ID: 962047980

View in Genome Browser
Species Human (GRCh38)
Location 3:131781060-131781082
Sequence CCTCATTAAAACATTTAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 168}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962047980 Original CRISPR CCTCATTAAAACATTTAGCC AGG (reversed) Intronic
900665616 1:3813552-3813574 CCTTATAAACACATTTAACCTGG + Exonic
904702761 1:32367830-32367852 CCTCATTACAGCTTATAGCCAGG + Intronic
906587103 1:46988516-46988538 CCTCATAAAAAGACTTAGCAAGG - Intergenic
908377225 1:63555902-63555924 TCTCTTTAAAAAAATTAGCCAGG - Intronic
908632926 1:66130208-66130230 CCTCCTTAAAAAGTTTAGCTTGG + Intronic
909443896 1:75726384-75726406 CCTCAGTAGACCATTTAACCTGG + Intronic
909982473 1:82118942-82118964 ATTCATTAAAACATTTGGGCTGG + Intergenic
910526952 1:88190405-88190427 CCTCAATAAGCCATTCAGCCTGG - Intergenic
911554247 1:99323863-99323885 CTTGATTAGAACATTTAGCCTGG - Intergenic
912485812 1:110027112-110027134 ACTCATTTAAAAAATTAGCCGGG + Intergenic
913427287 1:118747427-118747449 CTTAATTAAAAGATATAGCCTGG + Intergenic
915156886 1:153884439-153884461 CCTCAAAAAAAAAATTAGCCGGG + Intronic
916671508 1:167025943-167025965 CCTCAGTAAAAAATATAGACTGG + Intergenic
918668126 1:187177841-187177863 TCTCATTCTATCATTTAGCCTGG - Intergenic
923955747 1:239017711-239017733 AATCATTAAAACATTGAGCTTGG + Intergenic
1066395617 10:35018465-35018487 CCTCATTAAAGATTTTAGGCCGG + Intronic
1069657964 10:70104379-70104401 CCTCACTAAAGAATTTGGCCAGG + Intronic
1072558246 10:96542250-96542272 CCTAATTAAAACATGAGGCCAGG + Intronic
1072910377 10:99495751-99495773 CAGCATTAAGACATTTAGCATGG + Intergenic
1074506650 10:114076888-114076910 CATCAATGAAACATTTACCCAGG - Intergenic
1075858360 10:125651129-125651151 CCTCATAAAAAGATTTAGGGAGG - Intronic
1076247878 10:128961829-128961851 TCTTATTGAAACATTAAGCCCGG + Intergenic
1076663642 10:132072246-132072268 CCTTTTTAAAACGTTTAGGCTGG + Intergenic
1077951969 11:6968908-6968930 TTTTATTAAAACATTTACCCAGG - Intronic
1078769371 11:14333802-14333824 CGTCTCTAAAAAATTTAGCCAGG - Intronic
1079928444 11:26525979-26526001 CATCATTTAAACATTGATCCTGG - Intronic
1082148572 11:48702339-48702361 CCTCATTAAAAGAGTTAGGAAGG + Intergenic
1086573150 11:88307793-88307815 CCTAATGGATACATTTAGCCTGG - Intronic
1088129257 11:106467191-106467213 CCTCATTTAAAAATTCATCCAGG + Intergenic
1090071833 11:123550690-123550712 CCTCATTAAGACCTTAATCCAGG + Intronic
1090427909 11:126622526-126622548 CTTCATTACAAAAGTTAGCCAGG + Intronic
1090501159 11:127262714-127262736 CCTCTTCAGAACATTTATCCGGG + Intergenic
1091637945 12:2212144-2212166 CCCCATAAAAACATATAACCTGG - Intronic
1092357588 12:7809543-7809565 TTTCATAAAAACAATTAGCCAGG - Intergenic
1093871884 12:24302649-24302671 CCATATTAAAACTTTTAGCAGGG - Intergenic
1097009576 12:55942634-55942656 ACTCATTCAAACAATTAACCAGG + Intronic
1098021214 12:66158342-66158364 CCTCAAAAAAACATTCAGGCCGG + Intronic
1099139972 12:78960762-78960784 CTTCTTTAAAACTTTTAGCTAGG - Intronic
1099935832 12:89124259-89124281 CATATTTAAAACTTTTAGCCTGG + Intergenic
1102823929 12:115930892-115930914 CATCATAAAAATATTCAGCCAGG + Intergenic
1103057599 12:117833978-117834000 TTTCATTAAAAAAATTAGCCAGG + Intronic
1103709173 12:122898190-122898212 GCTCAATAAAACCTTTAGCTTGG - Intergenic
