ID: 962022966

View in Genome Browser
Species Human (GRCh38)
Location 3:131518985-131519007
Sequence CATGGTTACTAAAACTGCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962022966_962022969 -10 Left 962022966 3:131518985-131519007 CCTTTGCAGTTTTAGTAACCATG No data
Right 962022969 3:131518998-131519020 AGTAACCATGAAGCATCGTGGGG No data
962022966_962022971 -5 Left 962022966 3:131518985-131519007 CCTTTGCAGTTTTAGTAACCATG No data
Right 962022971 3:131519003-131519025 CCATGAAGCATCGTGGGGCACGG No data
962022966_962022972 23 Left 962022966 3:131518985-131519007 CCTTTGCAGTTTTAGTAACCATG No data
Right 962022972 3:131519031-131519053 ACTGTCCCTTTATTTCAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962022966 Original CRISPR CATGGTTACTAAAACTGCAA AGG (reversed) Intergenic
No off target data available for this crispr