ID: 962006650

View in Genome Browser
Species Human (GRCh38)
Location 3:131356433-131356455
Sequence GTCAAATGTAGGCTTGACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962006650_962006654 -1 Left 962006650 3:131356433-131356455 CCCTGGTCAAGCCTACATTTGAC No data
Right 962006654 3:131356455-131356477 CTACAGATCTGGCTGACATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962006650 Original CRISPR GTCAAATGTAGGCTTGACCA GGG (reversed) Intergenic
No off target data available for this crispr