ID: 962053720

View in Genome Browser
Species Human (GRCh38)
Location 3:131846697-131846719
Sequence GAGATGACTGTTCAGTTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 248}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962053717_962053720 -6 Left 962053717 3:131846680-131846702 CCTACCCACACAGTAAGGAGATG 0: 1
1: 1
2: 0
3: 9
4: 145
Right 962053720 3:131846697-131846719 GAGATGACTGTTCAGTTTTCTGG 0: 1
1: 0
2: 2
3: 31
4: 248
962053718_962053720 -10 Left 962053718 3:131846684-131846706 CCCACACAGTAAGGAGATGACTG 0: 1
1: 0
2: 0
3: 15
4: 112
Right 962053720 3:131846697-131846719 GAGATGACTGTTCAGTTTTCTGG 0: 1
1: 0
2: 2
3: 31
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962053720 Original CRISPR GAGATGACTGTTCAGTTTTC TGG Intronic
903003457 1:20282779-20282801 GAGATGACTGCTCTGTCATCAGG - Intergenic
903687421 1:25142045-25142067 GAGATGACAGCTCAGGTCTCTGG + Intergenic
903823494 1:26122847-26122869 GAGAAGAGAGTCCAGTTTTCTGG + Exonic
903980151 1:27180469-27180491 GACATGACTGACCAGTTTGCTGG - Intergenic
904017744 1:27435770-27435792 TAGATGACTGCTCATTCTTCTGG + Intronic
905626570 1:39493447-39493469 GAGATGACATTTCTGTTGTCAGG + Intronic
905670325 1:39787009-39787031 GAGATGACATTTCTGTTGTCAGG - Intronic
906218571 1:44059532-44059554 GAGATGGCTGTGAAATTTTCTGG - Intergenic
909179825 1:72408957-72408979 GAGATATATTTTCAGTTTTCAGG - Intergenic
909814548 1:79975672-79975694 GAGCTGATTGTTAAATTTTCAGG - Intergenic
913219790 1:116650238-116650260 GATTGGACTGTTCAGTCTTCAGG + Intronic
914762395 1:150609661-150609683 GTGATGTCTGTTGAGTTTTTTGG - Intronic
914953260 1:152137990-152138012 GAGATGGCTCTTCAGCTTTCTGG + Intergenic
916640271 1:166720689-166720711 GACATGACTGACCAGTTTGCTGG - Intergenic
917624811 1:176834949-176834971 GAGATGAATTTTCACTTTTGTGG - Intronic
920013840 1:202889403-202889425 GACCTTACTGTTTAGTTTTCTGG + Intergenic
920277703 1:204819783-204819805 GAGCTGATTGTTAAATTTTCAGG + Intergenic
922809984 1:228409869-228409891 GAGATCACTGTTTACTTCTCTGG + Intronic
923019334 1:230150822-230150844 GCCCTGACTGTGCAGTTTTCTGG + Intronic
1068040074 10:51812839-51812861 CAAATGACTGTTGAGTTTTTTGG + Intronic
1068597904 10:58923825-58923847 GAAATGCCTGTTCAGATTTTTGG - Intergenic
1069115131 10:64495286-64495308 GAAATGTCTGTTCAGATCTCTGG + Intergenic
1069438386 10:68406843-68406865 GCGATGACTTTTCAGGTTTGGGG - Exonic
1070976081 10:80606701-80606723 GAGCTGACTGTTAAATTTTCAGG - Intronic
1071705865 10:87997574-87997596 GAAAAGACAGTTCAGTTTTAGGG + Intergenic
1073229534 10:101956818-101956840 GAGTTGACTGTAAAATTTTCAGG + Intronic
1074566878 10:114587743-114587765 GGGAAGGCTATTCAGTTTTCTGG + Intronic
1076046661 10:127299703-127299725 GAGATGACATGTCAGTTTCCTGG - Intronic
1076413068 10:130265509-130265531 ATGATGAATCTTCAGTTTTCTGG + Intergenic
