ID: 962033056

View in Genome Browser
Species Human (GRCh38)
Location 3:131621598-131621620
Sequence CCTCAGATACTGCAGGTTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 166}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962033048_962033056 30 Left 962033048 3:131621545-131621567 CCTCTCTTACTTCTCTTAATGCT 0: 1
1: 0
2: 1
3: 47
4: 355
Right 962033056 3:131621598-131621620 CCTCAGATACTGCAGGTTTTAGG 0: 1
1: 0
2: 1
3: 8
4: 166
962033051_962033056 -7 Left 962033051 3:131621582-131621604 CCTCTAGGCCATTATCCCTCAGA 0: 1
1: 0
2: 0
3: 7
4: 118
Right 962033056 3:131621598-131621620 CCTCAGATACTGCAGGTTTTAGG 0: 1
1: 0
2: 1
3: 8
4: 166
962033050_962033056 6 Left 962033050 3:131621569-131621591 CCATGTCAGATATCCTCTAGGCC 0: 1
1: 0
2: 0
3: 5
4: 80
Right 962033056 3:131621598-131621620 CCTCAGATACTGCAGGTTTTAGG 0: 1
1: 0
2: 1
3: 8
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962033056 Original CRISPR CCTCAGATACTGCAGGTTTT AGG Intronic
904305279 1:29584998-29585020 GCTCAGCTACTGCAGGGTGTGGG + Intergenic
904343269 1:29851957-29851979 GCTCAGCTACTGCAGGATGTGGG + Intergenic
905433935 1:37944054-37944076 CATCAGAGACTGCAGTTTTATGG + Intronic
905448310 1:38041898-38041920 CCTCAGCTGCTGCTGGTTCTTGG + Intergenic
906090304 1:43172769-43172791 GCTCAGACGCTGCATGTTTTTGG + Exonic
906190798 1:43898515-43898537 CCTCAGATACCAGAGGTTTGAGG + Intronic
906410377 1:45574037-45574059 CCTCACATACCCCAGGTATTTGG - Intergenic
907489490 1:54800066-54800088 CCTCAGAAAGTACAGGTTGTAGG - Intronic
911973177 1:104462421-104462443 CTTCAGGTGCTGCAGGTTTCAGG + Intergenic
912555711 1:110514537-110514559 CCTCAGGTACTTGAGGTCTTGGG + Intergenic
912816581 1:112833535-112833557 CCTGAGAAGCTGCAGGTGTTAGG + Intergenic
913345163 1:117801756-117801778 CATCAGTTAATGCAAGTTTTGGG + Intergenic
917130724 1:171739623-171739645 CATCAGATCCTGCAGGTTGAGGG - Intronic
919100329 1:193088653-193088675 TCTTATATACTGCAGGTTTGGGG + Intronic
921784177 1:219207494-219207516 CATCAGAAAATGTAGGTTTTTGG - Intronic
923886697 1:238165139-238165161 CCTCAAAGACTGCAATTTTTTGG - Intergenic
924168217 1:241307734-241307756 TGTCAGATACTGCAGGTGCTGGG - Intronic
1064390832 10:14940732-14940754 CCTTAGACACTGTAAGTTTTAGG - Intronic
1064401198 10:15022713-15022735 CCTTAGACACTGTAAGTTTTAGG - Intergenic
1065599476 10:27354246-27354268 CCTCAGACACATCAGTTTTTAGG - Intergenic
1071681342 10:87708527-87708549 CCTCAGCTACTGGAGTATTTGGG + Intronic
1072786263 10:98285051-98285073 CCTCTGATACAGCAGGTATCTGG - Intergenic
1075367326 10:121903735-121903757 CTCCAAATACTGCAGGTATTTGG + Intronic
1075957545 10:126536846-126536868 CCTCAGAAGCTTCATGTTTTAGG - Intronic
