ID: 962022969

View in Genome Browser
Species Human (GRCh38)
Location 3:131518998-131519020
Sequence AGTAACCATGAAGCATCGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962022964_962022969 8 Left 962022964 3:131518967-131518989 CCCAGGCAGAAATAAATGCCTTT No data
Right 962022969 3:131518998-131519020 AGTAACCATGAAGCATCGTGGGG No data
962022965_962022969 7 Left 962022965 3:131518968-131518990 CCAGGCAGAAATAAATGCCTTTG No data
Right 962022969 3:131518998-131519020 AGTAACCATGAAGCATCGTGGGG No data
962022966_962022969 -10 Left 962022966 3:131518985-131519007 CCTTTGCAGTTTTAGTAACCATG No data
Right 962022969 3:131518998-131519020 AGTAACCATGAAGCATCGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962022969 Original CRISPR AGTAACCATGAAGCATCGTG GGG Intergenic
No off target data available for this crispr