1078558233 11:12348505-12348527 GAGATGACTGTAAATCTTTCTGG + Intronic
1079303440 11:19300222-19300244 GAGATGATTGTTAAATTTGCAGG + Intergenic
1080810713 11:35701623-35701645 GACATAACTGACCAGTTTTCTGG + Intronic
1081469595 11:43357721-43357743 GAAATGAATGTTCAGTCTTCAGG + Intergenic
1081925624 11:46826058-46826080 TAGAAAACTGTTCAGATTTCTGG - Intronic
1085480294 11:76816590-76816612 GACATGACTGACCAGTTTGCTGG + Intergenic
1087803689 11:102532719-102532741 AAGATGACTGTTAAGGTTTTTGG - Intergenic
1088676587 11:112199677-112199699 GATAGGACTTTTCATTTTTCAGG + Exonic
1089945980 11:122474031-122474053 GAGATGGCTATTAAATTTTCAGG - Intergenic
1090231776 11:125112052-125112074 TAGATGACTGTGCAGTTCTCTGG - Intergenic
1090455550 11:126845563-126845585 GACATGGCTGACCAGTTTTCCGG - Intronic
1090751755 11:129752285-129752307 GAGTGGACTGTTAATTTTTCAGG + Intergenic
1090823412 11:130365472-130365494 GAGCTGATTGTTACGTTTTCAGG + Intergenic
1091478569 12:801979-802001 TTGATGACTGCTCAATTTTCTGG - Intronic
1093096460 12:14977235-14977257 GAGATGACAGTGTAGTTGTCTGG - Intronic
1093393022 12:18646313-18646335 GAGATTATGGTTTAGTTTTCTGG - Intronic
1093647950 12:21610500-21610522 GAGATGACTGTGATGATTTCAGG - Intergenic
1094774889 12:33714362-33714384 CAGAAGACTGTCCACTTTTCTGG + Intergenic
1095493694 12:42762415-42762437 GAGCTGACTGTTAAATTTGCAGG + Intergenic
1096137302 12:49213099-49213121 GACAAAACTGTTTAGTTTTCTGG - Intronic
1096676910 12:53231072-53231094 GAGATGACTGTCCCGCTTTAGGG - Intronic
1097932207 12:65200633-65200655 GAGATGTCTGTTAAGTTCTTTGG + Intronic
1098058662 12:66536502-66536524 GCAATGACTGTTCATTCTTCCGG + Intronic
1100625062 12:96322851-96322873 GAGATGATTGTTAAAGTTTCAGG - Intronic
1100991716 12:100258533-100258555 GAGAAGACTCTTAAGTTTTGGGG + Intronic
1101765480 12:107694725-107694747 GGAATGACTGTTAAGTTCTCAGG - Intronic
1102742662 12:115222083-115222105 GAGGTGACTGTTCAAATTGCAGG - Intergenic
1104023068 12:125006557-125006579 GAGGTGACTGCTCAGCTTGCAGG + Intronic
1104619156 12:130297737-130297759 GAAATGACTGATCAGCTTTCTGG - Intergenic
1105465554 13:20636413-20636435 GAGAGAACTGTTTAGTTTGCAGG - Intronic
1105778361 13:23683228-23683250 GACATGACTGACCAGTTTGCTGG - Intergenic
1106637765 13:31547852-31547874 GAGATGTCTGTTCAGATTGTTGG + Intergenic
1108704589 13:52973749-52973771 AGGATGACTCTGCAGTTTTCTGG + Intergenic
1109968430 13:69733122-69733144 TAAATGACTGTTCTGATTTCTGG + Intronic
1110161267 13:72381212-72381234 GAGTTTACTGTTAATTTTTCAGG + Intergenic
1110832085 13:80043404-80043426 GAGATGACTGGAAAGTCTTCAGG - Intergenic
1110969711 13:81745921-81745943 GAGATGACTGTCCTTTATTCTGG + Intergenic
1111032326 13:82619484-82619506 GAGGTGAGTGTTCAAGTTTCTGG - Intergenic
1111050790 13:82881514-82881536 GACATGATTGTTAAGTTTCCTGG + Intergenic
