ID: 962048134

View in Genome Browser
Species Human (GRCh38)
Location 3:131783212-131783234
Sequence GTACTTGCTTATTATAGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 91}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962048134 Original CRISPR GTACTTGCTTATTATAGTGG AGG (reversed) Intronic
901803904 1:11725735-11725757 GTACTTCCTTTTTAAAGTTGGGG + Exonic
906258672 1:44369519-44369541 GTAAGTGATTATTATTGTGGTGG + Intergenic
907426631 1:54383801-54383823 GTTCTTGCTTTTTATAAAGGGGG - Intronic
911452498 1:98081763-98081785 CTAATTGCTTATTGTATTGGTGG + Intergenic
919293618 1:195665906-195665928 GTCCTTGTGTATAATAGTGGAGG + Intergenic
919339115 1:196281061-196281083 TTATTTGCTTATTTTTGTGGGGG + Intronic
919515048 1:198511863-198511885 GTAATTGCTTATTTTAGTTTTGG + Intergenic
919549773 1:198970471-198970493 GTTGTTGCTTTTTTTAGTGGGGG + Intergenic
920202445 1:204267890-204267912 GGTCCTGCTTATTATGGTGGGGG - Intronic
921282369 1:213579420-213579442 GTACTTTTTTGTTATAGAGGTGG - Intergenic
921505470 1:215963567-215963589 GTGCCTGCATATTTTAGTGGAGG - Intronic
1065438851 10:25728570-25728592 ATAGTTGCTTATTGTTGTGGTGG + Intergenic
1066397351 10:35039282-35039304 GTTCTTGCTTATAAGACTGGTGG - Intronic
1070336207 10:75457002-75457024 GTAATTGCTTATTCTAGAAGAGG + Intronic
1071505106 10:86227362-86227384 GAACTTGCTCATAGTAGTGGGGG + Intronic
1080331093 11:31139774-31139796 GTAGTTGAATATTAGAGTGGAGG - Intronic
1092980089 12:13786153-13786175 GTACCTGCTTAGTTTAGTCGAGG - Intronic
1093235967 12:16608664-16608686 TTACTTGCTTATAAGTGTGGGGG - Intronic
1105817889 13:24053180-24053202 GTACTTGCATTTTATAATCGTGG + Intronic
1113100159 13:106708854-106708876 GTTTTTTCATATTATAGTGGAGG - Intergenic
1118726953 14:68635309-68635331 TTACCTGCTTTATATAGTGGAGG + Intronic
1120475854 14:84985766-84985788 TTACTTGCTAATTATATTTGGGG + Intergenic
1121385739 14:93522726-93522748 ATACTATCTTATTATAGTAGTGG + Intronic
1125586850 15:40826820-40826842 GTACTTGCTTAATGGAGTTGTGG + Intronic
1126684347 15:51234455-51234477 GTGCTTGCTCGTTACAGTGGGGG - Intronic
1139639375 16:68279954-68279976 GAACTTGCTTGTCATAGTAGTGG + Intronic
1140342788 16:74181851-74181873 CTTCTTGCTTATTGTAGTGGAGG + Intergenic
1140598115 16:76440463-76440485 GTACTTGCCGATAATTGTGGAGG - Intronic
1149109658 17:53012842-53012864 GTACTTGGCTTTTATACTGGAGG + Intergenic
1149984672 17:61338313-61338335 GAATTTGCTTATTATAGTAAAGG - Intronic
1151519537 17:74618268-74618290 GCACTTGCTTAAGATATTGGGGG - Intronic
1155357520 18:24967689-24967711 GTACTTGGTTATTATTGAGAAGG - Intergenic
1168612479 19:57812438-57812460 GTACTTGGTTATCTTGGTGGTGG - Intronic
925867375 2:8240616-8240638 GTACTTGCATTTTAGAGTGAAGG - Intergenic
932092683 2:68820407-68820429 GCACTAGCTTGTTATAGAGGAGG + Intronic
932184341 2:69679515-69679537 CTATTTGCTTATTTTTGTGGGGG + Intronic
941129652 2:161630985-161631007 GTACTTTCATATTTTATTGGAGG - Intronic
944954655 2:204794485-204794507 GTATTTGCTGATTACCGTGGTGG + Intronic
1169407566 20:5335536-5335558 TTACTTGCTAATTATAAAGGAGG + Intergenic
1174249110 20:49205175-49205197 GTATTTTCGTATTATACTGGAGG + Intergenic
1180010158 21:45044024-45044046 GTAGCTGGTTATTAGAGTGGTGG - Intergenic
1182055589 22:27352103-27352125 GGACTTGCTTCTTATAAAGGAGG + Intergenic
949641706 3:6043112-6043134 GCACTTGTTTATTATTGTCGTGG + Intergenic
950340971 3:12244064-12244086 TAACTTGCTTAGTAAAGTGGAGG - Intergenic
954010743 3:47635411-47635433 GTCCTAGTTTGTTATAGTGGTGG - Intronic
954624016 3:52012610-52012632 GTGCTAGATTATTATATTGGGGG + Intergenic
955136535 3:56224499-56224521 GTACTTGTTTATTATTGTAAGGG + Intronic
