ID: 961988913

View in Genome Browser
Species Human (GRCh38)
Location 3:131166787-131166809
Sequence CTGGATCCCTAGTTGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 130}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961988905_961988913 13 Left 961988905 3:131166751-131166773 CCTGCTGACTGAAAGGCCATGGG 0: 1
1: 0
2: 1
3: 26
4: 253
Right 961988913 3:131166787-131166809 CTGGATCCCTAGTTGGAGAAAGG 0: 1
1: 0
2: 1
3: 17
4: 130
961988910_961988913 -3 Left 961988910 3:131166767-131166789 CCATGGGGTCAACAATAGGGCTG 0: 1
1: 0
2: 0
3: 8
4: 85
Right 961988913 3:131166787-131166809 CTGGATCCCTAGTTGGAGAAAGG 0: 1
1: 0
2: 1
3: 17
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961988913 Original CRISPR CTGGATCCCTAGTTGGAGAA AGG Intronic
904907197 1:33906594-33906616 CTGGATAACTAGGTGGGGAATGG + Intronic
908709657 1:67000997-67001019 CTGGACCCTGAGTGGGAGAAAGG - Exonic
908833807 1:68208665-68208687 CAGAATCCCTACTTGGAGACTGG + Intronic
910165605 1:84324606-84324628 GTGTATTCCTAGTTGGAGAGAGG + Intronic
911783075 1:101908622-101908644 CTGGAACCTTATTTGGAAAAAGG + Intronic
912975877 1:114329841-114329863 CTGGGCCCCTGGTTGCAGAAGGG + Intergenic
914059545 1:144196368-144196390 CTGGATCCCTGTTTGGTGTAGGG + Intergenic
914119605 1:144770003-144770025 CTGGATCCCTGTTTGGTGTAGGG - Intergenic
914886186 1:151586297-151586319 CTGGAATCCTAGTGGGAGGAAGG - Intergenic
914976412 1:152367704-152367726 CTGGATCTCTATTTTGAGAATGG + Intergenic
920281435 1:204846584-204846606 CTGGATTCCTAGGTGGGGGATGG + Intronic
920716345 1:208343852-208343874 CTGAATTGCTACTTGGAGAAGGG - Intergenic
922128406 1:222752526-222752548 CTGGGTCTCCAGTTGGTGAATGG + Intergenic
1064304918 10:14156992-14157014 CTGGTTCCCTTGTTTGATAAAGG + Intronic
1066700162 10:38119134-38119156 CAGCATCCCTAGGTTGAGAAGGG + Exonic
1067994305 10:51253464-51253486 CTGGATACCTTGTGGTAGAAGGG - Intronic
1068935459 10:62631530-62631552 CTGGGTCCCTAGTTCTTGAAGGG + Intronic
1070091666 10:73291968-73291990 CTGGATCACTGGTTGGACTATGG - Exonic
1072063143 10:91837406-91837428 CTGGATCCCTAGAGGTAGATGGG - Intronic
1072436840 10:95421858-95421880 CTGCTTCCCCAGTTGGATAACGG - Intronic
1077283301 11:1755021-1755043 CTGGGTCCCTAGGAGGAAAAGGG + Exonic
1077633597 11:3827117-3827139 GTGGCTCCCTCATTGGAGAAGGG + Exonic
1077696022 11:4393497-4393519 AGGGATCCCTGGTGGGAGAAGGG + Intronic
1077960863 11:7075176-7075198 ATGGATCCCCAGTTGGCCAACGG - Intergenic
1085935009 11:81130740-81130762 GTTGATCTCTAGTTAGAGAATGG + Intergenic
1090422020 11:126581937-126581959 CTGGATCCCTAGTTACACAAGGG + Intronic
1092088287 12:5783821-5783843 CTGGAGCCCTAGTGGGAGAAGGG - Intronic
1093651703 12:21653457-21653479 CTGGTTCCCTAGTGCCAGAAAGG + Intronic
1094045294 12:26159913-26159935 CAGGATCCCTTGTTAGAGAAGGG + Intronic
