ID: 962039504

View in Genome Browser
Species Human (GRCh38)
Location 3:131690957-131690979
Sequence TCTCTCACAATCAGTGACAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 191}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962039504 Original CRISPR TCTCTCACAATCAGTGACAT TGG (reversed) Intronic
908446580 1:64203544-64203566 TCTCACCCAATCAGCGACAGGGG - Intergenic
908808951 1:67959597-67959619 TCTCACAGCATCTGTGACATAGG - Intergenic
910813271 1:91259797-91259819 TCTCTAATGATCAGTGATATTGG - Intergenic
912059534 1:105649051-105649073 TCTCTCAGAAAGAGTGACAATGG + Intergenic
917477504 1:175381478-175381500 TCTTTCAGGATCATTGACATTGG - Intronic
917832570 1:178908653-178908675 TCTCTGGCAATTAGTGATATTGG + Intronic
918665753 1:187148534-187148556 TCTCTGATGATCAGTGATATTGG + Intergenic
918974404 1:191463371-191463393 TCTCTCATGATCAGTGATATTGG - Intergenic
919721108 1:200836829-200836851 TCTCTAATGATCAGTGATATTGG + Intronic
921528420 1:216247337-216247359 TTTCTCACAAGCAATGCCATAGG + Intronic
921586527 1:216952942-216952964 TGCCTCACAATCACTCACATTGG + Intronic
924217999 1:241845240-241845262 TCCCTCCAAATCAGAGACATGGG - Intergenic
1067016787 10:42762686-42762708 TCTCTGATAATCAGTGATGTTGG + Intergenic
1068979757 10:63049907-63049929 TCTCTAATAATCAGTGATATTGG + Intergenic
1071370061 10:84942055-84942077 TGTCTCTCAATCAGTGGCAAGGG + Intergenic
1072733416 10:97863523-97863545 TCTCTCACAACCAGCAAGATGGG + Intronic
1074227088 10:111495067-111495089 TCTCACAAAACCATTGACATAGG + Intergenic
1076473376 10:130735735-130735757 TCAGTCACATTCAGTCACATAGG + Intergenic
1081414933 11:42803024-42803046 TCATTCAGAATCAGTCACATTGG - Intergenic
1085260649 11:75202881-75202903 CCTCTAACAAGCAGAGACATGGG - Exonic
1090321588 11:125849247-125849269 TCTCTAACGATCAGTGATGTTGG - Intergenic
1090605395 11:128418090-128418112 TATTTCACAATAAGTGACAGTGG - Intergenic
1091114617 11:133001488-133001510 TCTATCACAACCAGTGACCATGG - Intronic
1091811689 12:3404713-3404735 TCTCTCTCAATCACTGATAATGG - Intronic
1091956929 12:4652857-4652879 TCTGTCACTATCAGTGAGCTAGG + Intronic
1093596079 12:20961106-20961128 TCTCTAATGATCAGTGATATTGG - Intergenic
1097885305 12:64722879-64722901 CCACTCACAGTCAGTGACAAAGG + Intronic
1100629880 12:96377500-96377522 TTTCTCATTATCAATGACATTGG - Intronic
1101820819 12:108183128-108183150 TTTCTCATCATCAGTGACACTGG - Intronic
1101927346 12:108983593-108983615 CCTCTCACCATCAGTGGGATTGG + Exonic
1107768807 13:43767555-43767577 TTTCTAACAATCAGTGCAATTGG + Intronic
1108324075 13:49313149-49313171 TATGTAACAAACAGTGACATTGG - Intronic
1109593065 13:64512677-64512699 TCTCTAATGATCAGTGATATTGG + Intergenic
1113791640 13:113032121-113032143 TATCTTAGAATCAGTGAGATAGG - Intronic
1114068454 14:19087425-19087447 TCTCTGATAATCAGTGATGTTGG - Intergenic
1114093809 14:19312589-19312611 TCTCTGATAATCAGTGATGTTGG + Intergenic
1116392608 14:44411588-44411610 TCTTTTACAATCATTAACATTGG - Intergenic
1116400231 14:44497412-44497434 CCTCACACAATAAGAGACATAGG + Intergenic