1111210014 13:85065637-85065659 GAGATGATTATGCAATTTTCTGG + Intergenic
1111468005 13:88643112-88643134 GAAATGGCAGCTCAGTTTTCAGG - Intergenic
1113473398 13:110562290-110562312 GAGATGACTGTCCACTTTTCAGG - Intergenic
1113982828 13:114290388-114290410 GAGATGATGTGTCAGTTTTCAGG + Intronic
1114184498 14:20389969-20389991 GAGCTGATTGTTAAGTTTTCAGG + Intronic
1114842600 14:26282787-26282809 GAGCTGACTGTTAAATTTTCAGG - Intergenic
1116498799 14:45595178-45595200 CAAATGTCTGCTCAGTTTTCAGG - Intergenic
1118303023 14:64632174-64632196 GAGCTGGCTGTTAAATTTTCAGG - Intergenic
1118453773 14:65927384-65927406 GATGTCACTGATCAGTTTTCAGG - Intergenic
1119537667 14:75416137-75416159 AAGATGGGTGTTCAGTCTTCAGG + Intergenic
1120740885 14:88107587-88107609 GAGCTGATTGTTAAATTTTCAGG - Intergenic
1121221926 14:92292111-92292133 GAGATAGCTGTTCCTTTTTCTGG - Intergenic
1122185144 14:99986632-99986654 GAGTTCACTGTGCAGATTTCTGG + Intronic
1122196428 14:100090656-100090678 GAGATGACCTTACGGTTTTCCGG - Intronic
1124061792 15:26299975-26299997 TAGATGACAGTTCAGCTTTGGGG + Intergenic
1125369530 15:38956936-38956958 GAGCTGATTGCTAAGTTTTCAGG + Intergenic
1126283151 15:46980022-46980044 AAGATGACTTTCCAGCTTTCAGG + Intergenic
1129965296 15:79729642-79729664 GAGAAGGCTGTCCAGGTTTCTGG + Intergenic
1130887387 15:88105299-88105321 GAGATGACTCTCCAGATTTAGGG + Intronic
1135863257 16:26076911-26076933 GACATTACTATTCTGTTTTCTGG + Intronic
1138055566 16:53829498-53829520 GTGATATCTGTTTAGTTTTCTGG + Intronic
1138742150 16:59323462-59323484 GAGCTAACTGTTAAGTTTTCAGG + Intergenic
1139054519 16:63166205-63166227 GAAATCACTGTTCAATTCTCAGG + Intergenic
1141871583 16:86790148-86790170 GACAAGAATTTTCAGTTTTCTGG - Intergenic
1143867314 17:9933442-9933464 GAGCTGAATGTTAAATTTTCAGG + Intronic
1144398304 17:14867933-14867955 GAGATGATCGTTAAGTCTTCAGG + Intergenic
1147449474 17:40495064-40495086 GAGCTGATTGTTAAATTTTCAGG + Intronic
1147848951 17:43426388-43426410 GAGCTGAATGTTGAATTTTCAGG + Intergenic
1147910068 17:43850301-43850323 GAGCTCACTGTTAACTTTTCAGG - Intronic
1149008706 17:51832608-51832630 GACATTCCTGTTCAGTTTCCAGG - Intronic
1149466930 17:56887411-56887433 GAGATGACTCTTCAACTGTCCGG - Intergenic
1151089378 17:71418742-71418764 GAGTTGACTGTTACATTTTCAGG + Intergenic
1151107418 17:71632729-71632751 GTGATGACTTTTTATTTTTCTGG - Intergenic
1151303921 17:73250773-73250795 GAAATGACTGTTCCTTTTGCAGG + Intronic
1151451450 17:74200620-74200642 GAGTTCTCTCTTCAGTTTTCAGG - Intergenic
1152496611 17:80677314-80677336 GGAATTACTGTTCAGTTTTTGGG - Intronic
1156351189 18:36302563-36302585 GACCTGGCTGTTCAGTTCTCTGG + Intronic
1157380954 18:47216862-47216884 GAGTGAACTGTTCTGTTTTCAGG + Intronic
1158386113 18:56993784-56993806 GAGATGACTGATCACTTTACAGG - Intronic
1160373917 18:78396531-78396553 GAGATGCCTGTGAAGCTTTCAGG + Intergenic