1095134972 12:38589423-38589445 CAGGATCTCTAGTTGGAAAATGG + Intergenic
1101518532 12:105460117-105460139 CTGGATCCTTATTTGGAGGCAGG + Intergenic
1102927229 12:116835614-116835636 CTGGAGTGCTAGATGGAGAAGGG + Intronic
1103889919 12:124230919-124230941 CTGGTTGCTTGGTTGGAGAATGG + Intronic
1103907089 12:124333272-124333294 CTGGAGACCTGGATGGAGAAAGG + Exonic
1104378903 12:128290086-128290108 CTGGATCCAAAGGTGCAGAAAGG + Intronic
1105400829 13:20093784-20093806 CTGGAACTCTAGTTTGAGACTGG + Intergenic
1106500009 13:30319006-30319028 CTTCATTTCTAGTTGGAGAAGGG - Intergenic
1106973583 13:35177022-35177044 CCGGATCCTTAATAGGAGAAAGG - Exonic
1107646812 13:42502632-42502654 ATGGAACCCTGGTTGGAGAAAGG + Intergenic
1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG + Exonic
1113811894 13:113147714-113147736 CTGGACACCCAGTGGGAGAAGGG - Intronic
1119451153 14:74712004-74712026 CTTGATCAGTAGCTGGAGAATGG + Intronic
1119738578 14:76999508-76999530 CTGGCTGCATAGTTGGGGAATGG + Intergenic
1121949963 14:98163193-98163215 CTTAATCCCTGGTTGAAGAAAGG - Intergenic
1123704272 15:22939847-22939869 CTGGACCCCGAGTCTGAGAAGGG + Intronic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1125531211 15:40414749-40414771 CTGGAACCTTAGTTGAATAAAGG + Intronic
1126835851 15:52664306-52664328 CTAGAATCCTAGTTGGAAAAAGG + Intronic
1127166728 15:56251383-56251405 CTGGCCCCCTAGTTGGAACAGGG + Intronic
1127911783 15:63422257-63422279 CTGTATCCCTTCTTGAAGAAGGG + Intergenic
1128443578 15:67737228-67737250 ATGGATCCCTGGGGGGAGAATGG + Intronic
1129542223 15:76359757-76359779 CTGAATCCCAAGTTACAGAAGGG + Intronic
1132319891 15:100918382-100918404 TTGGGTCCCTGGTTGGAGAGGGG - Intergenic
1133104102 16:3495560-3495582 CTGGACCCCTAGTTTGGGAGAGG + Intergenic
1137394513 16:48107329-48107351 CTGGGTCTCTGGTTGGACAAGGG - Exonic
1139632510 16:68239129-68239151 CTGGAGCCCTAGATAGAGAAGGG - Intergenic
1203143106 16_KI270728v1_random:1781825-1781847 GTGGATCCCCAGATGGAGGATGG + Intergenic
1203143170 16_KI270728v1_random:1782250-1782272 GTGGATCCCCAGATGGAGTATGG + Intergenic
1145016767 17:19403914-19403936 GTGGATTGGTAGTTGGAGAATGG + Intergenic
1147547467 17:41413671-41413693 CTAGATGACTAGTTGGAGGAAGG - Intergenic
1148745402 17:49915284-49915306 CTGGAACCCCAGTTGGTGACAGG - Intergenic
1148999598 17:51743470-51743492 CTGGATTCCTTGTTGGGGATTGG - Intronic
1151060246 17:71084126-71084148 CTAGATACCAAGGTGGAGAAGGG - Intergenic
1152688313 17:81705776-81705798 CTGGTTCCCCAGTGGGGGAAAGG - Intronic
1153243738 18:3053874-3053896 CTGGGTGCTTAGTTGGAGAATGG - Intergenic
1159017087 18:63110168-63110190 CTGAGTCCCAAGTGGGAGAAAGG - Intergenic
1161961300 19:7524885-7524907 CTGCCTTCCTGGTTGGAGAAAGG + Intronic
1165939231 19:39407025-39407047 AGGGAGCCCCAGTTGGAGAAGGG - Intronic
1202698946 1_KI270712v1_random:148254-148276 CTGGATCCCTGTTTGGTGTAGGG + Intergenic