1077028706 11:453546-453568 CTTCAGATACCCCAGGTTTCTGG + Intronic
1077680229 11:4233230-4233252 CCTCAGCTGCTGCAGGGTCTCGG - Intergenic
1077681255 11:4242676-4242698 CCTCAGCTGCTGCAGGGTCTCGG + Intergenic
1078897220 11:15607366-15607388 CCTCAGATACCCCAGGGTTAAGG - Intergenic
1079962667 11:26943365-26943387 CCTCAAATCCAGCAGATTTTTGG - Intergenic
1080406987 11:31988111-31988133 CCAAAGATGCTGCAGCTTTTTGG + Intronic
1084545156 11:69811718-69811740 CCACAGATACTGCTGTTCTTAGG + Intronic
1085796294 11:79543043-79543065 CTTCAGAGACTGCAGTTTCTTGG + Intergenic
1086554283 11:88090816-88090838 CCTCAGATGCTCCAGCATTTTGG - Intergenic
1087729174 11:101758956-101758978 CCTCAGATACTGAATGTTCCAGG + Intronic
1088905114 11:114149463-114149485 CCTTCCATGCTGCAGGTTTTGGG - Intronic
1089132000 11:116219600-116219622 CCCCAGAGGCTGCAGGTTTGTGG - Intergenic
1091410610 12:236974-236996 ACTCACATACTTCTGGTTTTTGG - Intronic
1092248664 12:6878782-6878804 CCTCAGTTACTGCATCTGTTAGG + Intronic
1095339535 12:41073023-41073045 GCTCAGATTCTCCAGGCTTTGGG + Intergenic
1095749349 12:45694280-45694302 CCTCAGATTCCACAGGTTATGGG + Intergenic
1097457182 12:59813896-59813918 ATACAGATGCTGCAGGTTTTGGG + Intergenic
1097807474 12:63981784-63981806 CTTCAGATACTGCTGTTTCTGGG - Intronic
1099170055 12:79353041-79353063 CCTCTAATACTCTAGGTTTTTGG - Intronic
1099256963 12:80326098-80326120 CCTCAAGTACTGCAGGTATAAGG - Intronic
1100860501 12:98800438-98800460 CAAAAGATACTGTAGGTTTTGGG - Intronic
1101062073 12:100982874-100982896 CTTTAGATACTACAGGTTGTTGG - Intronic
1102530393 12:113542204-113542226 CTTCTGATTCCGCAGGTTTTGGG - Intergenic
1103699914 12:122843722-122843744 CCACAGACCCTGCAGCTTTTCGG - Intronic
1103788478 12:123451612-123451634 CCTGAGACACTGCAGGTGTCTGG - Intergenic
1107348253 13:39486484-39486506 CCTCAAATATTTCAGGTTTGTGG - Intronic
1109331890 13:60941067-60941089 CATCAGATACCGCAGGTTGGGGG + Intergenic
1111191717 13:84817044-84817066 ACTCAGGTAATGCAGGTTTCAGG + Intergenic
1111884759 13:94006250-94006272 CCTCAGCTCCTTCAGGATTTGGG - Intronic
1115301159 14:31887030-31887052 CCACAGATGCTGCTGGTTTGGGG + Intergenic
1117820064 14:59639072-59639094 CCTCAGACACTGCAGTATTTCGG - Intronic
1118217347 14:63821861-63821883 TCTAAGATACTGCAAGTTTTTGG - Intergenic
1119473328 14:74912485-74912507 CCTCAGACCCTGCAGGATGTTGG - Intronic
1120031834 14:79650527-79650549 GTTCACTTACTGCAGGTTTTGGG - Intronic
1120681717 14:87488094-87488116 GCTCAGATACTGCTAGTTCTGGG - Intergenic
1121787726 14:96675071-96675093 CCTCAAAGATTGCAGGTCTTAGG + Intergenic
1123198195 14:106637459-106637481 ACTCAGAAACAGCAGGTTCTAGG - Intergenic
1124192624 15:27593798-27593820 CATCAGATCCTGCAGGTTAAGGG + Intergenic
