ID: 962026761

View in Genome Browser
Species Human (GRCh38)
Location 3:131555958-131555980
Sequence GATAGTTATTCCCCTTCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 166}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962026759_962026761 13 Left 962026759 3:131555922-131555944 CCTTTTGTATGTATCATCTTTTA 0: 1
1: 33
2: 6727
3: 5900
4: 6670
Right 962026761 3:131555958-131555980 GATAGTTATTCCCCTTCTGCAGG 0: 1
1: 0
2: 0
3: 7
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962026761 Original CRISPR GATAGTTATTCCCCTTCTGC AGG Intronic
905176224 1:36137198-36137220 GATGGTTATTCCTCTCCAGCTGG + Exonic
909187483 1:72506643-72506665 GATACTTTTTCCCCTTTTGTAGG + Intergenic
910236855 1:85045962-85045984 TGTAGTTATTCCCATTTTGCTGG - Intronic
910512280 1:88020861-88020883 GATATTTTCTCCCTTTCTGCCGG + Intergenic
911187672 1:94919703-94919725 TATGGTTATTTCCCCTCTGCTGG - Intronic
913181661 1:116328396-116328418 AATAGTTATTGCATTTCTGCTGG - Intergenic
913545429 1:119863344-119863366 GATGGTAATTTCCCTTGTGCTGG - Intergenic
914963683 1:152231864-152231886 AATATTTCTTCCCATTCTGCAGG + Intergenic
915082314 1:153360637-153360659 CATTCTTATTCTCCTTCTGCGGG - Exonic
917541957 1:175922903-175922925 GAAATTTCTTACCCTTCTGCTGG - Intergenic
918760638 1:188400952-188400974 AATATTTTCTCCCCTTCTGCAGG - Intergenic
919203747 1:194393352-194393374 AATATTTATTCCCATTCTGTAGG - Intergenic
920836288 1:209513986-209514008 GATATTTCATCCCCTGCTGCAGG + Intergenic
921747704 1:218756130-218756152 AAGAGTTTTTCCCATTCTGCTGG - Intergenic
1063408084 10:5815261-5815283 GATTGTTATTGTCCTTCTGTTGG - Intronic
1064597854 10:16963533-16963555 GCTAGCAATTCCACTTCTGCAGG + Intronic
1065780790 10:29164732-29164754 GTAAGTTTTTCCCCTTCAGCAGG - Intergenic
1065819867 10:29515944-29515966 AATTGTTATTCCCATTCTGACGG + Intronic
1067161579 10:43829750-43829772 GATATTTTCTCCCATTCTGCAGG - Intergenic
1069130647 10:64697848-64697870 AATATTTATTCCCATTCTGTAGG - Intergenic
1072347951 10:94527477-94527499 GATATTTTTTCCCATTCTGTGGG + Intronic
1072511446 10:96130114-96130136 GACAGGTATTCCCCGTCAGCGGG + Intronic
1072781096 10:98252468-98252490 GACAGCTCTACCCCTTCTGCAGG - Exonic
1075281195 10:121139888-121139910 TATTGTTATCCCCCTTCTGCAGG - Intergenic
1075848962 10:125570932-125570954 GATATTTCTTCCCCTTCTAAAGG - Intergenic
1075968921 10:126636604-126636626 GATAAATATTCCTTTTCTGCTGG + Intronic
1078389331 11:10922797-10922819 GAGAGTTTTTCAGCTTCTGCAGG + Intergenic
1086925039 11:92631059-92631081 GATATTTATTTCCCTCCTTCAGG + Intronic
1087632657 11:100669097-100669119 GATAGTTCTTCCCCAACTCCTGG - Intergenic
1087814220 11:102640896-102640918 GACATTTATTCAACTTCTGCTGG - Intergenic
1088407564 11:109498299-109498321 GATAGTTCTTCCCTATATGCAGG - Intergenic
1090241356 11:125184300-125184322 GACACTCATTCCCCTTCAGCAGG + Intronic
1090452715 11:126820827-126820849 GATACTTATCCCCCTTTTCCAGG + Intronic
1090935278 11:131335987-131336009 AATCGTTATTCCCCTTCTTCTGG - Intergenic
1091908701 12:4211319-4211341 GATAATAATACCCATTCTGCAGG - Intergenic
1094102576 12:26779626-26779648 GATAGTTATGCCCAATATGCAGG + Intronic
1094322158 12:29196824-29196846 AATACTTTTTCCCATTCTGCAGG - Intronic
