ID: 962010676

View in Genome Browser
Species Human (GRCh38)
Location 3:131387518-131387540
Sequence CCTGATGCACAGATGCAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 148}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962010672_962010676 29 Left 962010672 3:131387466-131387488 CCCAGATGGAGGGAGTTTGTGTG 0: 1
1: 0
2: 0
3: 16
4: 210
Right 962010676 3:131387518-131387540 CCTGATGCACAGATGCAGATTGG 0: 1
1: 0
2: 0
3: 11
4: 148
962010674_962010676 -7 Left 962010674 3:131387502-131387524 CCAAAGTGCTGCTCATCCTGATG 0: 1
1: 0
2: 2
3: 27
4: 274
Right 962010676 3:131387518-131387540 CCTGATGCACAGATGCAGATTGG 0: 1
1: 0
2: 0
3: 11
4: 148
962010673_962010676 28 Left 962010673 3:131387467-131387489 CCAGATGGAGGGAGTTTGTGTGT 0: 1
1: 0
2: 1
3: 19
4: 225
Right 962010676 3:131387518-131387540 CCTGATGCACAGATGCAGATTGG 0: 1
1: 0
2: 0
3: 11
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962010676 Original CRISPR CCTGATGCACAGATGCAGAT TGG Intronic
900576303 1:3384152-3384174 CCTGCTGGACAGGTGCATATGGG - Intronic
900888420 1:5431824-5431846 CCTTTTTCGCAGATGCAGATGGG - Intergenic
907542833 1:55232099-55232121 CATGATGCAGAGTTGAAGATTGG + Intergenic
908320758 1:62976147-62976169 TCTGATGCACATCTGGAGATGGG - Intergenic
908410374 1:63858442-63858464 CCTGATGCACAAATTAAGACTGG + Intronic
914248360 1:145902021-145902043 CCTGTGGGACAGAAGCAGATGGG + Exonic
915399684 1:155613103-155613125 CCTGATTCCCTGATGCAGTTTGG + Exonic
915416795 1:155748659-155748681 CCTGATTCCCTGATGCAGTTTGG + Intergenic
919209424 1:194460334-194460356 CCAGATACAGAGATGCAGAGGGG - Intergenic
920966167 1:210702814-210702836 GCTGCAGCACAGATGCAGAAGGG - Intronic
922861196 1:228818304-228818326 TCTGATGCACAGCTGCAGTTTGG - Intergenic
1066228205 10:33405198-33405220 TCTGAAGGACATATGCAGATTGG - Intergenic
1068279866 10:54854667-54854689 CCTGATGATCAGCTGCAGAGAGG - Intronic
1075783772 10:125034177-125034199 CCTGATTCACAGCTGCAGAACGG + Intronic
1076892925 10:133293615-133293637 CCTGATGGACAGGTCCAGGTTGG + Exonic
1077105020 11:838433-838455 CCTGGTGGTCAGATGCAGGTTGG + Exonic
1077196772 11:1284955-1284977 CATCCTGCACAGATGCAGAAAGG - Intronic
1077913407 11:6594331-6594353 CCTGGTGGCCAGATGGAGATGGG - Intergenic
1079097686 11:17521411-17521433 TCTGAAACACAAATGCAGATTGG + Exonic
1080029260 11:27643701-27643723 CCTGATGCAGGGATGCAGGATGG + Intergenic
1080767260 11:35308378-35308400 CCTGATTCACAGAAGCTGTTCGG + Intronic
1083791662 11:64989809-64989831 GCTGCTGCAGAGAAGCAGATGGG + Exonic
1085715430 11:78868759-78868781 GCTGATGCACAGATGCAAGTGGG - Intronic
1085814355 11:79720710-79720732 CTGGATGCATAAATGCAGATTGG - Intergenic
1086725911 11:90183921-90183943 CATGATGTAGAGATACAGATAGG - Intronic
1089817548 11:121189826-121189848 CCTGTTACACAGCTGCAGAGAGG - Exonic
1090925521 11:131246734-131246756 CTCAATGCCCAGATGCAGATGGG + Intergenic
1091392475 12:134035-134057 CCAGGTGCAAAGCTGCAGATAGG + Intronic
1091871835 12:3898197-3898219 CCTCATGCTCTGAGGCAGATGGG - Intergenic
1092534627 12:9376572-9376594 CCTCATTCACAGAAGCAGCTTGG - Intergenic