1164447146 19:28327686-28327708 GAGATGGCTGTTCAGAGATCTGG + Intergenic
1164673072 19:30083860-30083882 GACATGAATTTTCAGTTTACAGG - Intergenic
1165797580 19:38527871-38527893 GAGATGACTATTAAGTTTTGGGG + Intronic
1167225168 19:48233697-48233719 GAGCTGACGGTTCCATTTTCAGG + Intronic
1168578724 19:57535538-57535560 AAGGTGACTGTTCAGTTCTGTGG + Intronic
926442550 2:12905498-12905520 GACATGATTTTTCACTTTTCTGG + Intergenic
927117517 2:19919451-19919473 GAGAAGGTTGTTCAGTTTCCAGG - Intronic
929728316 2:44457271-44457293 GAGATGACTCTTTTGTTTTTTGG + Intronic
930151060 2:48060657-48060679 GACATGACTGACCAGTTTCCGGG + Intergenic
930605120 2:53485585-53485607 GAGATGAGTGTTCTTTTTTGTGG + Intergenic
932562002 2:72881383-72881405 GAGATTAAAGTTCAGTTTTGGGG - Intergenic
935209819 2:100929576-100929598 GAGAAGATTGTTCACTTTTCAGG + Intronic
936929599 2:117774059-117774081 GAAATGTCTGTTCAGGTCTCTGG - Intergenic
938157365 2:128952695-128952717 GAGATGAGTGACCAGCTTTCTGG - Intergenic
939027597 2:137032467-137032489 GAGATGCCTGTTCCTTTTTTGGG - Intronic
939866945 2:147483314-147483336 GTGATGACTGTTCTCTTATCTGG - Intergenic
940141430 2:150495500-150495522 CAGAAGACTTTGCAGTTTTCTGG + Intronic
940142603 2:150509893-150509915 AAGATGACTCTTCAGTTGTCTGG - Intronic
940214061 2:151286603-151286625 GAGGTAATTGTTCTGTTTTCTGG - Intronic
941321757 2:164064340-164064362 GAAAAACCTGTTCAGTTTTCAGG + Intergenic
942040538 2:172057607-172057629 GTGATGCCTTTTCAATTTTCTGG + Intronic
942068734 2:172296173-172296195 GAGAGCACTGTGCAGTTTTTGGG - Intergenic
942443097 2:176056317-176056339 GGCATGACACTTCAGTTTTCTGG - Intergenic
943663262 2:190581831-190581853 GAGATGACTGTTAAAGTTTTAGG + Intergenic
943854758 2:192775198-192775220 CAAATGTCTGTTCAGTGTTCTGG - Intergenic
943899728 2:193417965-193417987 GAGATGACAATACAGTTTTTTGG - Intergenic
944954725 2:204795411-204795433 GAGATGACTGGTCACGTTTGAGG + Intronic
946541439 2:220688496-220688518 AAGAAGACTGCTCAGTTTTCAGG - Intergenic
946949339 2:224855797-224855819 GAGCTGAATGTTCAATTTTTAGG + Intronic
947404903 2:229765025-229765047 GAACTTACAGTTCAGTTTTCTGG + Intronic
1170414308 20:16123836-16123858 GAGCTGACTGTTGAATTTTGAGG - Intergenic
1172573626 20:35989625-35989647 GAGCTGATTGTTAAATTTTCAGG + Intronic
1174829144 20:53797014-53797036 GAGCTGGTTGTTAAGTTTTCAGG - Intergenic
1174935792 20:54866820-54866842 GAACTGACTGTTAAATTTTCTGG - Intergenic
1176920162 21:14678613-14678635 GAGATGGCTGTTGAATTATCAGG - Intergenic
1176979773 21:15367973-15367995 GAGGTAACTGTTCTCTTTTCAGG - Intergenic
1177000986 21:15613026-15613048 GAGGTGTCTGTTAAGGTTTCTGG - Intergenic
1178166606 21:29985332-29985354 GAAATGGCAGCTCAGTTTTCAGG - Intergenic
1178459428 21:32788874-32788896 GAGCTGATTGGTAAGTTTTCAGG + Intergenic
