ID: 962022972

View in Genome Browser
Species Human (GRCh38)
Location 3:131519031-131519053
Sequence ACTGTCCCTTTATTTCAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962022970_962022972 5 Left 962022970 3:131519003-131519025 CCATGAAGCATCGTGGGGCACGG No data
Right 962022972 3:131519031-131519053 ACTGTCCCTTTATTTCAAAATGG No data
962022966_962022972 23 Left 962022966 3:131518985-131519007 CCTTTGCAGTTTTAGTAACCATG No data
Right 962022972 3:131519031-131519053 ACTGTCCCTTTATTTCAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962022972 Original CRISPR ACTGTCCCTTTATTTCAAAA TGG Intergenic
No off target data available for this crispr