927086099 2:19675269-19675291 CTGCATCTCTGTTTGGAGAAGGG - Intergenic
933935842 2:87203266-87203288 CTGGATTCCTGTTTGGAAAATGG - Intergenic
934169896 2:89531735-89531757 CTGGATCCCTGTTTGGTGTAGGG + Intergenic
934280198 2:91606043-91606065 CTGGATCCCTGTTTGGTGTAGGG + Intergenic
938342702 2:130546205-130546227 CTGGATATCTGGTTGGGGAATGG - Exonic
938347131 2:130574517-130574539 CTGGATATCTGGTTGGGGAATGG + Exonic
943905817 2:193500454-193500476 CTTGATCCATAGCTGCAGAATGG - Intergenic
944836505 2:203585484-203585506 CTGGAACCCTGCTTGGAGAGTGG - Intergenic
947670026 2:231930040-231930062 CAGGATGCCTGGTGGGAGAAAGG + Intergenic
948334638 2:237198160-237198182 CAGGACTCCTAGTAGGAGAATGG - Intergenic
948443377 2:238012760-238012782 CTGGTGCCCTAGGTGGAGGAAGG + Intronic
1170603645 20:17860074-17860096 CTGTATCCCTGGTTGGAGCCTGG + Intergenic
1172009481 20:31838030-31838052 CTGGAACCCCAGTGGGAGGATGG + Intergenic
1172404168 20:34675501-34675523 CAGGTTTCCTAGTTGGGGAATGG - Intronic
1172912672 20:38421618-38421640 CTGAAAGCCTAGTTGGAAAAAGG + Intergenic
1173396623 20:42686351-42686373 CTTGACCCCTAGTGGGACAATGG + Intronic
1179675303 21:42976959-42976981 TTGGATCCATAGCTGCAGAATGG + Intronic
1181438735 22:22924904-22924926 CTGGAACCCCAGGAGGAGAAGGG - Intergenic
949999002 3:9641960-9641982 CTGGATCCATCGCTGGAGAGGGG + Intergenic
950283482 3:11726408-11726430 CTGGAGCCCTCTTTTGAGAAGGG + Intergenic
952167908 3:30771270-30771292 CTTGACCCTTAGTTGCAGAATGG + Intronic
954354244 3:50071751-50071773 CTGGATAGCTAGGAGGAGAAGGG + Intronic
961988913 3:131166787-131166809 CTGGATCCCTAGTTGGAGAAAGG + Intronic
962844998 3:139266410-139266432 CAGGATCCCTAGTTTGCAAATGG + Intronic
967219711 3:187238193-187238215 CTGGCACCTTGGTTGGAGAAAGG - Intronic
968132462 3:196199472-196199494 CTGGTTCCTTTGGTGGAGAATGG - Intronic
968181906 3:196601662-196601684 CTGGAACCCTAACTGGGGAAAGG - Intergenic
969030569 4:4209812-4209834 CTGGATCCCTGTTTGGTGTACGG - Intronic
969366585 4:6698499-6698521 GTGGATCCCTCTTTGGGGAAGGG + Intergenic
970365493 4:15354097-15354119 CATGTACCCTAGTTGGAGAACGG - Intronic
974314341 4:60258203-60258225 CTTAATCACTAGTTGAAGAAAGG - Intergenic
976148180 4:82064702-82064724 CTGGTTGCCCAGTTGGAGTAGGG - Intergenic
978057540 4:104291044-104291066 CTGGATTTCAAGGTGGAGAAAGG - Intergenic
979464372 4:121019447-121019469 CTGAATCCTTTTTTGGAGAATGG + Intergenic
982278235 4:153658671-153658693 GTGGAGCCCTTGATGGAGAAGGG + Intergenic
983708855 4:170689979-170690001 CTGGATCCCTATTTGGAAAGTGG + Intergenic
987051319 5:14148876-14148898 CTGGGTCCCCAGCTGGAGCAAGG + Intronic
987743613 5:21942144-21942166 CAGGATTTCAAGTTGGAGAAAGG + Intronic
991428049 5:66511834-66511856 GTGGTTTCCTAGTTGGTGAATGG - Intergenic
993327958 5:86565779-86565801 CAGGATCCCTGTTTGGAAAATGG - Intergenic
