAGTAAGG + Intergenic
999730755 5:154475432-154475454 CCAGATAGGGAAATGGAGATAGG + Exonic
1000461715 5:161530025-161530047 CCAGAGAGGGAGATGGAGAGAGG - Intronic
1001642149 5:173252137-173252159 CCTCAGGGGGAGATGGAGTCAGG + Intergenic
1002761952 6:209291-209313 CTTGATGGGGAGCTGGTGCTCGG - Intergenic
1003957170 6:11174622-11174644 GGAGATGGGGAGATGCAGATAGG - Intergenic
1004628900 6:17402995-17403017 CATAATGAGGAGATGGAAATGGG - Intronic
1006082670 6:31576512-31576534 ACTGTTGGGGAGAAGGAGAATGG - Exonic
1006087052 6:31603516-31603538 CCTGAGGGGGAGATGTAGATTGG - Intergenic
1006843241 6:37045077-37045099 CCTGATGCGGAGATGGGGGTAGG - Exonic
1007180464 6:39925911-39925933 CCTGATGGAGAGTTGGGGAGTGG - Intronic
1007246404 6:40466358-40466380 CCAGATGGGGAAATGAAGCTTGG + Intronic
1008191794 6:48467807-48467829 GCTGTTTGGGAGATGGAGATGGG + Intergenic
1009942198 6:70302866-70302888 AGTGGTGGGGAGATGGAGCTGGG - Intronic
1013520666 6:110930262-110930284 ACTAATGGGGATGTGGAGATGGG - Intergenic
1013609689 6:111782837-111782859 ACTGATGGGAAGCTGGAGCTTGG - Intronic
1014369497 6:120586804-120586826 TCTGATGGTGAGATTGAGTTCGG - Intergenic
1014384298 6:120781405-120781427 CGTGATGTGGAGATGGGGGTAGG - Intergenic
1016823256 6:148365652-148365674 ACTGAAGGAGAGATGGAGCTAGG + Intronic
1017236210 6:152119806-152119828 GATGATGGGGAGATGGGTATGGG - Intronic
1018372877 6:163184918-163184940 CCTGGTGGGCAAATGGAAATGGG + Intronic
1019294081 7:264763-264785 CCCGAGGGGGACATGGAGACAGG + Intergenic
1019583029 7:1777920-1777942 CCTGATGGAAAGATGGATAAAGG - Intergenic
1020053234 7:5097450-5097472 GCTGGTGAGGAGATGGAGAAAGG - Intergenic
1020389880 7:7646667-7646689 ACAGATGGGGAGCTGGAGAGGGG + Intronic
1021688179 7:23207500-23207522 CCCGCTGGGTTGATGGAGATGGG + Intergenic
1022290812 7:29000840-29000862 GCTGATGGGGAGAGGGGGAGTGG - Intronic
1023888395 7:44376327-44376349 CCTGTTGGGGAGGGGAAGATGGG + Intergenic
1025709019 7:63890851-63890873 CCAGCTGGGGAGATGGGGAGAGG + Intergenic
1026879959 7:73901867-73901889 CCTGAGGGGGAGGGGGAGTTGGG - Intergenic
1026896605 7:74013258-74013280 CCAAGTGGGGAGAGGGAGATTGG + Intergenic
1027164952 7:75827752-75827774 CCTGCTGGGGAGGTGGACACAGG + Intergenic
1028772886 7:94647376-94647398 GGTGATGGGGAGATGAAGATAGG - Intronic
1029171979 7:98636993-98637015 ACTGATGGGGAGTTGGAGTGGGG + Intergenic
1029938503 7:104454135-104454157 CCAAAGAGGGAGATGGAGATTGG + Intronic
1030840964 7:114353808-114353830 TGTGATGGTGAGATGTAGATTGG - Intronic
1033848597 7:145465536-145465558 ACTGATGAGGACATGGAGAAAGG - Intergenic
1039346141 8:36707815-36707837 GCTACTTGGGAGATGGAGATGGG - Intergenic
1041752806 8:61279245-61279267 CCTGATGGGAAGCTGGAGCTGGG - Intronic
1043198783 8:77335985-77336007 CCTTATTTGGAGATGGAGCTAGG - Intergenic