1117580970 14:57151357-57151379 TATCTCAAAATCAGTCACATTGG - Intergenic
1118658541 14:67981171-67981193 TCCCTAACAATTAATGACATTGG - Intronic
1119885505 14:78137276-78137298 GCTCTCACAATCCTTGAGATTGG + Intergenic
1120240701 14:81946428-81946450 TCTCTCAAAAACAGTAAGATAGG - Intergenic
1121038922 14:90729131-90729153 TCTCTCACAAGCAGTTTAATAGG + Intronic
1122802023 14:104235915-104235937 TCTCTCACAGCCTGTGACATGGG - Intergenic
1123157031 14:106237067-106237089 TCTCTCACAGACAGACACATTGG - Intergenic
1126563334 15:50068777-50068799 TCTCTCACTCTCTGTCACATAGG - Intronic
1128678909 15:69632220-69632242 TCCCTAACAAGCAGTGTCATAGG + Intergenic
1131552923 15:93373336-93373358 TTTCTCATAATCAGTCACCTTGG + Intergenic
1131648577 15:94374317-94374339 TCTCTCTCAATGGGTAACATAGG - Intronic
1134340987 16:13345838-13345860 TCTCTAATCATCAGTGACATTGG + Intergenic
1134759315 16:16699571-16699593 TCTCTCTCTCTCTGTGACATGGG + Intergenic
1134986758 16:18659626-18659648 TCTCTCTCTCTCTGTGACATGGG - Intergenic
1137244542 16:46691420-46691442 TCTCTCAAACACTGTGACATTGG - Intronic
1137328649 16:47468268-47468290 TCTCTGTCAAGCAGTGAGATGGG + Intronic
1139165052 16:64556169-64556191 TCTCTAAAAATGAGTGACATTGG + Intergenic
1140595424 16:76403449-76403471 TCTCTAATGATCAGTGATATTGG - Intronic
1143387966 17:6543318-6543340 TCTTTCCCACTCAGGGACATAGG + Intronic
1143874072 17:9978753-9978775 TGTCTCAGAATCAATGACACAGG + Intronic
1145054376 17:19690699-19690721 TCTCTAACGATCAGTGATGTTGG - Intronic
1145864226 17:28229688-28229710 TCATTGACCATCAGTGACATGGG + Intergenic
1146235059 17:31151519-31151541 TCTCTCAGTATCTGGGACATTGG + Intronic
1147926618 17:43950561-43950583 TCATTGACCATCAGTGACATGGG - Intergenic
1156061304 18:33079680-33079702 TCTCTGATGATCAGTGATATTGG - Intronic
1156389301 18:36635644-36635666 TCTCTGGCAATCAGTAACCTGGG + Intronic
1159135620 18:64333654-64333676 TCTCTGCCAATCACTGACAATGG + Intergenic
1160373695 18:78395084-78395106 GCTCCCATAATCAGTGACACGGG - Intergenic
1160397830 18:78584844-78584866 TCTTTGACAATCAGTGACTTGGG + Intergenic
1168187508 19:54709446-54709468 TCTCTCACACTCAGTGTCTCTGG - Intergenic
929390819 2:41466459-41466481 TCTCTCAATATCATTGCCATGGG + Intergenic
929483269 2:42333148-42333170 TGTCTCAGAATCAGTGAAAATGG - Intergenic
930133829 2:47880836-47880858 TCTTTCACAATCACTGCCTTAGG + Intronic
930364050 2:50416768-50416790 TCACTCACTATCAGTGGCATGGG + Intronic
930947092 2:57087781-57087803 TCTCTGACAATCAATGATGTTGG + Intergenic
931420903 2:62126510-62126532 TCTCTAATGATCAGTGACATTGG + Intronic
931570386 2:63662971-63662993 TCTCTCAACAACAGTGGCATGGG - Intronic
933704354 2:85278741-85278763 TTTCTCAGATTCAGTGAGATTGG + Intronic
935102473 2:100010031-100010053 TCTCCCCAAATCAGCGACATGGG + Intronic
935125454 2:100218561-100218583 TCTCTGAGAATCAGAGACCTTGG - Intergenic
935496881 2:103793060-103793082 TCTCTAATAATCAGTGATGTTGG - Intergenic
935508944 2:103946883-103946905 TGTCTCACGATCAGTGAGAGAGG + Intergenic
936252888 2:110880873-110880895 TCTCCCACCTTCACTGACATTGG + Intronic
