ID: 962050728

View in Genome Browser
Species Human (GRCh38)
Location 3:131812139-131812161
Sequence CTGCATCCTAATTGCAATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 97}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962050728_962050730 -1 Left 962050728 3:131812139-131812161 CCAGGATTGCAATTAGGATGCAG 0: 1
1: 0
2: 0
3: 8
4: 97
Right 962050730 3:131812161-131812183 GTCTTTATGGCTCCCCAAGAAGG 0: 1
1: 0
2: 0
3: 4
4: 82
962050728_962050735 13 Left 962050728 3:131812139-131812161 CCAGGATTGCAATTAGGATGCAG 0: 1
1: 0
2: 0
3: 8
4: 97
Right 962050735 3:131812175-131812197 CCAAGAAGGAATAGAGAAGGTGG 0: 1
1: 0
2: 2
3: 58
4: 542
962050728_962050731 10 Left 962050728 3:131812139-131812161 CCAGGATTGCAATTAGGATGCAG 0: 1
1: 0
2: 0
3: 8
4: 97
Right 962050731 3:131812172-131812194 TCCCCAAGAAGGAATAGAGAAGG 0: 1
1: 0
2: 0
3: 21
4: 276
962050728_962050736 24 Left 962050728 3:131812139-131812161 CCAGGATTGCAATTAGGATGCAG 0: 1
1: 0
2: 0
3: 8
4: 97
Right 962050736 3:131812186-131812208 TAGAGAAGGTGGAAATAAGTTGG 0: 1
1: 0
2: 0
3: 25
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962050728 Original CRISPR CTGCATCCTAATTGCAATCC TGG (reversed) Intronic
907513372 1:54978794-54978816 CTGGGTGCTAATTGAAATCCAGG - Intergenic
917300905 1:173573111-173573133 CTGCTTCCTAATTCTAATTCTGG + Intronic
917864147 1:179177251-179177273 CTGAACCCTAGTTGCAAGCCAGG + Intronic
917911795 1:179655531-179655553 CTGCATCCCAATTGCAGTGTTGG - Intronic
918061863 1:181068651-181068673 CTGCATCCTGATTGCAGTGGTGG + Intergenic
919402792 1:197140317-197140339 CTTCATCCTTATTGCAGTTCTGG - Intronic
920356436 1:205376727-205376749 CTGCAGCCTCCTTGAAATCCTGG + Intergenic
920901898 1:210116956-210116978 ATGCATGCTTATTGCATTCCAGG - Intronic
921751910 1:218804478-218804500 CTGCCTCCTAAGTGCAAAGCTGG + Intergenic
1062805385 10:415994-416016 CTGCATCCTAGATGCGATCCTGG + Intronic
1065484137 10:26220628-26220650 CTGCATTCATAGTGCAATCCTGG + Intronic
1066804311 10:39228999-39229021 CTGCATTCTAGTTTTAATCCTGG - Intergenic
1066804734 10:39235342-39235364 CTGCATTCTAGCTGTAATCCTGG - Intergenic
1068926470 10:62544715-62544737 CTGCAACCTAATTGCCATCTTGG - Intronic
1072933217 10:99686324-99686346 CTGCATAGTAATTGCAATGAAGG - Intronic
1074960567 10:118441679-118441701 GTGCATCCTGATTTCCATCCTGG - Intergenic
1079032457 11:16995826-16995848 CTGCATCCTAATTACGACCTTGG - Intronic
1083660202 11:64248555-64248577 CTGCATCCAAACTCCAACCCAGG + Intergenic
1083734750 11:64673159-64673181 CTGCCTGCTACTTGCAGTCCAGG + Intronic
1084760639 11:71268458-71268480 CAGCATCCTAGTTGCAGCCCTGG - Intergenic
1087971127 11:104485600-104485622 TTGCATTCTAATAGCAACCCTGG + Intergenic
1088365858 11:109039114-109039136 CTGCATCCCAGTTTCAAACCAGG - Intergenic
1090545902 11:127767821-127767843 CTGCAGGATAATTGCAATGCTGG + Intergenic
1092110189 12:5955194-5955216 CTGCCTGCTAATTGCAATACTGG - Intronic