1098207406 12:68126498-68126520 AATAGTTACTCCCATTCTGTGGG + Intergenic
1099359685 12:81684406-81684428 GATAGGTATTCACCTCTTGCTGG - Intronic
1100951030 12:99849793-99849815 GACAGTAATTACCCTTCTGGGGG + Intronic
1102154890 12:110717185-110717207 TCTAGTTATTCCTCTTCTGTGGG + Intergenic
1104058535 12:125248824-125248846 GCTGCTTTTTCCCCTTCTGCAGG + Intronic
1106939721 13:34764393-34764415 GAAAGTTATTCCCATGGTGCAGG + Intergenic
1107916940 13:45161933-45161955 GGTATTTATTCCACTTCTGTTGG + Intronic
1109804996 13:67428065-67428087 AATAGTTCTTTCCCTTCTGTTGG + Intergenic
1110827199 13:79986605-79986627 GTTGAATATTCCCCTTCTGCTGG + Intergenic
1110965886 13:81696619-81696641 AATATTTGTTCCCCTTCTGTGGG - Intergenic
1112079715 13:95956379-95956401 AATATTTATTCCCATTCTGTAGG - Intronic
1113229864 13:108201287-108201309 GTTAATTATTTCCTTTCTGCTGG - Intergenic
1116326192 14:43535748-43535770 CAAGGTTATTCCCGTTCTGCAGG + Intergenic
1119627199 14:76188631-76188653 GATATTTTCTCCCATTCTGCGGG + Intronic
1123868267 15:24544330-24544352 GATATTTTTTCCCATTCTGTGGG + Intergenic
1125456455 15:39864753-39864775 AATATTTTTTCCCATTCTGCAGG - Intronic
1129548897 15:76427280-76427302 GATATTTTCTCCCATTCTGCAGG - Intronic
1130687056 15:86047797-86047819 GATATTTTCTCCCATTCTGCAGG - Intergenic
1130874097 15:87997150-87997172 TATAGTTATCCCCATTATGCAGG - Intronic
1138315404 16:56065363-56065385 TTTAGTTATCCCCATTCTGCAGG + Intergenic
1138998869 16:62484573-62484595 TCTAGTAATTCCCCTTCTCCAGG + Intergenic
1139257724 16:65559027-65559049 GATAACTCTTTCCCTTCTGCCGG - Intergenic
1139617054 16:68103131-68103153 GATATTTTTTCCCATTCTGTAGG + Intronic
1140330838 16:74055305-74055327 TATTGTTATTCCCATTTTGCAGG + Intergenic
1140867515 16:79076766-79076788 TATTCTTATTCCCATTCTGCAGG - Intronic
1141247312 16:82320345-82320367 GATATTTTTTCCTCTTCTTCAGG + Intergenic
1146075935 17:29729100-29729122 GATATTTTTTCCCATTCTGTGGG - Intronic
1147519255 17:41153773-41153795 GATATTTTCTCCCATTCTGCAGG + Intergenic
1147799812 17:43076256-43076278 GATAGATATGTCCCTTCTGAAGG - Intronic
1148070767 17:44907267-44907289 GATAGTTGCTCCGCCTCTGCTGG - Intronic
1148361059 17:47012449-47012471 GATATTTTTTCCCATTCTGTGGG - Intronic
1152371446 17:79891072-79891094 GTTAGGTTTTCCCCTTGTGCTGG - Intergenic
1155225662 18:23727014-23727036 GATATTTTCTCCCATTCTGCAGG + Intronic
1155894723 18:31310824-31310846 GAAAATTATTTCCCTTTTGCAGG + Intergenic
1155978884 18:32160469-32160491 CATAGTTTTTACCCTACTGCTGG - Intronic
1157219945 18:45821670-45821692 AATATTTACTCCCATTCTGCAGG - Intergenic
1157584202 18:48790887-48790909 GATAGCCCTTCTCCTTCTGCTGG + Intronic
1162731968 19:12723737-12723759 GATAGCTGTTCCCCTCCTTCAGG - Intronic
1168093697 19:54102440-54102462 GTTAGTCATTCACCTTCTCCCGG + Intronic
925488396 2:4363255-4363277 GATATTTTCTCCCATTCTGCAGG + Intergenic
926113787 2:10198251-10198273 GTTAGTTAGTCCACTTCTGGAGG - Intronic
927311263 2:21634266-21634288 GATAGTCATTTCCCTTTTCCGGG - Intergenic
927840613 2:26440494-26440516 GATTGATCTTCCTCTTCTGCTGG - Exonic
929526718 2:42710598-42710620 TATAGTAATCCCCCTTCTGTGGG - Intronic
932849351 2:75169756-75169778 GATAGCTATTCAACTTATGCTGG + Intronic
933456317 2:82524156-82524178 CATACTTATTCCCCTTAAGCTGG - Intergenic