937233018 2:120411452-120411474 TCTCTAATAATCAGTGATGTTGG + Intergenic
940278492 2:151964513-151964535 TATCTCAAATTCAGTGAAATGGG - Intronic
942757158 2:179355385-179355407 TCTCAAACCAGCAGTGACATTGG + Intergenic
943227043 2:185191056-185191078 TCTCTGATAATTAGTGACTTAGG + Intergenic
945579250 2:211572346-211572368 ACGCTAACAATCTGTGACATTGG + Intronic
946785776 2:223242269-223242291 TCTCTAATGATCAGTGATATTGG + Intergenic
1170306192 20:14940821-14940843 TCTATGTTAATCAGTGACATTGG + Intronic
1171093533 20:22309178-22309200 TATCTCACATTCCTTGACATTGG - Intergenic
1172995650 20:39068815-39068837 TCTCTGACACTCAGTGTCTTTGG - Intergenic
1177197309 21:17917092-17917114 TCGCTCACATTCAGTGAGAGTGG - Intronic
1177890151 21:26795197-26795219 TCTCTCATGATTAGTGACATTGG + Intergenic
1178004533 21:28202941-28202963 TCTCTGACGATCAGTGATGTTGG - Intergenic
1178427225 21:32488540-32488562 TCTCTGACAATTAGTGATGTTGG + Intronic
1180486926 22:15809986-15810008 TCTCTGATAATCAGTGATGTTGG - Intergenic
1184081439 22:42223656-42223678 TATTTCCCAATCTGTGACATTGG + Intronic
949593127 3:5514524-5514546 TCTCTGATGATCAGTGATATTGG - Intergenic
950145371 3:10646123-10646145 GCTCTCACAAACATTGATATCGG - Intronic
950695018 3:14692483-14692505 TCTCTGACTATCAGTGATGTTGG + Intronic
951372080 3:21861788-21861810 TCTCTCTCACTCAGTGTCTTTGG + Intronic
951838848 3:27011873-27011895 TCTCTCTCAAGCAGTTACAGAGG + Intergenic
952518298 3:34128246-34128268 TCTCTAATAATCAGTGATGTTGG - Intergenic
953122801 3:40061838-40061860 TCTCTAATGATCAGTGATATTGG + Intronic
955582575 3:60440269-60440291 TTTCTCCCAATCAGGGAAATTGG + Intronic
955654731 3:61232547-61232569 TCTCTCATAATCAAAGACAGGGG + Intronic
956918203 3:73896900-73896922 TCTCAACCAATAAGTGACATGGG + Intergenic
957170760 3:76734016-76734038 TCCCTCATAAGCAGAGACATGGG - Intronic
957880978 3:86212683-86212705 TCTGCCACAATCAGTGAGGTAGG - Intergenic
957900397 3:86481632-86481654 TGGCTGACAACCAGTGACATGGG - Intergenic
959234250 3:103698061-103698083 TCTCTTACAAAAATTGACATAGG - Intergenic
959386776 3:105718812-105718834 GCTCTCAAAATCAGAGAAATGGG - Intronic
962039504 3:131690957-131690979 TCTCTCACAATCAGTGACATTGG - Intronic
962427748 3:135287271-135287293 TCTCTGATGATTAGTGACATTGG + Intergenic
964082783 3:152780202-152780224 TCTCTCTCAAGCAGTGAAAGAGG + Intergenic
965026575 3:163309808-163309830 TCTCTTACAATCATTGATTTTGG - Intergenic
966176235 3:177140671-177140693 TCTCCCACTGTCAGTGACAAGGG - Intronic
966927571 3:184655392-184655414 ACGCTCAGAATCAGAGACATGGG + Intronic
968885369 4:3327675-3327697 TCTCTCATGATTAGTGATATTGG - Intronic
970137274 4:12939252-12939274 TCTCTCATATTCGGTGGCATGGG - Intergenic
970836144 4:20409808-20409830 TCTCTAATGATCAGTGACGTTGG + Intronic
970846419 4:20543814-20543836 TCTCTCACTACCAATCACATTGG + Intronic
971878320 4:32333716-32333738 TCACTCAAAAACTGTGACATTGG + Intergenic
972737050 4:41852799-41852821 TCTGTGACAATCAGTGAACTTGG - Intergenic
973347726 4:49074485-49074507 AATCTCACAATCAGTAACAAAGG - Intergenic