1104573248 12:129943953-129943975 CCTCCTTGAAACATCTAGGCTGG + Intergenic
1106140760 13:27009217-27009239 CCTCAATAAAACATTGATTCAGG - Intergenic
1111349473 13:87007500-87007522 GCTTATTAAAACAATTAGCTGGG - Intergenic
1113345062 13:109469081-109469103 CCTTTTTAAAACATTTTACCAGG + Intergenic
1113994503 14:16055144-16055166 CCTCATTAAAAGATTTAAAGTGG - Intergenic
1114915733 14:27262728-27262750 CCTCATTAAACCATTTAGTGAGG - Intergenic
1116273587 14:42802944-42802966 CCTCATTAAGACACTTTGACAGG + Intergenic
1117237069 14:53789539-53789561 CTGCATTAAAACACTTTGCCAGG + Intergenic
1118274649 14:64374887-64374909 AATCATTAAAAAAATTAGCCGGG - Intergenic
1118483461 14:66190005-66190027 CTCTATAAAAACATTTAGCCAGG - Intergenic
1122530290 14:102420631-102420653 ACAAATTAAAAAATTTAGCCAGG - Intronic
1125201072 15:37101080-37101102 ACTTAATAAAAAATTTAGCCCGG - Intronic
1125342058 15:38685055-38685077 CCTCATAAAAACACTTAGCCTGG - Intergenic
1126086723 15:45017515-45017537 CCTCATAAAATCATTTAGGGAGG + Intergenic
1126498598 15:49319992-49320014 CCTCATAAAATCATGGAGCCAGG - Intronic
1129803136 15:78431760-78431782 CAACAATAAAACAATTAGCCAGG + Intergenic
1135638726 16:24101376-24101398 TCTCAACAAAAAATTTAGCCAGG + Intronic
1136406119 16:30048406-30048428 GCTCATTAAAATATATAGCCAGG - Intronic
1143807705 17:9442886-9442908 ACTCATTAAAACATTTAGAGAGG + Intronic
1144809674 17:17990694-17990716 ACTTTTTAAAACATTTGGCCGGG + Intronic
1145899210 17:28479051-28479073 CCTCACTAAAAAAATTAGCCAGG + Intronic
1147745913 17:42694465-42694487 GCTAATTAAAAAATTTTGCCAGG - Intronic
1149383061 17:56113387-56113409 CCTCATTAAAGAAGTCAGCCTGG - Intronic
1149726830 17:58903541-58903563 CCTCATTTAAACAGGTAACCAGG - Intronic
1149797733 17:59536223-59536245 CTTCATTAAAAAAAATAGCCTGG + Intergenic
1151716136 17:75831956-75831978 TCTCAAAAAAACAATTAGCCAGG + Intronic
1151849077 17:76679125-76679147 TCTCTATAAAACAATTAGCCAGG + Intronic
1154245470 18:12693111-12693133 CACTATTAAAACTTTTAGCCAGG - Intronic
1155255082 18:23988945-23988967 CAAAAATAAAACATTTAGCCAGG + Intergenic
1155947257 18:31869020-31869042 CATTATTAAAGCATTTAGCAAGG + Intronic
1158296828 18:56006903-56006925 CATAATTAAAACATTTAGTTTGG + Intergenic
1159196126 18:65117773-65117795 ACTAATTAAAACATTTAGAATGG - Intergenic
1164555436 19:29247445-29247467 CCTCATTTAAAAATTTAGCTTGG + Intergenic
1165269500 19:34692930-34692952 CACCATTAAAACATTTATCCTGG - Intergenic
1166681621 19:44771174-44771196 TCTCAATAAAACAGTTAGGCTGG - Intergenic
925793483 2:7518033-7518055 CCACATTAAATCAGTTACCCTGG - Intergenic
926161136 2:10490369-10490391 CCCCATTCAAACATTTAGGGTGG + Intergenic
931658208 2:64529788-64529810 ACTAATAAAAACAATTAGCCAGG - Intronic
935689030 2:105713781-105713803 CATCATACAAACATTCAGCCCGG + Intergenic
936697337 2:114966177-114966199 CCTCATTCAACCATCTACCCAGG - Intronic
941295432 2:163733580-163733602 CCTCCTTAAAACATTTCTCAGGG + Intronic
941489837 2:166129757-166129779 ATTCATTAAAACATGTGGCCAGG - Intergenic
941925303 2:170888346-170888368 TCTCTTTAAAAAAATTAGCCAGG + Intergenic
942392188 2:175507095-175507117 CCTCATTAAATGAGTTAGGCAGG - Intergenic
946449507 2:219767836-219767858 CCTCATGACCACATTTAGACTGG + Intergenic
947533928 2:230929159-230929181 CCCCACTTAAACATTGAGCCCGG + Intronic
1169489006 20:6055800-6055822 AATAATTAAAACATTAAGCCAGG + Intergenic