1096037041 12:48481695-48481717 CCTCATGCAGAAATGCAGAGTGG - Intergenic
1097076231 12:56397003-56397025 CCAGCTGCAGAGATGCAGAGAGG - Intergenic
1097076361 12:56397547-56397569 TCGGATCCACAGATGCAGTTTGG + Intergenic
1097451037 12:59737100-59737122 TGTGAGGCACAGTTGCAGATGGG + Intronic
1100381564 12:94066530-94066552 CATGTTGCAAAGATGCACATAGG + Intergenic
1100870665 12:98907227-98907249 CTTGATGGACATATGAAGATGGG + Intronic
1101515341 12:105429809-105429831 TCTGATGCTCAGATACAGACTGG - Intergenic
1101764114 12:107682684-107682706 CCAGATCCACAGCTGCAGTTTGG + Intergenic
1103253272 12:119519298-119519320 CCTGATGATCAGAAGCAGTTAGG + Intronic
1104378883 12:128289936-128289958 CCTGAGGCCCTGATGAAGATGGG + Intronic
1106601183 13:31188381-31188403 CCTGAGGCACAGGTGCTGATGGG + Intergenic
1107959946 13:45548616-45548638 CCAGATGCTCAGGTGCAGAGGGG + Intronic
1108612611 13:52098908-52098930 CCTCATGAACATGTGCAGATAGG + Intronic
1115747798 14:36455623-36455645 TCTGATTCACAGAGGTAGATAGG + Intergenic
1118623638 14:67636940-67636962 CCTGATGCACAGTTAGAGAAAGG + Intronic
1118812527 14:69285758-69285780 CCTGAGGGACAGATGGAGAGGGG - Intronic
1119032009 14:71200142-71200164 CAAGATGCACAGATGCAGTAAGG + Intergenic
1120415938 14:84217891-84217913 CCTGGTGCACAGATAGAGAGAGG - Intergenic
1120657318 14:87207821-87207843 GATGCTGCTCAGATGCAGATTGG + Intergenic
1120846978 14:89134779-89134801 CCTGGTGCACAGATCCAGAGAGG - Intronic
1121604956 14:95233895-95233917 GCTGACCCACAGAGGCAGATGGG + Intronic
1122273936 14:100581575-100581597 CCTGATGCACAGAGGCGGGTGGG - Intronic
1122288882 14:100668846-100668868 CCTGAGGCAGAGAGGCAGGTGGG - Intergenic
1128322857 15:66704893-66704915 CCTGGTGCTCAGGTGCAGACAGG + Intronic
1131927023 15:97395981-97396003 CCTCTTGTACAGTTGCAGATGGG + Intergenic
1132940054 16:2501993-2502015 CCTGGTGCAGAGAAGCAGTTGGG - Exonic
1133019696 16:2961905-2961927 GCAGATGCACAGGTGCAGATTGG - Intergenic
1133781627 16:8943430-8943452 CGAGCTGCACAGATGCAGTTAGG + Intronic
1134012538 16:10866096-10866118 CCTGATGAACGGATGGATATTGG - Intergenic
1136018637 16:27425217-27425239 CCTTATCCTCAGATACAGATCGG - Intronic
1138622978 16:58226506-58226528 CCTGATGCACAGACGCATACAGG + Intergenic
1141232226 16:82179407-82179429 CCTGATGCCCAGAGGCAGACAGG - Intergenic
1142108404 16:88318425-88318447 CCTGATCCTGAGATGCAGCTGGG - Intergenic
1142108415 16:88318472-88318494 CCTGATCCTGAGATGCAGCTGGG - Intergenic
1145127741 17:20315824-20315846 TCTGATGCAGAGCTGCAGCTGGG - Intronic
1148979854 17:51563047-51563069 CCTGAAAAAGAGATGCAGATAGG + Intergenic
1149518323 17:57298217-57298239 CCTGATCCACGGTTGCAGAATGG + Intronic
1149550871 17:57538373-57538395 GCTGATATACAGATACAGATGGG - Intronic
1150110748 17:62497140-62497162 CCTCCCGGACAGATGCAGATGGG - Intronic
1151205947 17:72506866-72506888 CCTGATGTAGAGATGCACTTGGG + Intergenic
1158715303 18:59873782-59873804 CCAGATGCACAGAAGAAGCTTGG - Intergenic
1163564909 19:18045315-18045337 CATGGTGCCCAGTTGCAGATGGG - Intergenic
1164409014 19:27981904-27981926 CCTCATGCACTGAGGCAGAGGGG + Intergenic