1125098466 15:35881721-35881743 CATAAGATACTCCAGGATTTTGG + Intergenic
1126001418 15:44213812-44213834 CCACATCTACTGCAGGTATTTGG - Intergenic
1128049666 15:64652867-64652889 CCTAAGATACTGCAAGTCTGGGG + Intronic
1128927071 15:71666860-71666882 ACTCAGATTCTGAAGGCTTTGGG + Intronic
1130131748 15:81149389-81149411 CATCAAGTACTGCAGGATTTAGG + Intergenic
1132322634 15:100937389-100937411 CCTCAGAAACCACAGTTTTTAGG + Intronic
1133340265 16:5031365-5031387 CCTCTGATTCTGCAGGTCTGAGG + Intronic
1134155284 16:11837993-11838015 TCTCAGACTCTGCAGCTTTTGGG + Exonic
1140282251 16:73565512-73565534 CCTCGAATACTCAAGGTTTTCGG + Intergenic
1140642115 16:76987167-76987189 TCACAGATACTGCTGGCTTTGGG + Intergenic
1141260694 16:82451070-82451092 CATCACATACTGCAATTTTTGGG + Intergenic
1151607097 17:75144720-75144742 CCTCAGATTCAGCAGGTTGAGGG - Intronic
1152108604 17:78344552-78344574 CATCAGATACTCCAGGGCTTTGG + Intergenic
1155302538 18:24443935-24443957 TCTCATTTACTGCAGGTTTTAGG + Intronic
1156688107 18:39674233-39674255 CATCAGATCCTGCAGGCTTCGGG + Intergenic
1157524569 18:48371172-48371194 CTGCAGAAACTGTAGGTTTTGGG - Intronic
1160057195 18:75494185-75494207 CTTCAGACACTGGAGGCTTTGGG - Intergenic
1160340373 18:78084264-78084286 CCTCAGAGACTGCACCTTTGAGG - Intergenic
1162454781 19:10776820-10776842 CCTCTGCTGCTGCAGGCTTTGGG - Intronic
1164578725 19:29421236-29421258 CCTCTGATAATGGAGGTTTATGG + Intergenic
1165336340 19:35172636-35172658 CCAAAGAAACTGCAGGGTTTGGG + Intergenic
1167817650 19:51898238-51898260 CATCAGACTCTGCAGGTTTCAGG + Intronic
930009205 2:46922845-46922867 CCTCAGAAACCGCAGGTTGAGGG + Intronic
930976825 2:57473148-57473170 CCTCATATACTGGAAGGTTTAGG - Intergenic
937385501 2:121428229-121428251 TCTCCTATATTGCAGGTTTTAGG - Intronic
937391257 2:121488600-121488622 ACACAGATACTGAAGGTTTTGGG - Intronic
941350221 2:164423185-164423207 TCTCAGTTTCTGCAGGTTTCTGG - Intergenic
942258998 2:174138648-174138670 CCACAGATATTGTGGGTTTTGGG - Intronic
943383053 2:187173953-187173975 CCTCAGTTGCTTCAGGGTTTTGG + Intergenic
944980247 2:205109408-205109430 CCTTAAATACTGCAGGATTGAGG - Intronic
946447938 2:219755554-219755576 TATCAGTTACTGAAGGTTTTGGG - Intergenic
1169345396 20:4824243-4824265 CCGCAGACACTGCAGGGTTGGGG - Intergenic
1173924862 20:46773264-46773286 ACTCATACTCTGCAGGTTTTTGG + Intergenic
1178104457 21:29302143-29302165 GCTCAGGGAATGCAGGTTTTAGG - Intronic
1178237255 21:30857396-30857418 CATCAGATCCTGCAGGTTAAGGG + Intergenic
1180154484 21:45971404-45971426 CCTCAGATCCTGATGCTTTTGGG + Intergenic
1180981000 22:19877925-19877947 CCTCAGACAGGGCGGGTTTTAGG - Intronic
1181427702 22:22855192-22855214 CCTCAGAAACTCCTGGGTTTGGG - Intronic