1169615287 20:7436657-7436679 TCCTATGAAAACATTTAGCCTGG - Intergenic
1171865875 20:30487385-30487407 CCTCATTAAAAGATTTAAAGTGG + Intergenic
1173006842 20:39146410-39146432 CCTCATTTAAACAGTTTCCCAGG + Intergenic
1173270486 20:41529898-41529920 CCTCATGAAAACATGGAGGCAGG - Intronic
1173760579 20:45556447-45556469 CATCAACAACACATTTAGCCCGG + Intronic
1174874652 20:54213823-54213845 CCTTATTAAGACATTTAAACAGG + Intronic
1175565337 20:59970933-59970955 CCACATTACAACAATTAGGCGGG + Intronic
1177561525 21:22760310-22760332 CCTCTTTAAAACCTATAGCTTGG - Intergenic
1180312588 22:11252260-11252282 CCTCATTAAAAGATTTAAAGTGG + Intergenic
1181448378 22:22998202-22998224 CCCCATTAAAAGATATAGACTGG + Intergenic
1181886271 22:26024655-26024677 CCTCATGAAGCCCTTTAGCCGGG + Intronic
1182955501 22:34420922-34420944 AATCAATAAAACATTTAGACAGG - Intergenic
1183170503 22:36184139-36184161 TCTGATTAAAATATTTAGGCAGG - Intergenic
949846328 3:8374066-8374088 CCCAATTAAAAGATATAGCCTGG + Intergenic
957934482 3:86924909-86924931 CTTCATAAAAACATCTAGACTGG - Intergenic
960023745 3:112985869-112985891 CCTAATTAAGAAATTAAGCCTGG + Intergenic
961030934 3:123603205-123603227 TCTCAATAAAATAATTAGCCGGG - Intergenic
961524219 3:127486385-127486407 CCTCATAAAAACCTTTCCCCTGG + Intergenic
961912178 3:130329395-130329417 CCTTATTAAAACAGTCAGCTAGG - Intergenic
962047980 3:131781060-131781082 CCTCATTAAAACATTTAGCCAGG - Intronic
962768621 3:138592168-138592190 CCTTGTTAAGACATTTAGCTGGG + Intronic
963540196 3:146577094-146577116 TGTTATTTAAACATTTAGCCTGG + Intronic
965526300 3:169722694-169722716 CCACATTAAAACATTTCCACAGG - Intergenic
967546352 3:190733389-190733411 TCTGATTAAATCACTTAGCCTGG - Intergenic
971194670 4:24461082-24461104 ACAAATAAAAACATTTAGCCAGG - Intergenic
971460373 4:26889660-26889682 CCTCATTAGCACCTGTAGCCAGG + Intronic
973183976 4:47301471-47301493 CTACAATAAAAAATTTAGCCAGG + Intronic
973192229 4:47398743-47398765 CCTCACACAAAAATTTAGCCGGG - Intronic
974870377 4:67636202-67636224 CCTCACTAAATCATTCATCCAGG - Intronic
975212623 4:71718939-71718961 CCTCATTAAAAAAGTTAGGGAGG + Intergenic
975986342 4:80203709-80203731 CCTCATTCAAATATTTACCCGGG + Exonic
976133908 4:81913969-81913991 CCTCATTAAAACATTACAACCGG + Intronic
976139452 4:81975725-81975747 CCTCATAAAAACATGTATGCAGG + Intronic
976720565 4:88165077-88165099 TCTAATTAAAACATTTACCTCGG - Intronic
977404494 4:96578402-96578424 CCTCATAAAATCAGTTAGCGAGG + Intergenic
984690944 4:182725319-182725341 CTTCAAAAAAACAATTAGCCAGG - Intronic
985871432 5:2560366-2560388 CCTGATTAAGAAATGTAGCCTGG + Intergenic
987081212 5:14427209-14427231 CCTCATCTAAACATCTCGCCTGG + Intronic
987113102 5:14705153-14705175 TCACATTAAAATATTTAGCTGGG - Exonic
987425255 5:17765909-17765931 CCACATAAAAAAAATTAGCCAGG - Intergenic
990405144 5:55482278-55482300 CCTCATTAAAACAGTTTTTCGGG - Intronic
991445230 5:66692614-66692636 ACTCATTAAATCATTTTGCTAGG + Intronic
992737091 5:79733051-79733073 CTTCATCCAAACATTTAGCTTGG + Exonic
992786146 5:80172522-80172544 CATCATTAAAACATTTTAGCTGG - Intronic
993044637 5:82853516-82853538 CCACATTAAAACAATCAGTCTGG - Intergenic
993509026 5:88748208-88748230 CCTAATTAAAATATTTTGCCAGG - Intronic
994509474 5:100685462-100685484 TCTCATTAAAAAATTTGGCATGG - Intergenic