997641158 5:135449740-135449762 CTGGAGCCCTACCTGGAGAAAGG - Exonic
999230546 5:150059351-150059373 CTGGAGCCCTAGTAAGAGATGGG - Intronic
1001417235 5:171554696-171554718 ATGGCTCCCCAGTTGGAGAAAGG - Intergenic
1004274200 6:14221306-14221328 CTGGCTTCCGAGGTGGAGAAGGG + Intergenic
1004803694 6:19178954-19178976 ATGGACCCCTACTTGGGGAAAGG + Intergenic
1005046393 6:21646801-21646823 GTGGATCACTAGTTGGAGACAGG - Intergenic
1005892001 6:30147750-30147772 ATTTATCCCCAGTTGGAGAAAGG + Exonic
1007848816 6:44783540-44783562 CTGAATACCTAGTGGCAGAAAGG + Intergenic
1011042384 6:83044599-83044621 GGGGAGCTCTAGTTGGAGAATGG - Exonic
1011224067 6:85087551-85087573 CTGGCTCCTTAGATGGTGAAAGG - Intergenic
1012964332 6:105657017-105657039 CTGAATCCATAGTTATAGAAGGG + Intergenic
1016246497 6:141987580-141987602 GTTGATCCTTATTTGGAGAAGGG + Intergenic
1018801583 6:167226942-167226964 CTGGATCCATCGCTGGAGAGGGG - Intergenic
1020119778 7:5496466-5496488 CTGGATCCATAGGTGGCTAAAGG + Intronic
1021790069 7:24195905-24195927 CTGGATCCCAAGAGGGAAAAAGG + Intergenic
1022060288 7:26786274-26786296 CTGTATCCCTAATTGTAGAATGG - Intronic
1022882714 7:34605487-34605509 CTGGATCAGTAGTTGATGAAAGG + Intergenic
1023763480 7:43488720-43488742 CTGGGCCCCTTGTTGGAGAAGGG + Intronic
1032171200 7:129586001-129586023 CTGGATCCCTATTTGGAAAGTGG + Intergenic
1033104485 7:138508298-138508320 CTGGTTCCGTTGTGGGAGAAGGG + Intronic
1033412071 7:141127168-141127190 CTCGATCCCTTGCAGGAGAAAGG - Intronic
1039278814 8:35959539-35959561 CTGGATCCCTGTTTGGAAAATGG + Intergenic
1045816545 8:106283345-106283367 CTGGAACCCTAGATGGAGAGAGG + Intronic
1048463709 8:134644139-134644161 CTGGCCCCCTAGCTGGTGAATGG - Intronic
1053482372 9:38424916-38424938 CTGGAAGCCGAGTTGGAGGATGG - Intergenic
1056019289 9:82424470-82424492 CTGGATCCCTGGGTGAAGAGTGG - Intergenic
1058723325 9:107778576-107778598 CTGGTTCCATCTTTGGAGAAGGG - Intergenic
1062152321 9:135027837-135027859 CTGGTTCTCTAATTGGAAAATGG - Intergenic
1186091130 X:6050019-6050041 CAGGATCCCTGGTTTGGGAAAGG + Intronic
1187853744 X:23616735-23616757 ATGTATCCTTATTTGGAGAAAGG + Intergenic
1188630847 X:32358200-32358222 CTAGAAGCCAAGTTGGAGAAGGG - Intronic
1190305170 X:49077845-49077867 GTGGAGCCCTTGATGGAGAAGGG - Exonic
1190314332 X:49140220-49140242 CTGGATCCCTGTTTGGAAAATGG - Intergenic
1194096986 X:89653167-89653189 CTGGTGCCTTTGTTGGAGAATGG + Intergenic
1194794189 X:98189691-98189713 TTTGATGCCTAGGTGGAGAAAGG + Intergenic
1198871517 X:141180713-141180735 GTGCTTCCCTGGTTGGAGAAAGG + Intergenic
1200450006 Y:3314547-3314569 CTGGTGCCTTTGTTGGAGAATGG + Intergenic
1200912622 Y:8544517-8544539 CTGGATCAGTATTTGGAAAATGG + Intergenic
1200983239 Y:9281110-9281132 CTGGATCAATATTTGGAAAATGG - Intergenic
1202127144 Y:21578587-21578609 CTGGATCAATATTTGGAAAATGG + Intergenic