ID: 961993512

View in Genome Browser
Species Human (GRCh38)
Location 3:131217073-131217095
Sequence GTTCACGGTGTCCTAGTTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 46}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961993512_961993513 -10 Left 961993512 3:131217073-131217095 CCGGGAACTAGGACACCGTGAAC 0: 1
1: 0
2: 0
3: 3
4: 46
Right 961993513 3:131217086-131217108 CACCGTGAACACAGTGTTCGAGG 0: 1
1: 0
2: 0
3: 1
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961993512 Original CRISPR GTTCACGGTGTCCTAGTTCC CGG (reversed) Intronic