975107127 4:70580269-70580291 TCTCTAATGATCAGTGACGTTGG - Intergenic
975538155 4:75473877-75473899 CCTTTCACAATCAGGGATATAGG + Intergenic
975798507 4:78034385-78034407 TCTTTCACCATCAGTTGCATAGG - Intergenic
977485790 4:97644370-97644392 TTTGTCAAAAGCAGTGACATGGG - Intronic
979476906 4:121169132-121169154 GCTTTCACTATGAGTGACATGGG - Intronic
982277541 4:153651878-153651900 TCACTTACAAGCTGTGACATAGG - Intergenic
983683550 4:170380790-170380812 TCCCTAATAATCAGTGATATTGG + Intergenic
984894301 4:184523186-184523208 TCTCTAACAATCAGTGATGTTGG + Intergenic
985240203 4:187923024-187923046 TCTCTCACCAACAGTGACCCAGG - Intergenic
986383480 5:7208693-7208715 TCTCTCTCAATCAATGGGATGGG - Intergenic
986798308 5:11233775-11233797 TTTCTCCCATTCAGTCACATAGG - Intronic
987556039 5:19450923-19450945 TCTCCAACAATCACTGCCATGGG - Intergenic
987709441 5:21489831-21489853 TCTCTAATGATCAGTGATATTGG + Intergenic
989131603 5:38112570-38112592 TCTCTGCCAGTCAGAGACATAGG - Intergenic
990863853 5:60358598-60358620 TATGTCACAATGGGTGACATGGG - Intronic
991316006 5:65307639-65307661 TCTCTAACAATGAATGAAATTGG - Intronic
991608425 5:68426335-68426357 CTTCTCATAATCAGTGGCATAGG + Intergenic
992247691 5:74843891-74843913 TGTCTCACTTTCAGTAACATTGG - Intronic
992568510 5:78026967-78026989 GCTCTCACAATCAATGAAAAGGG - Intronic
995401679 5:111749283-111749305 TCTCTCAGTAAAAGTGACATAGG - Intronic
996072551 5:119149944-119149966 TCTCTCACAATCAGTGCTAGTGG + Exonic
996279853 5:121716098-121716120 TCTCTGATAATCAGTGATGTTGG - Intergenic
996920236 5:128759868-128759890 TCTCTAATGATCAGTGATATTGG - Intronic
1000011509 5:157237745-157237767 TCTCTGGCACTCAGTGTCATTGG + Intronic
1004252579 6:14034278-14034300 TCTCTGCCAAACAGTGACCTGGG + Intergenic
1004579426 6:16934433-16934455 TCTTTCTCAATCCATGACATGGG + Intergenic
1012716673 6:102682305-102682327 TCTCTGACAATCAGTGATGTTGG - Intergenic
1013101634 6:106992125-106992147 TCTCACATAATCAGTCAAATGGG - Intergenic
1014228067 6:118871159-118871181 TCTCTGTTAATCAGTGATATTGG - Intronic
1015558414 6:134486897-134486919 TCTCTAATGATCAGTGACGTTGG + Intergenic
1016512520 6:144859541-144859563 CCTCTCACAAGCAGTGAATTAGG - Intergenic
1016564656 6:145439553-145439575 TCTTTAACGATCAGTGATATTGG + Intergenic
1017143048 6:151208931-151208953 TCTCTCTCCATCAGTGACTTTGG - Intergenic
1018570543 6:165205166-165205188 TCTCCCAGACTCAGTCACATAGG + Intergenic
1022953459 7:35360535-35360557 TCTCTCCCAGTCAATGAAATGGG + Intergenic
1023686957 7:42745911-42745933 CCTCTCACCATCAGTGAGAGGGG - Intergenic
1024316362 7:48021673-48021695 TCTCTGACAATCAATGAAACTGG - Intronic
1026735790 7:72947852-72947874 TCACTCACCCTCAGTCACATCGG - Intronic
1026786133 7:73302783-73302805 TCACTCACCCTCAGTCACATCGG - Intronic
1027981063 7:85223062-85223084 TCTCTGACAATTAGTGATGTTGG - Intergenic
1031315121 7:120247078-120247100 TGGCTCACAATCAGTAATATGGG + Intergenic
1031735424 7:125353692-125353714 TCTCTCTAAATAAGTGACTTTGG - Intergenic
1032145885 7:129380211-129380233 TCTCTCCTAAGCTGTGACATTGG + Intronic