1092445480 12:8552450-8552472 CTAAATCCAAAGTGCAATCCTGG + Intergenic
1100044967 12:90368622-90368644 CTGCATCCTGTTTGGAAGCCGGG + Intergenic
1102435388 12:112918900-112918922 CTGCATACTAAATTCCATCCTGG - Intronic
1108716933 13:53090181-53090203 CTGCTTCCTACTTGCAAGCAGGG + Intergenic
1114261150 14:21037226-21037248 CGGCTTCCCAACTGCAATCCTGG + Intronic
1116023968 14:39494142-39494164 CTGCCTCTGAATTGCCATCCTGG + Intergenic
1122887988 14:104719040-104719062 CTGCTTCCTAAAGGCAACCCTGG + Exonic
1134264811 16:12683882-12683904 CTGGATCCTTATTGAAATCCTGG - Intronic
1136739382 16:32501619-32501641 CTTCCTCCTAATTGTCATCCGGG - Intergenic
1143385677 17:6529024-6529046 CTGCATGCTAATTCTCATCCTGG + Intronic
1143882399 17:10039789-10039811 CAGCATCCTAATGTCAATCGAGG + Intronic
1144212252 17:13025580-13025602 TTTCATCCTCATGGCAATCCTGG - Intergenic
1146108047 17:30061138-30061160 CTGCCTCCTCATTGCTGTCCTGG - Intronic
1153255005 18:3161710-3161732 CTAGATCCTAATTAAAATCCTGG + Intronic
1155399230 18:25419846-25419868 GTGCATCCTAATTAGCATCCTGG - Intergenic
1155601789 18:27557364-27557386 CTGAATCATAATTTCACTCCAGG - Intergenic
1158535536 18:58305066-58305088 CTGCATCCCATCTGCATTCCGGG + Intronic
1158718418 18:59900464-59900486 CTGCATCCCAATCGCAAATCCGG - Intronic
1165327229 19:35121171-35121193 CTGCATCCTGGCTGTAATCCTGG + Intronic
926498281 2:13618743-13618765 CTGCATCCTTATTGCTATGTAGG - Intergenic
934153282 2:89170863-89170885 CTGCATCCAGTTTGCAATCTGGG - Intergenic
934157112 2:89213537-89213559 CTGCATCCACTTTGCAATCAGGG - Intergenic
934161491 2:89253659-89253681 ATGCATCCAATTTGCAAACCTGG - Intergenic
934165059 2:89286810-89286832 CTGCATCCAGTTTGCAATCTGGG - Intergenic
934202214 2:89895652-89895674 CTGCATCCAGTTTGCAATCTGGG + Intergenic
934205790 2:89928756-89928778 ATGCATCCAATTTGCAAACCTGG + Intergenic
934210205 2:89969207-89969229 CTGCATCCGCTTTGCAATCAGGG + Intergenic
934213954 2:90011068-90011090 CTGCATCCAGTTTGCAATCTGGG + Intergenic
936461332 2:112715586-112715608 CAGCCTCCTTATTGCTATCCTGG - Intergenic
938106020 2:128530329-128530351 CTGCATCCTCATCACCATCCAGG - Intergenic
938746359 2:134282157-134282179 CTTAATCCTCATTGCATTCCTGG - Intronic
943805730 2:192122903-192122925 ATGCTTCCTAATTGCATTTCTGG - Intronic
946466822 2:219919546-219919568 CTGCATGCTAACAACAATCCTGG - Intergenic
1168818516 20:757422-757444 GTGCATCCTTACAGCAATCCTGG + Intergenic
1174917815 20:54671663-54671685 GAGCATCCTATTTGCATTCCAGG - Intergenic
1178135044 21:29617771-29617793 CTGCATCCTTAATGCATTTCAGG + Intronic
1182607816 22:31520644-31520666 CTGCATCATAATTAAAATCCAGG + Intronic
949667613 3:6358567-6358589 CTGCAACCTAGCTGCAAGCCAGG - Intergenic
953365517 3:42341095-42341117 CAGTATCCTAATTTCTATCCTGG - Intergenic
953753001 3:45623740-45623762 CTGCATCCTACCTGGCATCCTGG - Intronic
956078575 3:65533094-65533116 TTGCATTCTTTTTGCAATCCAGG - Intronic