957373055 3:79321015-79321037 GTAGTTACATATTATATTGGGGG - Intronic
959571549 3:107889897-107889919 GTACCTGAGTATTAAAGTGGAGG + Intergenic
962048134 3:131783212-131783234 GTACTTGCTTATTATAGTGGAGG - Intronic
967428403 3:189353905-189353927 CTACTTGCCCATTAAAGTGGAGG + Intergenic
969879788 4:10163510-10163532 GTACTTGCTTATTATAAACTTGG + Intergenic
970181417 4:13400144-13400166 GAACTTGGATATTATAGTGGAGG - Intronic
970755762 4:19424519-19424541 CTCCTTGCTTATTATATAGGTGG - Intergenic
970803785 4:20006238-20006260 TTACTTGCAGATTATAGTGCTGG - Intergenic
972205715 4:36769987-36770009 GTACTTTCTTACTATAATTGGGG + Intergenic
973156965 4:46967563-46967585 ATACTGGTTTATTATACTGGTGG + Intronic
973334363 4:48941418-48941440 GTACCTTCTCATTGTAGTGGTGG + Intergenic
975622633 4:76309000-76309022 GTACTTGATTTTAATAGAGGGGG + Intronic
977386342 4:96344493-96344515 GTACTCCCTACTTATAGTGGTGG - Intergenic
980396989 4:132227110-132227132 GTACTTGTTTTCTATCGTGGTGG - Intergenic
983966183 4:173813991-173814013 TTACTTGCTTAATATTTTGGGGG - Intergenic
984735582 4:183104787-183104809 ATAGTTGCTTAGTATATTGGAGG + Intronic
993817056 5:92562031-92562053 GTACCTCCTTATTTTGGTGGAGG - Intergenic
997610466 5:135212390-135212412 GGACTTGCTTCTTAAAGTGGAGG + Intronic
1001368138 5:171165701-171165723 GTACATGCTGAAAATAGTGGAGG + Intronic
1004739231 6:18441217-18441239 ATAATTGATTTTTATAGTGGAGG - Intronic
1005618333 6:27596709-27596731 GTATTTGCTTATTGAAGGGGTGG + Intergenic
1007012796 6:38433817-38433839 GAACTTACATATTATGGTGGAGG - Intronic
1008248272 6:49205936-49205958 GTACCTACTTATTATTTTGGGGG + Intergenic
1009988634 6:70813195-70813217 GTACTGGCCTATGATAGTGTAGG + Intronic
1011043631 6:83058221-83058243 GGACTTGCATATTATGGTGATGG - Intronic
1021094681 7:16522339-16522361 GTTTTTGATTATTAGAGTGGTGG - Intronic
1021130621 7:16908325-16908347 GTACTAGCTAATTATTTTGGGGG + Intergenic
1021309360 7:19073911-19073933 GTACTTGCTCATGTTAGTGGTGG - Intronic
1021531330 7:21649186-21649208 GTACTAACTTATAATACTGGTGG - Intronic
1023813187 7:43928181-43928203 GCACTCACTTATTATTGTGGGGG + Intronic
1028543318 7:91969561-91969583 ATACTTGCTTTTTATACTTGGGG + Intronic
1028933923 7:96444695-96444717 GTTCTTGCCTATTACAGTGGAGG + Intergenic
1031782953 7:125993310-125993332 CTACTTTCATATTATTGTGGTGG + Intergenic
1032605477 7:133346224-133346246 GTGCTTGCTGCTTTTAGTGGAGG + Intronic
1032622535 7:133551070-133551092 GTACTGGCTTAGAATAGTGTGGG - Intronic
1040962571 8:53050449-53050471 GTACTTGCTTGTTTTTGTGATGG + Intergenic
1045951422 8:107855682-107855704 GTACCAGCTTAATATAGTAGTGG + Intergenic
1046502181 8:115092886-115092908 GTTCTTGGTTATTTTATTGGTGG + Intergenic
1046747263 8:117889584-117889606 GTACTTGCATATCATTGTGGAGG - Intronic
1047663970 8:127069464-127069486 GTACTTTTATATTATAGAGGTGG - Intergenic
1047995546 8:130331538-130331560 TGCCTTCCTTATTATAGTGGAGG + Intronic
1048548649 8:135412509-135412531 GTACTTTCTTATTCTAGTTTGGG + Intergenic
1049208449 8:141374353-141374375 TTCCTTGCTTATGACAGTGGAGG - Intergenic
1050156237 9:2669090-2669112 CCACTTACTTATTATAGTCGTGG + Intergenic
1050804697 9:9659426-9659448 TTTGTTGCTTATTATACTGGGGG + Intronic
1054917179 9:70505889-70505911 GTACTTTCTTATTAATGTGTAGG + Intergenic
1057511000 9:95679596-95679618 GAACTTGCTTATTAGAGTTTGGG - Intergenic
1058680892 9:107439347-107439369 GTGCTTTCTTGGTATAGTGGGGG - Intergenic
1187881492 X:23851532-23851554 GTACATGGTCATTATAGTGTTGG + Intronic
1188679624 X:32985892-32985914 GTATTTGCTTTTCATTGTGGGGG + Intronic
1194535441 X:95101296-95101318 GTATTTGCTAATTATTGTGGTGG + Intergenic
1197506751 X:127314753-127314775 ATACTTGTTTTTTATAGTTGTGG - Intergenic