1032196239 7:129790343-129790365 TCCCTCACACTCAGTCACACAGG - Intergenic
1034020011 7:147632229-147632251 TCCCTGATAATTAGTGACATTGG - Intronic
1036462914 8:8969994-8970016 TGGCTCACAATCAGTGTGATTGG + Intergenic
1037672362 8:21026143-21026165 TCTGTCTCAATAATTGACATGGG + Intergenic
1038949649 8:32400548-32400570 TCTCTGATGATCAGTGATATTGG - Intronic
1039173499 8:34776967-34776989 TCTATGACCATCAGAGACATTGG - Intergenic
1041404174 8:57479502-57479524 TCTCTAATCATCAGTGATATTGG + Intergenic
1042608400 8:70570683-70570705 TCCCTGACAATCAGTGATGTTGG - Intergenic
1043230450 8:77793861-77793883 TCTTCCAAAATCAGTGAGATGGG + Intergenic
1043294170 8:78643923-78643945 TCTCTAATAATCAGTGATGTTGG - Intergenic
1043732227 8:83696726-83696748 TCTCTAGTGATCAGTGACATTGG + Intergenic
1044286397 8:90415765-90415787 CCTCTCACAAGCAGTGAAACAGG + Intergenic
1046189806 8:110778797-110778819 TCTCTAATGATCAGTGATATTGG - Intergenic
1046197178 8:110881188-110881210 CCTCTCACAAGCAGTGAATTAGG - Intergenic
1047441074 8:124879239-124879261 TCTATCAGAATCAAAGACATGGG + Intergenic
1047754081 8:127905251-127905273 TCTCTCCCACTCAGGAACATGGG + Intergenic
1050003623 9:1104378-1104400 TCTCTCACGATCAGTGATGTTGG + Intergenic
1050167082 9:2776514-2776536 TCTCTAATGGTCAGTGACATTGG - Intronic
1050338834 9:4615677-4615699 TATCTCATATTCAGTGACAAGGG + Intronic
1055859901 9:80736826-80736848 TCTTTCAGAATGATTGACATTGG - Intergenic
1056130369 9:83580034-83580056 TCCCTGATAATTAGTGACATTGG - Intergenic
1062579775 9:137224074-137224096 TATCTTACAATCAGTGACACGGG - Intergenic
1062708919 9:137960948-137960970 TCTCTAATAATCAGTAACGTTGG + Intronic
1186330317 X:8525618-8525640 TCTCTAATGATCAGTGATATTGG + Intergenic
1187429691 X:19210966-19210988 TGTCTCTCCATCAGTCACATAGG + Intergenic
1188265458 X:28067854-28067876 TTTCTCACATTCAGTGGCTTCGG - Intergenic
1188642172 X:32520083-32520105 TTACTGACATTCAGTGACATGGG - Intronic
1192253795 X:69437344-69437366 TCTCTAATGATCAGTGATATTGG + Intergenic
1193557222 X:82969879-82969901 CTTCTCGAAATCAGTGACATGGG - Intergenic
1195424791 X:104716675-104716697 TCTCTAATAATCAGTGATGTTGG - Intronic
1196173965 X:112619691-112619713 TCTCTTCCAAGCAGTGACTTGGG - Intergenic
1196311815 X:114176914-114176936 TCCCTAACAATTAGTGATATTGG + Intergenic
1196524173 X:116712005-116712027 TATCTCACAAGCAATAACATAGG - Intergenic
1196741414 X:119029150-119029172 TCTCACACAATCTGTTACTTAGG + Intergenic
1197245497 X:124162394-124162416 TCTCTCACAAGCAGTGAATTAGG + Intronic
1197495360 X:127173005-127173027 CCTCTCACAAGCAGTGAATTAGG - Intergenic
1197875768 X:131104303-131104325 TCACTATCAATCAGTGATATCGG + Intergenic
1198552939 X:137763311-137763333 TCTCTGACCTTCAGTGAAATAGG - Intergenic
1199456679 X:148037206-148037228 CCTCTCTCAATCAGTCACACAGG - Intergenic
1199783062 X:151081238-151081260 TCTCTCCCAATCAGCCACACAGG - Intergenic
1200035434 X:153325311-153325333 TCTCTAATGATCAGTGATATTGG + Intergenic
1201432864 Y:13922962-13922984 TCTCTAATGATCAGTGATATTGG - Intergenic