958776868 3:98495840-98495862 TGGCAACCTAATTGCATTCCTGG - Intergenic
958820176 3:98964556-98964578 CTGTAACCTAATTGCAAGCGAGG + Intergenic
962050728 3:131812139-131812161 CTGCATCCTAATTGCAATCCTGG - Intronic
962679380 3:137782831-137782853 CTGCATCCTGATTGTAATAATGG + Intergenic
965836035 3:172853941-172853963 CTGCATCCTAATTACCAATCAGG - Intergenic
966343911 3:178957058-178957080 CTGGACCCTAACTGCAAGCCAGG + Intergenic
967650195 3:191976117-191976139 CTGCATACTAATTGTATTCATGG + Intergenic
982038671 4:151373029-151373051 CAGCATCCTTATGGCAATCCAGG + Intergenic
983387731 4:167086977-167086999 CTGCATCATGATTGCTATCTGGG - Intronic
987052977 5:14163636-14163658 CTGCATCCTGATTGGGATTCTGG + Intronic
991414473 5:66378561-66378583 CTGCTTCCTATTTGTCATCCTGG - Intergenic
1000644798 5:163748281-163748303 CTCCTTCCCAATTACAATCCAGG - Intergenic
1000700900 5:164448533-164448555 GGGCATCTTAATTCCAATCCTGG - Intergenic
1000912433 5:167038304-167038326 CTGCTTCCTTGCTGCAATCCTGG + Intergenic
1002930433 6:1630719-1630741 CTACATCTGAATTGCAATCGTGG + Intronic
1008350686 6:50486527-50486549 CTCCAACCCAATTGCACTCCTGG + Intergenic
1012418924 6:99040368-99040390 ATGAATCCTCTTTGCAATCCAGG - Intergenic
1013150292 6:107439282-107439304 CTGGATCCTAGTAGCAAGCCAGG - Intronic
1021908141 7:25356216-25356238 TTGCATGGTAGTTGCAATCCTGG + Intergenic
1021984944 7:26089308-26089330 CTGCATCCTCACCGCAAACCTGG + Intergenic
1023729477 7:43176890-43176912 CTGCTTCGTAATTGCAATGCAGG - Intronic
1027244204 7:76355341-76355363 GTTCATCCTCATTGCAGTCCTGG - Intronic
1040276347 8:46016007-46016029 ATGCATCCTGGTTGCAAGCCAGG + Intergenic
1040277075 8:46019231-46019253 ATGCACCCTGGTTGCAATCCAGG + Intergenic
1042835400 8:73075229-73075251 GTGCATCCTAAGAGCAAGCCAGG + Intronic
1043682903 8:83053129-83053151 CCTCATCCTAATTGGAATCAAGG - Intergenic
1043712136 8:83434887-83434909 CTGAATCAGAATTGGAATCCAGG - Intergenic
1044248166 8:89975275-89975297 ATGCCTCCTAATTTAAATCCAGG + Intronic
1044917296 8:97128765-97128787 GTGCATCCCAATTGCTCTCCAGG - Intronic
1048107280 8:131425268-131425290 TTGCATTCTAATTGGAATACAGG - Intergenic
1051098385 9:13492927-13492949 CTGTATCCTAAATGCTTTCCTGG - Intergenic
1051307244 9:15724952-15724974 CTGCATCCTTATGGAAAGCCTGG - Exonic
1051701479 9:19828890-19828912 CAACATCCTATTTGCAATCTAGG + Intergenic
1056208295 9:84340899-84340921 TGGCATCCTATTTGCACTCCTGG + Intergenic
1057128496 9:92637667-92637689 TTGGATCCTCATTGCAACCCGGG - Intronic
1060712640 9:125884456-125884478 CTGCTTCATAATTGCAAACCTGG - Intronic
1194161907 X:90464560-90464582 ATGAATCATAAGTGCAATCCTGG + Intergenic
1197872283 X:131071583-131071605 CTGGATCTTATTTCCAATCCAGG + Intronic
1198487381 X:137101691-137101713 CTGCATCATAATGGAAATCTAGG + Intergenic
1200508190 Y:4042305-4042327 ATGAATCATAAGTGCAATCCTGG + Intergenic
1201665644 Y:16450553-16450575 TTGCATCATCATTGCACTCCAGG + Intergenic