ID: 962009242

View in Genome Browser
Species Human (GRCh38)
Location 3:131378108-131378130
Sequence TGACCTTGATCACGTGTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962009241_962009242 3 Left 962009241 3:131378082-131378104 CCAACATGACTTGTCAATGATGA No data
Right 962009242 3:131378108-131378130 TGACCTTGATCACGTGTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962009242 Original CRISPR TGACCTTGATCACGTGTTCA AGG Intergenic