935990056 2:108711576-108711598 GATAATTTCTCCCCTTCTGTGGG - Intergenic
937287379 2:120761926-120761948 AAGGGTTATTCCCCTTCTGCAGG + Intronic
938732154 2:134155028-134155050 GAGAGTTCTCCCTCTTCTGCAGG - Intronic
942007126 2:171715434-171715456 GATAGATATTCACCTTCTTTGGG - Exonic
943715500 2:191147911-191147933 GACAATTATTCCCCTTCTTTGGG + Intronic
944770044 2:202904884-202904906 AATAATTATTCCCATTCTGTGGG - Intronic
946869719 2:224074799-224074821 GATGGTGAGTCCCCTTGTGCAGG - Intergenic
1177970516 21:27783939-27783961 AATATTTTTTCCCATTCTGCGGG - Intergenic
1179256148 21:39717268-39717290 AATAGTTTTTCCCATTTTGCAGG + Intergenic
1182920993 22:34078762-34078784 AATATTTTTTCCCATTCTGCAGG - Intergenic
949262920 3:2123212-2123234 GATAGTTATTCCCATTTTGGAGG - Intronic
949448060 3:4156236-4156258 GCAAGTTGTTTCCCTTCTGCAGG - Intronic
949749403 3:7333370-7333392 GATTTTTATTGCCCTTCTGGGGG - Intronic
950599648 3:14021587-14021609 GATATTTTCTCCCATTCTGCAGG + Intronic
951256981 3:20461090-20461112 GATATTTTTTCCCCTTCTTTGGG + Intergenic
952915366 3:38234315-38234337 AATAATTATTCCCATTCTGTAGG - Intronic
953689589 3:45106717-45106739 GGTAGTTGTTCCCCTGCTTCTGG + Intronic
953731322 3:45451127-45451149 AATATTTTTTCCCCTTCTGTAGG + Intronic
956564895 3:70625262-70625284 GAGAGTCATTCTCCTTCTTCTGG + Intergenic
956895633 3:73656872-73656894 GAAAGTTTTCCCCCTTTTGCTGG - Intergenic
958713396 3:97746934-97746956 GATAGTTCTTCTCCTTCTTATGG - Intronic
960540953 3:118862070-118862092 GATACTTTCTCCCCTTCTGTGGG + Intergenic
962026761 3:131555958-131555980 GATAGTTATTCCCCTTCTGCAGG + Intronic
962145373 3:132834735-132834757 GCTAGTTATTCCCCCTCAGTGGG + Intergenic
962895940 3:139714951-139714973 GATAGCTATTTCCCTGTTGCTGG + Intergenic
970574032 4:17410157-17410179 AATATTTATTCCCATTCTGTGGG - Intergenic
971225572 4:24748554-24748576 TATAGTTATTCCCATTTTGCAGG - Intergenic
972651728 4:41024390-41024412 GATAGTTTCTCCCATTCTGTAGG - Intronic
972825702 4:42756820-42756842 GATATTTATTCCTCTTTTCCAGG + Intergenic
973574432 4:52272817-52272839 GATATTTTCTCCCATTCTGCAGG - Intergenic
974731205 4:65868533-65868555 GATAGCTATACCCATTCTGTAGG - Intergenic
975617418 4:76260778-76260800 AATAGTTTCTCCCATTCTGCAGG - Intronic
975735031 4:77372730-77372752 GATAGTAATTCCCCTCCTACTGG + Intronic
976269411 4:83216385-83216407 GATATTTGCTCCCATTCTGCAGG - Intergenic
979452640 4:120890898-120890920 AATATTTTCTCCCCTTCTGCAGG + Intronic
982421463 4:155203961-155203983 GATAATTCTTCCACTTCAGCTGG + Intergenic
982950605 4:161690590-161690612 AATATTTTTTCCCTTTCTGCAGG + Intronic
983565169 4:169142977-169142999 CTTAGTTATTCCTCTTCTGTGGG - Intronic
983750311 4:171260186-171260208 AAAATTTTTTCCCCTTCTGCAGG + Intergenic
984690533 4:182720592-182720614 GATAGTGAATCCCATTCTGGGGG + Intronic
988779328 5:34505222-34505244 GATAATTACTCCCCTTCAACAGG - Intergenic
989142779 5:38218644-38218666 GATATTTGTGACCCTTCTGCTGG + Intergenic
989282255 5:39658496-39658518 CATATTTTTTCCCATTCTGCAGG - Intergenic
990694916 5:58405382-58405404 GCTGGTTCTTCCCCTGCTGCAGG - Intergenic
994533404 5:100995498-100995520 AATAACTACTCCCCTTCTGCTGG - Intergenic
