ID: 961989305

View in Genome Browser
Species Human (GRCh38)
Location 3:131170583-131170605
Sequence TCACCTGTCTCATTGATTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 169}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961989301_961989305 6 Left 961989301 3:131170554-131170576 CCCATGAAGGTTAAATGCTTTGT 0: 1
1: 0
2: 1
3: 15
4: 209
Right 961989305 3:131170583-131170605 TCACCTGTCTCATTGATTCAGGG 0: 1
1: 0
2: 2
3: 15
4: 169
961989300_961989305 18 Left 961989300 3:131170542-131170564 CCTGAAACTGAGCCCATGAAGGT 0: 1
1: 0
2: 1
3: 17
4: 160
Right 961989305 3:131170583-131170605 TCACCTGTCTCATTGATTCAGGG 0: 1
1: 0
2: 2
3: 15
4: 169
961989302_961989305 5 Left 961989302 3:131170555-131170577 CCATGAAGGTTAAATGCTTTGTG 0: 1
1: 0
2: 0
3: 21
4: 181
Right 961989305 3:131170583-131170605 TCACCTGTCTCATTGATTCAGGG 0: 1
1: 0
2: 2
3: 15
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961989305 Original CRISPR TCACCTGTCTCATTGATTCA GGG Intronic