1184068529 22:42134299-42134321 CCTCAGATGCAGCATGTTTTAGG + Intergenic
1184262690 22:43328427-43328449 CCACAGAGCCTGCAGTTTTTGGG - Intronic
949285923 3:2404384-2404406 CCTCATATTTTGCTGGTTTTTGG + Intronic
950952331 3:17013657-17013679 TCTCAAATAATGCAGGTTCTTGG - Intronic
957954047 3:87161033-87161055 CTCTAGATACTGCAGGTTTCAGG - Intergenic
961537342 3:127578060-127578082 CCTCAGGCACAGCAGGATTTGGG - Intronic
962033056 3:131621598-131621620 CCTCAGATACTGCAGGTTTTAGG + Intronic
962625138 3:137218527-137218549 CCTGAAATACTGCAGGGGTTTGG + Intergenic
962726035 3:138227788-138227810 ACTCTGATACTGTAGGTTTGGGG - Intronic
964473392 3:157077343-157077365 CCACAGCTACTGCAGTTCTTTGG + Intergenic
966944875 3:184770666-184770688 CCTCAGGCACTGCAGTTTTGGGG + Intergenic
969210103 4:5680896-5680918 CCCCACAGACTGCAGGCTTTGGG + Intronic
971640535 4:29126406-29126428 CATCAGATCCTACAGGTTTTGGG - Intergenic
971969466 4:33603488-33603510 CCTTAGATACTCCAGCTTTCTGG + Intergenic
977401767 4:96541532-96541554 CATCAGATCCTGCAGGTTCAGGG - Intergenic
978845992 4:113273485-113273507 TTTAAGATACTGCATGTTTTTGG + Intronic
982092124 4:151889339-151889361 ACTCAGATTCTGCAGGTAGTCGG - Intergenic
984480698 4:180297612-180297634 CATCAGAGACTTCTGGTTTTGGG - Intergenic
985122949 4:186661906-186661928 CCTCAGATTCTGCAGGTTAAGGG - Intronic
985777010 5:1849816-1849838 TCTGAGACACTGCTGGTTTTAGG - Intergenic
986029909 5:3884006-3884028 CCATAGCTACTGCAGGGTTTGGG - Intergenic
986851761 5:11820780-11820802 CTTCAGGTACTGCAGGATGTGGG + Intronic
988247489 5:28706333-28706355 ACTGATATACTGCAGCTTTTAGG - Intergenic
988838506 5:35059168-35059190 CTTCAGTTGCTGAAGGTTTTAGG + Exonic
989411433 5:41123721-41123743 CCTCAGCTTCTGCAGGTGCTTGG + Intergenic
991590947 5:68250817-68250839 CCTCAAGTAGTGCTGGTTTTAGG - Intronic
992272151 5:75076202-75076224 CCTCAGATTCCACAGGTTTAAGG + Intronic
1000441044 5:161263599-161263621 CATCAGAATCTGCAGGCTTTTGG + Intergenic
1001478229 5:172066063-172066085 CCTCTGTCAATGCAGGTTTTGGG - Intronic
1004132058 6:12929989-12930011 ACTAAGATACTGCAGTATTTAGG - Intronic
1004439297 6:15632605-15632627 AGTCAAACACTGCAGGTTTTTGG + Intronic
1004449105 6:15728227-15728249 CCTCAAATAATGCAGGAGTTAGG - Intergenic
1005455245 6:26013825-26013847 CATGAGATACTGCAGATTTATGG + Intergenic
1005692937 6:28324419-28324441 CCTCAGATGCTGCTGGTTCATGG - Intergenic
1009731032 6:67607188-67607210 CCTCAGAAACTGATGGCTTTAGG - Intergenic
1009997055 6:70907477-70907499 CCAGATATACAGCAGGTTTTAGG - Intronic
1011624832 6:89274215-89274237 CCTCAGATGCCCCAGGTTGTTGG + Intronic
1012049858 6:94328125-94328147 CCACAGGTACTGCAAATTTTAGG + Intergenic