995267983 5:110187044-110187066 AAAATTTTTTCCCCTTCTGCAGG + Intergenic
995885106 5:116885602-116885624 AATACATATTCCCCTTCTTCTGG - Intergenic
999441991 5:151608970-151608992 GATATTTTCTCCCATTCTGCAGG + Intergenic
999486371 5:152000935-152000957 AATAGGTATTTCCCTCCTGCGGG - Intergenic
1001306869 5:170581245-170581267 GAAAGTTAGTCCCTGTCTGCAGG - Intronic
1001412932 5:171523700-171523722 GATAATAATTCCTCTTTTGCGGG + Intergenic
1001535893 5:172497629-172497651 AATGATTATACCCCTTCTGCAGG + Intergenic
1005604100 6:27458343-27458365 AATATTTTTGCCCCTTCTGCAGG - Intronic
1007024812 6:38560133-38560155 GATATTTTTTCCCATTCTGTGGG - Intronic
1007314311 6:40972968-40972990 AATATTTTTTCCCTTTCTGCAGG + Intergenic
1012101742 6:95097658-95097680 AATAATTATTACCCTTCTGCTGG + Intergenic
1018074445 6:160199148-160199170 AGTGGTTCTTCCCCTTCTGCTGG - Intronic
1020490261 7:8773836-8773858 GATATTTTCTCCCTTTCTGCAGG + Intergenic
1022230364 7:28408202-28408224 TATAATTATTCCCATTCTACAGG - Intronic
1027193968 7:76015582-76015604 GATACTTTCTCCCATTCTGCAGG - Intronic
1028037324 7:86001342-86001364 AATATTTCTTCCCATTCTGCAGG - Intergenic
1028907865 7:96175137-96175159 GATGTTTTTTCCCCTCCTGCAGG - Intronic
1030198861 7:106881319-106881341 GATTATTATTCCCATTCTACAGG - Intronic
1030599504 7:111577551-111577573 AATATTTATTCCCATTCTGTGGG - Intergenic
1033790922 7:144791498-144791520 GATTGTGATTACCCTTCTCCTGG - Intronic
1033884117 7:145923565-145923587 GATTTTTATTACGCTTCTGCTGG - Intergenic
1034875043 7:154718177-154718199 GATATTTCCTCCCATTCTGCAGG + Intronic
1040474900 8:47767225-47767247 AATATTTTTTCCCATTCTGCGGG - Intergenic
1044293024 8:90494952-90494974 AATAATTGTTCCCATTCTGCAGG - Intergenic
1044697872 8:94941205-94941227 TACAGCTATTCCCTTTCTGCAGG + Intronic
1045304847 8:100950719-100950741 GGTAGTGGTTCCGCTTCTGCGGG - Intronic
1050001148 9:1078041-1078063 GATAACTATTCCCCTTCTTGGGG - Intergenic
1050382647 9:5046334-5046356 GATAGTTTTTCCCATTCTCTAGG + Intronic
1050753279 9:8966821-8966843 AATATTTTTTCCCCTTCTGTAGG - Intronic
1055547602 9:77396190-77396212 CATAGTTATTTTCCTTCTCCAGG + Intronic
1055743763 9:79419562-79419584 AATATTTCTTCCCATTCTGCAGG + Intergenic
1060389163 9:123264634-123264656 GATATTTAATCCCTTTGTGCTGG - Intronic
1186138872 X:6549598-6549620 GATATTTATTCTCCTGCTTCTGG - Intergenic
1186532112 X:10307445-10307467 GATATTTTTTCCCATGCTGCAGG + Intergenic
1188406300 X:29814507-29814529 GATATTTTTTCCCATTCTGTAGG + Intronic
1189639756 X:43055435-43055457 GAGAGTTGTGCCCCTTCTGTGGG + Intergenic
1192530601 X:71880269-71880291 GATATTTTCTCCCATTCTGCGGG - Intergenic
1193615019 X:83676463-83676485 AATATTTATTCCCATTCTGTAGG - Intergenic
1193900247 X:87167669-87167691 GACAGCTATGCCCCTTCAGCAGG + Intergenic
1196250514 X:113454542-113454564 GATAGTTTCTCCCACTCTGCGGG + Intergenic
1196360785 X:114854786-114854808 AATATTTTTTCCCATTCTGCAGG - Intronic
1196579853 X:117366194-117366216 CATTGTTTTTCCCCCTCTGCAGG - Intergenic
1200688487 Y:6280138-6280160 GACAGTCATTGCCCTTCTTCAGG - Intergenic
1201012670 Y:9563765-9563787 GACAGTCATTGCCCTTCTTCAGG - Intergenic
1201046786 Y:9894551-9894573 GACAGTCATTGCCCTTCTTCAGG + Intergenic
1201369272 Y:13243525-13243547 AATATTTTTTCCCCTTCTGTGGG - Intergenic