ID: 961997105

View in Genome Browser
Species Human (GRCh38)
Location 3:131257538-131257560
Sequence ATGGCCCTTGCGGTGTCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 62}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961997100_961997105 29 Left 961997100 3:131257486-131257508 CCACTGTTGTAAGGATAGAATTT 0: 1
1: 0
2: 0
3: 22
4: 182
Right 961997105 3:131257538-131257560 ATGGCCCTTGCGGTGTCTTGTGG 0: 1
1: 0
2: 0
3: 4
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961997105 Original CRISPR ATGGCCCTTGCGGTGTCTTG TGG Intronic
900632874 1:3646632-3646654 ATGGCCAGTAAGGTGTCTTGGGG + Intronic
901723019 1:11215595-11215617 ATTGCCCATGGGGTGTCTTCTGG + Intronic
905886009 1:41492354-41492376 GTGGCCCTGGTGGTGACTTGGGG + Intergenic
907430288 1:54407126-54407148 ATGGCCCTTGGCGTGCTTTGGGG + Intronic
908084759 1:60619537-60619559 TTGGAGCTTGCGGTGTATTGGGG - Intergenic
914416748 1:147491197-147491219 AAGGAACTTGGGGTGTCTTGTGG - Intergenic
1067740038 10:48888580-48888602 ATGGCCCTTGGGTTTTATTGTGG - Intronic
1074383728 10:113000883-113000905 ATGGCCCTAGCGGGGTTTGGAGG - Intronic
1076237125 10:128871983-128872005 ATGGCCCTGGCCGGGTCTTTGGG - Intergenic
1090862609 11:130667241-130667263 ATGGTCCTTGGTGTGTCCTGTGG + Intergenic
1095373897 12:41503714-41503736 ATGAGCCTTGCCTTGTCTTGGGG + Intronic
1104095120 12:125550122-125550144 ATGGCCCTTGCAGGCTCTGGGGG - Intronic
1113708547 13:112449278-112449300 ATGACCCTTTCGGGGTGTTGAGG - Intergenic
1117480385 14:56137974-56137996 ATTTCCCTTGGGCTGTCTTGTGG + Intronic
1119851500 14:77869723-77869745 TTGGGCCTTGGGGTGTCTTCTGG + Intronic
1121275414 14:92664095-92664117 GTGGCCCCTGGGGTGCCTTGGGG - Intronic
1126380552 15:48042503-48042525 ATGGCCCTTATGGTCTCTTGTGG + Intergenic
1128583762 15:68829133-68829155 ATGGCCCTTGCAGTTAGTTGGGG + Intronic
1137481785 16:48857910-48857932 ATGGAACTTGCGGTCCCTTGAGG + Intergenic
1137668774 16:50267223-50267245 ATGGCCCATGCGGTCCCTGGGGG - Intronic
1138087996 16:54151317-54151339 ATGGCCTTTGGGGTGACTTGAGG - Intergenic
1138358025 16:56401102-56401124 ATGGACCTTGAGGTATCTTTTGG - Intronic
1142112021 16:88338097-88338119 ATGGGCCATGGGATGTCTTGGGG - Intergenic
1142866691 17:2795648-2795670 ATGCCCCTTGCAGTGTGATGTGG + Intronic
1147229305 17:39005518-39005540 ATGGCCCTTATGGCGTGTTGGGG - Intergenic
1166304123 19:41928104-41928126 ATGGCCCCCGCGGCGTCCTGGGG + Intronic
927711738 2:25330510-25330532 ATGGCCCTTGGGCTGTATGGTGG - Intronic
1171232015 20:23494596-23494618 ATGGCCCTTGCGGTTTGTCCAGG + Intronic
1171306595 20:24112383-24112405 CTGCCCCTTGCAGTGTCCTGGGG + Intergenic