1012094120 6:94935863-94935885 CCTCAGATATGGGAAGTTTTTGG - Intergenic
1013126839 6:107192350-107192372 TCTCAGACTCTGCAGCTTTTGGG - Intronic
1016499857 6:144707708-144707730 CTTCTGATTCAGCAGGTTTTGGG + Intronic
1021769066 7:23980398-23980420 CCTCAGCCACTCCAAGTTTTTGG - Intergenic
1024340181 7:48249922-48249944 CATCAGATCCTGCAGGTTAAGGG + Intronic
1024683466 7:51718691-51718713 CCGCAGATACTGCATGTTTGGGG - Intergenic
1027339263 7:77188617-77188639 CCTCAAATACTGCATCTTCTTGG - Intronic
1029449510 7:100633070-100633092 CCGCAGGTCCTGCAGGTCTTCGG + Exonic
1030378428 7:108781846-108781868 CTTCATCTACTGCAGGATTTTGG + Intergenic
1030433460 7:109483545-109483567 CCTCAGATGCTTCAGACTTTTGG - Intergenic
1031840041 7:126726600-126726622 CATCAGATTCTGGAGGATTTTGG - Intronic
1032800875 7:135316478-135316500 TCTGAGATGCTGCTGGTTTTGGG - Intergenic
1033742020 7:144283223-144283245 CCTCAGACACTGTTGTTTTTCGG - Intergenic
1033751882 7:144366391-144366413 CCTCAGACACTGTTGTTTTTCGG + Exonic
1037698143 8:21245838-21245860 CCTCAGAAACTGTTGGTTTAGGG + Intergenic
1038290750 8:26247862-26247884 CCCCAGATACTGCAAGGTTCTGG - Intergenic
1042747003 8:72119259-72119281 ACTCAGGTACTCCAGGTGTTTGG + Intergenic
1049034934 8:140067944-140067966 GCTCAGACACTGCAGGTGTGGGG - Intronic
1050878497 9:10671353-10671375 TCTCATCTTCTGCAGGTTTTTGG + Intergenic
1051017893 9:12503060-12503082 ACTCATAAAATGCAGGTTTTGGG - Intergenic
1055002837 9:71472982-71473004 CATCAGAGACTGCACGTTGTGGG - Intergenic
1056978848 9:91288180-91288202 CCTCTTCTACTGGAGGTTTTGGG - Intronic
1058527732 9:105877126-105877148 CCTCAGATTCTCCTTGTTTTTGG - Intergenic
1060458011 9:123818770-123818792 CTTCAGATTCTGCAGCATTTTGG + Intronic
1061684451 9:132263650-132263672 CCTAGGAGACTCCAGGTTTTTGG + Exonic
1185717203 X:2352399-2352421 CCTCAGATAGCTCAAGTTTTTGG - Intronic
1187288090 X:17925521-17925543 CCTCAGATTCTGCAGGTTCTTGG + Intergenic
1187587026 X:20674751-20674773 CCTCAGAAAGTTAAGGTTTTAGG + Intergenic
1189109505 X:38273255-38273277 CCTGAAATTCTTCAGGTTTTGGG + Intronic
1190204407 X:48391505-48391527 TCACAGATACTGCAATTTTTTGG - Intronic
1190206129 X:48403898-48403920 TCACAGATACTGCAATTTTTTGG + Intronic
1192227283 X:69238132-69238154 CCTCCGTTTCTGCAGGCTTTAGG - Intergenic
1193584994 X:83310822-83310844 CCACAAATACTGCAACTTTTAGG + Intergenic
1194247755 X:91536983-91537005 CTTTAGATACTCCAGCTTTTCGG + Intergenic
1195325602 X:103755858-103755880 CGTCAGATCCTGCAGGTTGAGGG + Intergenic
1198235630 X:134733836-134733858 TGTCAGATACTGCAGGCTGTTGG + Intronic
1198589711 X:138163743-138163765 CCACAGAAACTGCATATTTTTGG - Intergenic
1199996764 X:153030784-153030806 CCCCAGAGACGGCAGGGTTTGGG - Intergenic