1164885266 19:31773325-31773347 CCTGATGCCCAGTTCCATATGGG + Intergenic
1165798838 19:38535375-38535397 ACTGATGCAAACATGCAGGTAGG + Exonic
1166857038 19:45787393-45787415 CCTGATGATCAGAGGCAGAACGG + Intronic
1166898174 19:46036940-46036962 CAGGATGAACAGCTGCAGATAGG + Intergenic
1167734352 19:51282810-51282832 CCTAAAGACCAGATGCAGATGGG + Intergenic
925270413 2:2602407-2602429 CCAGATGCACAGATTCTGAATGG - Intergenic
926917053 2:17902157-17902179 ACAGATGCAGATATGCAGATTGG + Intronic
929790480 2:45018812-45018834 GGTGATGCACAGCTGCAGAAGGG - Intergenic
932355003 2:71061104-71061126 CCAGATGCCCAAAGGCAGATGGG + Intergenic
933205066 2:79497794-79497816 CATGATATACAAATGCAGATAGG - Intronic
933532612 2:83529728-83529750 CCAGATGCTCAGATGGAGCTTGG + Intergenic
935691104 2:105733238-105733260 ACTTATGAACAGATGCACATTGG + Intergenic
936648847 2:114403308-114403330 CCTCATGGACAGATACTGATTGG + Intergenic
938692616 2:133806229-133806251 GCTGATGCAAAGATGCTTATGGG - Intergenic
941965678 2:171298169-171298191 CCTGCTGCCCAGATGAGGATTGG - Intergenic
942134615 2:172912313-172912335 GCTTATGCAAAGATGCACATGGG - Intronic
943760592 2:191604113-191604135 CCTGTTACACAGAAGCAGAGAGG - Intergenic
944018817 2:195075952-195075974 TCACATGCACAGATGCACATAGG + Intergenic
945163535 2:206918518-206918540 GCAGATGCACAGATGCATAAGGG - Intergenic
945362274 2:208906480-208906502 CCTGATGCAGGAATGCAGGTGGG + Intergenic
945996112 2:216437811-216437833 GCTTATGCACAGATACAGAGTGG + Intronic
947965326 2:234275650-234275672 CCTCAGGCACTGAGGCAGATAGG - Intergenic
948555531 2:238807389-238807411 CCTGGGTCACAAATGCAGATGGG + Intergenic
1172563207 20:35907287-35907309 CCTGATGGACACCTGCAGCTTGG + Intronic
1175525012 20:59627675-59627697 ACTGAATCACAGATGCAGGTGGG - Intronic
1175850276 20:62086879-62086901 CCTGATCCACAGAAACAGAGAGG + Intergenic
1178742728 21:35217668-35217690 CCTGAGGCACAAGTGCAGGTGGG + Intronic
1181637363 22:24180706-24180728 ACTGAAGCTCAGATGCGGATAGG - Intergenic
1185057383 22:48588046-48588068 CATTATGCACAGATGGAGCTTGG - Intronic
952098976 3:29989393-29989415 CCTGATGCACAGGTGCATTATGG + Intronic
961369788 3:126422407-126422429 CCTGATCCCCAGAAGCAGAGAGG - Intronic
961985033 3:131122837-131122859 CCTGATGGGGAGATGGAGATGGG + Intronic
962010676 3:131387518-131387540 CCTGATGCACAGATGCAGATTGG + Intronic
964063931 3:152558686-152558708 CCTGATGGAGTCATGCAGATAGG + Intergenic
972067304 4:34964892-34964914 TCTGAGTCACAGATGCAGCTGGG + Intergenic
973842154 4:54873328-54873350 CCTTATTCACAGAAGCAGACTGG - Intergenic
974410043 4:61528668-61528690 CCAGAGGCAAGGATGCAGATGGG + Intronic
975727431 4:77305721-77305743 ACTGATGCCCAGGTGCAGCTGGG - Intronic
975791588 4:77958736-77958758 CCTGATGAACAGAGGCACCTTGG + Intergenic
975794675 4:77994655-77994677 CTTGATACACAGATGCAAGTTGG + Intergenic
977326262 4:95578670-95578692 TCAAATGCACAGATGCACATAGG - Intergenic
982325175 4:154122531-154122553 ACTGATTCACGGAGGCAGATAGG - Intergenic
983712048 4:170730233-170730255 TCTGATGCATAGATACAGAGTGG - Intergenic