1000844539 5:166263041-166263063 TTTTATTAAAATATTTAGCCTGG - Intergenic
1004243027 6:13944965-13944987 CCTAAGAAGAACATTTAGCCGGG + Intronic
1007349141 6:41255948-41255970 CCTCACTGAAGCATTTTGCCAGG + Intergenic
1007867908 6:44993944-44993966 CTTCTTTAAGACATTTAGGCAGG - Intronic
1011677203 6:89746287-89746309 CCTCACTAAAAAAGTTTGCCGGG + Intronic
1013084245 6:106841947-106841969 CCACATCCAAACATTGAGCCTGG + Intergenic
1014477920 6:121897431-121897453 CCTCACTAAAATATTTCACCTGG + Intergenic
1014799986 6:125768043-125768065 CCTCAGAAAAAAAATTAGCCAGG - Intergenic
1015424939 6:133054763-133054785 CCGCCTTAAAACTTTTTGCCTGG + Intergenic
1016511339 6:144846617-144846639 CCTCATTGAAGCATTAAGCCAGG + Intronic
1018520704 6:164647300-164647322 CCTAATTAAAAGATATAGACTGG + Intergenic
1018666379 6:166141989-166142011 TCTCATTAAAACTTTCAGCTGGG + Intergenic
1024447500 7:49498273-49498295 CATAATTAAAATATTGAGCCTGG - Intergenic
1026381722 7:69806627-69806649 GCTCATCAAAAAAATTAGCCAGG - Intronic
1026875328 7:73876166-73876188 GATCATAAAAACAATTAGCCAGG - Intergenic
1027159450 7:75791617-75791639 CCTCATTAAAACTTACAGCCTGG - Intergenic
1027159547 7:75792255-75792277 CCTCATTAAAACTTACAGCCAGG - Intergenic
1027947079 7:84760916-84760938 GCACATTCAAACATTTAACCAGG - Intergenic
1028403763 7:90454341-90454363 TCTCATATAAACATATAGCCAGG + Intronic
1030537857 7:110791388-110791410 TCTCTTTAAAATATTTTGCCAGG + Intronic
1031011931 7:116533610-116533632 CCTGGCTAAAACAATTAGCCGGG - Intronic
1033488366 7:141814357-141814379 CCTCATTAAAAAAATAGGCCAGG - Intergenic
1034851219 7:154495688-154495710 ACTCATTAAAACATATATACAGG - Intronic
1036929750 8:12944032-12944054 TCTCATCAAGACACTTAGCCAGG + Intergenic
1037332596 8:17758556-17758578 CTTGATTTAAACATTTAGCTTGG - Intronic
1039343228 8:36673957-36673979 TCCCATTAAAAAATGTAGCCTGG - Intergenic
1041938603 8:63361862-63361884 CATCATCAAATCATTAAGCCAGG - Intergenic
1044682895 8:94799900-94799922 CATCATTAACCCATTTAGGCTGG + Intergenic
1045028569 8:98113982-98114004 CTGCTTAAAAACATTTAGCCTGG + Intronic
1045038707 8:98199838-98199860 CCTCATCAACACATTTTCCCAGG + Intronic
1045202775 8:100002563-100002585 CATCATTCATATATTTAGCCAGG - Intronic
1047528119 8:125651039-125651061 TATGATTAAAACATTTAGTCAGG + Intergenic
1048156231 8:131956411-131956433 GCTCATTAACATATTTTGCCTGG - Intronic
1048526425 8:135207069-135207091 TATCATTAAAACACTTAGCATGG + Intergenic
1050286623 9:4109511-4109533 CCTCATTAAAACATATCTCTTGG - Intronic
1053079162 9:35160293-35160315 CCTCTTTAAAGAATTTAGGCCGG - Intergenic
1054729705 9:68688880-68688902 AATCATTAAAAAATTTTGCCAGG + Intergenic
1055859839 9:80735653-80735675 TCTCAGTAAAAAATTTACCCTGG + Intergenic
1059245307 9:112844623-112844645 CCTTCTTAAAACATTTATCTTGG - Intronic
1060526611 9:124324560-124324582 CCTCATTACAGCATTTAAGCAGG - Intronic
1060956245 9:127642653-127642675 CAACATTAAAACATTTAGTAAGG - Intronic
1186245894 X:7616538-7616560 CCTCACAAAAGCATTTAGCCAGG - Intergenic
1186487912 X:9947837-9947859 CCTCCTTAAATCGTTTAGCATGG + Exonic
1187008235 X:15252936-15252958 GCTCAAAAAAACATTTGGCCAGG + Intronic
1193305366 X:79944480-79944502 CCCCAATAAAACATTTTGGCTGG - Intergenic
1199360232 X:146908533-146908555 CATCATTAAAAAATGTAGCAAGG + Intergenic
1201464382 Y:14264385-14264407 CCTAACAAAAGCATTTAGCCAGG - Intergenic