1045062844 8:98423939-98423961 CCTGCTGGGAAGATGGTGAGGGG - Intronic
1047176789 8:122549208-122549230 CCTGATGAGATAATGGAGATGGG + Intergenic
1048261103 8:132945736-132945758 CCAGAGGGGGAGAAGGAGATGGG + Intronic
1048506072 8:135023125-135023147 GGTGATGGGGAGATGAAGACAGG - Intergenic
1049049846 8:140185770-140185792 GCTGATGGGGAGATGGGGAAGGG + Intronic
1049704383 8:144033929-144033951 CCTGATGGGGAGATAGTCCTTGG + Intronic
1050844571 9:10198372-10198394 CCTGAAAGGAAGATGGAGTTAGG + Intronic
1051355811 9:16239006-16239028 GCTTATGGAGAGATGGAGAAAGG + Intronic
1052975699 9:34408348-34408370 CCTGCAAGGGAGGTGGAGATGGG + Intronic
1053162140 9:35820494-35820516 CCTGAAGAGGAGAAGGAGGTTGG + Intronic
1055327100 9:75142201-75142223 CCTCATGGATAGATGGAGATGGG + Intronic
1056817827 9:89814525-89814547 CCTGATGGGGTGATGGGGAATGG + Intergenic
1057007773 9:91575733-91575755 TCTGATGGTGACATGGAGCTAGG - Intronic
1057607612 9:96511612-96511634 CCTTCTGGGGAGAAGGGGATGGG + Intronic
1058714934 9:107715084-107715106 CCAGATGGGGAAACTGAGATGGG - Intergenic
1059171070 9:112125736-112125758 GCTGATGGGGATATGGAAACAGG - Intronic
1060440657 9:123636171-123636193 CCTGGTCAGGTGATGGAGATGGG - Intronic
1060807258 9:126585652-126585674 CCTGATGGGGAGAAGGCCACCGG + Intergenic
1062318663 9:135979986-135980008 CCGGCCGTGGAGATGGAGATGGG - Intergenic
1203530845 Un_GL000213v1:140426-140448 ACTGATGGGGAGATGCAGGAAGG + Intergenic
1203458797 Un_GL000220v1:14474-14496 CCTGATGGGGTTATAGAGGTGGG - Intergenic
1203488367 Un_GL000224v1:79284-79306 ATTGATAGGGAGATGGAGATAGG + Intergenic
1203500988 Un_KI270741v1:21180-21202 ATTGATAGGGAGATGGAGATAGG + Intergenic
1187258814 X:17666492-17666514 CCAGGTGAGGAGATGGATATGGG - Intronic
1187786700 X:22896593-22896615 TCTGATGCAAAGATGGAGATTGG - Intergenic
1188193429 X:27198892-27198914 CCTGTTGGGGAGTGGGGGATAGG + Intergenic
1189797074 X:44655257-44655279 CCAGAGGGGAAGATGGAGACAGG + Intergenic
1193300814 X:79886504-79886526 CCTCATGGGAAGATAGAGAGAGG + Intergenic
1193428467 X:81370258-81370280 CCAGATGAGGAGATTGAGACTGG - Intergenic
1194193500 X:90865269-90865291 CCTGATGGTGCGAAGGAGACTGG + Intergenic
1195538745 X:106038493-106038515 TCTGATGATGATATGGAGATTGG - Intronic
1196047083 X:111267710-111267732 CTTAATGGGGAGAGGGAGAGAGG + Intronic
1197322435 X:125049240-125049262 ACTGTTGGGGAGAGGGAAATAGG - Intergenic
1197587077 X:128361871-128361893 GCTGATGGGGATGTGGAGAAAGG - Intergenic
1198028777 X:132734971-132734993 GTTGGTGGGGAGATGGGGATGGG + Intronic
1201578720 Y:15488878-15488900 CCTGTTGGGGAGTTGGGGAGAGG - Intergenic
1202346541 Y:23934253-23934275 CCTGATGTGGAGGTGGACCTAGG - Intergenic
1202524230 Y:25735840-25735862 CCTGATGTGGAGGTGGACCTAGG + Intergenic