985956383 5:3269015-3269037 CCACATGTACAGATGCAGACGGG - Intergenic
987844269 5:23261623-23261645 TCTGATGCACAGGAGCAGAAAGG + Intergenic
989852306 5:46229282-46229304 CCTAATGCCCATTTGCAGATTGG - Intergenic
990510173 5:56482286-56482308 CCTGATGCTCAGTGGCAGTTTGG + Intergenic
992770432 5:80042321-80042343 GCTGATCCACAGATGAAGAACGG - Intronic
995613527 5:113936343-113936365 GCTGATGCACTAGTGCAGATGGG + Intergenic
998925952 5:147126820-147126842 CCTGATTAAAAGATGCAGAGTGG - Intergenic
1002038981 5:176496741-176496763 CCTGATGCACAGAAGAAGTCAGG - Intronic
1003073600 6:2963776-2963798 CCTGATGCCCACATGCATACAGG + Intronic
1003923444 6:10855459-10855481 TCTGATCCACAGCTGCAGTTTGG - Intronic
1005911379 6:30312872-30312894 CCTGATGCAGGCATGCAGTTGGG - Intergenic
1007805688 6:44444098-44444120 CCAGATGCATAGATGTAGCTGGG + Intronic
1009196751 6:60695573-60695595 CCTGATGACCAGCTGCAGAAAGG + Intergenic
1013327386 6:109060928-109060950 CCTGATGCAAGGATTCAGAGGGG - Intronic
1017304145 6:152897531-152897553 GCTGTTGGACAGATGCATATAGG - Intergenic
1018117432 6:160600978-160601000 CACGATGCTCAGATGCAGAATGG - Exonic
1018392121 6:163348649-163348671 CCTGAAGCTGAGAAGCAGATGGG - Intergenic
1019627667 7:2028626-2028648 CCTGATGCAGACAAGCAGAGAGG + Intronic
1019777138 7:2918532-2918554 CCTGATGCACCGAGGCAGCCGGG - Exonic
1022175843 7:27870781-27870803 CCTGAGTCACAGATGCTGCTCGG + Intronic
1022535963 7:31098680-31098702 CATTATGCACAGATGCAGCGGGG + Intronic
1027782793 7:82540746-82540768 ACTTATGTACAGATGTAGATAGG - Intergenic
1028633923 7:92966121-92966143 CCTGAGGCCAAGAAGCAGATAGG - Intergenic
1032039945 7:128551034-128551056 CCTCCTGGACAGATGCAGATGGG - Intergenic
1037890519 8:22621666-22621688 GCTGCTGCACAGCTCCAGATGGG - Intronic
1045064354 8:98432426-98432448 TCTGTTGCACAAATGCATATTGG + Exonic
1046441143 8:114255714-114255736 CCAGATGCACAGATACAAAAAGG + Intergenic
1048049235 8:130801780-130801802 CCTGCTGGACACCTGCAGATTGG + Intronic
1049956408 9:696934-696956 ATTGATGCACAGATGAAGAAAGG + Intronic
1050028890 9:1364591-1364613 CCAGATGCACACATGCACCTTGG - Intergenic
1050507829 9:6365877-6365899 CCTGATTCACAGATGGAGTCAGG + Intergenic
1055327100 9:75142201-75142223 CCTCATGGATAGATGGAGATGGG + Intronic
1056932890 9:90893301-90893323 CCTGCAGCACAGAAGCACATTGG + Intronic
1059668824 9:116474571-116474593 CCTCCTTCACAGATGGAGATGGG + Intronic
1062686749 9:137817578-137817600 CCTGAAGTACAGACACAGATGGG - Intronic
1185487288 X:491880-491902 CCACATGCACAGATGCACACAGG + Intergenic
1185487324 X:492308-492330 CCACATGCACAGATGCACACAGG + Intergenic
1185788453 X:2910080-2910102 CCGGATGCACACATGCACACTGG + Intronic
1187093246 X:16119492-16119514 CCTTATGGACAGATCCACATGGG - Intergenic
1187786700 X:22896593-22896615 TCTGATGCAAAGATGGAGATTGG - Intergenic
1190054040 X:47171554-47171576 CATGATGCACACATGCAAAATGG - Intronic
1190877652 X:54471083-54471105 CCTCAGGCAAAGGTGCAGATTGG - Intronic
1192755605 X:74044463-74044485 TCTCATGCAAAGATGCACATAGG - Intergenic
1193075406 X:77349745-77349767 CCTTGTGCAAAGATGCACATAGG + Intergenic