ID: 962013579

View in Genome Browser
Species Human (GRCh38)
Location 3:131418240-131418262
Sequence CTGTATCTGTAGAATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962013579_962013582 -1 Left 962013579 3:131418240-131418262 CCTTCCTCATTCTACAGATACAG No data
Right 962013582 3:131418262-131418284 GAAACTCAGGCCTATGATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962013579 Original CRISPR CTGTATCTGTAGAATGAGGA AGG (reversed) Intergenic
No off target data available for this crispr