1176042404 20:63072442-63072464 ACTGCCCTTGCGGGGTCTCGGGG - Intergenic
1179145827 21:38766527-38766549 ATGTCCCGTGAGGTGTCATGAGG + Intergenic
1179990171 21:44943960-44943982 ATGCCCCTGGCTGTTTCTTGGGG + Intronic
1181273218 22:21672972-21672994 CTGGCCCTTGTGGTGTTCTGGGG + Intronic
1184750338 22:46482347-46482369 ATGGCCCTTCCTCTGTCTTCAGG - Intronic
1185239244 22:49733787-49733809 CAGGCCCCTGGGGTGTCTTGTGG + Intergenic
950580625 3:13859665-13859687 ATGGCCCTTGCTGTGTCCTCAGG + Intronic
961997105 3:131257538-131257560 ATGGCCCTTGCGGTGTCTTGTGG + Intronic
962343295 3:134602630-134602652 CAGGCCCTTGGGGAGTCTTGTGG - Intronic
964129952 3:153275929-153275951 CTGGGCCTGGCTGTGTCTTGGGG + Intergenic
966413589 3:179667164-179667186 ATGGCATTTACGGAGTCTTGGGG + Intronic
974345581 4:60676976-60676998 ATAGCCATTGCTGTGTCTTTAGG - Intergenic
974581257 4:63804860-63804882 TTGGCCCTTGAGGTACCTTGAGG + Intergenic
985685602 5:1280042-1280064 ATGGCCCTGGCTGTGTCCCGTGG + Intronic
990564548 5:57016272-57016294 ATGGCCCTGGAGGTTTCTTGGGG - Intergenic
997583650 5:135032199-135032221 GTGGCCCTTTCAGTGTCTTTAGG - Intronic
998571608 5:143264383-143264405 ATGGCCCTGGCTGGGTGTTGTGG + Intergenic
1003538420 6:6996629-6996651 ATGGCACTTGCTGTGTCCTCTGG - Intergenic
1004683415 6:17918599-17918621 ATGGACCTTGTGTTTTCTTGGGG + Intronic
1006627139 6:35405428-35405450 AGGGCCCTTGTGTTGTCTGGGGG + Intronic
1019176855 6:170164354-170164376 ATGGCCATTCCGGGGTCATGTGG - Intergenic
1020628740 7:10615265-10615287 ATGGTCATTGCTGGGTCTTGAGG - Intergenic
1026528011 7:71172615-71172637 GTGGTCCTTACGGTGTCTTCTGG - Intronic
1029126892 7:98300844-98300866 CTGGGCGTTGCGGTGACTTGGGG - Intronic
1033731962 7:144188830-144188852 GTGTCCCTTGCTGTGTCTGGGGG - Intronic
1033742811 7:144287413-144287435 GTGTCCCTTGCTGTGTCTGGGGG - Intergenic
1033751091 7:144362201-144362223 GTGTCCCTTGCTGTGTCTGGGGG + Intronic
1034436382 7:151064593-151064615 CTGGGCCCTGGGGTGTCTTGCGG - Exonic
1039400249 8:37263074-37263096 CTGGCCCTTGAGGTGGTTTGAGG + Intergenic
1039642364 8:39237699-39237721 ATGGCCGTTGTGGTGGATTGGGG - Intronic
1050409833 9:5351483-5351505 ATGGCCCTTGAGCTGTCTCAGGG + Intergenic
1051937301 9:22458663-22458685 ATGGGGCTTGAGGTGTCTTATGG - Intergenic
1056936298 9:90917409-90917431 AAGGCCCTTGCCTTCTCTTGTGG + Intergenic
1058153318 9:101486099-101486121 ACTGCGCTCGCGGTGTCTTGGGG - Intronic
1061710861 9:132486882-132486904 ATGGCCCTTGCCGTGTGAGGCGG - Intronic
1062474182 9:136719359-136719381 ATGGCCCCTGGGGTGGCTTCGGG - Intronic
1193037201 X:76964901-76964923 ATGCCCCTCGAGGTGTGTTGTGG + Intergenic
1199836028 X:151591862-151591884 ATAGCCCTTTCTGTGTTTTGGGG - Intronic