1179202500 21:39238031-39238053 GAGATTAAGGTCCAGTTTTCTGG + Intronic
1183569524 22:38642199-38642221 TACCTGTCTGTTCAGTTTTCAGG - Intronic
1184180923 22:42825005-42825027 GACATGACTGTTCTTTTTTACGG + Intronic
1184799745 22:46752244-46752266 GAGATGCCTGCACAGTGTTCTGG - Intergenic
1185081083 22:48709722-48709744 GAGAGGACTGCTCAGTTCACCGG + Intronic
950024576 3:9811276-9811298 GAAATGCTTGTTAAGTTTTCTGG - Intronic
950812420 3:15661460-15661482 GAGATGCCTGTTAAGGTTTTTGG + Intergenic
952769609 3:36986318-36986340 GAAAAGACTGGTCAGTTTGCAGG + Intergenic
953158596 3:40397259-40397281 GGCATGACTGTTCAGTAATCAGG - Intronic
953690197 3:45111369-45111391 GAGCTGACTGTTAAGTGTTCAGG - Intronic
957449258 3:80355728-80355750 AAGATAACTCTTCAGTTCTCTGG + Intergenic
957702127 3:83727725-83727747 GAGCTGCCAGTTCAGTTTTCAGG - Intergenic
958593381 3:96189778-96189800 GAACTGACAGCTCAGTTTTCAGG - Intergenic
958684543 3:97376635-97376657 GAAGTGACTGTCCAGTGTTCTGG - Intronic
961466765 3:127086548-127086570 GAGATGAGTGTTAAGTATTCTGG + Intergenic
961527050 3:127510940-127510962 GAGATGCCTGTTCAGTTCAGAGG - Intergenic
961595764 3:128015005-128015027 GACATGACTGACCAGTTTTCTGG - Intergenic
962053720 3:131846697-131846719 GAGATGACTGTTCAGTTTTCTGG + Intronic
963252888 3:143119182-143119204 GAGGAGACGCTTCAGTTTTCCGG - Intergenic
964996639 3:162890865-162890887 GAGATGTCTGTTCAGGATTTTGG - Intergenic
965802229 3:172506440-172506462 AAAGTGACTATTCAGTTTTCAGG - Exonic
965900185 3:173630267-173630289 TAGATCACTGTTCACTGTTCAGG - Intronic
967332074 3:188300012-188300034 GAAATGTCTGTTCTGTTTTAGGG - Intronic
969487586 4:7480891-7480913 GAAATGAGTGTTCCCTTTTCTGG + Intronic
970091168 4:12409760-12409782 GACATGTCTGTTAAGTTTTTAGG + Intergenic
971566634 4:28151504-28151526 TACATGACTGTGCATTTTTCTGG - Intergenic
971825402 4:31614727-31614749 GAGCTGGCAGCTCAGTTTTCAGG + Intergenic
973810192 4:54562012-54562034 TAGGTTACTGGTCAGTTTTCTGG - Intergenic
974530031 4:63096935-63096957 TACATGACTGTTCATTCTTCTGG + Intergenic
975078311 4:70241694-70241716 GAGATAATTGTTCTGTTTTAAGG - Intergenic
975207660 4:71663253-71663275 AAGATAACAGTTCAGTTCTCTGG - Intergenic
975847774 4:78543052-78543074 GAGATGAGTGTCAGGTTTTCAGG + Intronic
975991323 4:80262867-80262889 AAGATGACTGTACAGTTTGAAGG - Intergenic
976021155 4:80628667-80628689 GAAATGTCTGTTCAGTTTCATGG - Intronic
976821991 4:89216970-89216992 GAGATGCCTGTGGAGTGTTCAGG - Intergenic
977522415 4:98101551-98101573 CTGATGACTGGCCAGTTTTCTGG - Intronic
977530238 4:98192517-98192539 GAGATTACTTTTTATTTTTCTGG + Intergenic
978393887 4:108257184-108257206 GAGCTGATTGTTAAGTTTTCAGG + Intergenic
978488600 4:109285626-109285648 GAGCTGATGGTTCAGCTTTCAGG + Intronic
978659609 4:111108860-111108882 GAGATGCCTGGTCTGGTTTCAGG - Intergenic
979841571 4:125448745-125448767 GAGCTGACTGGTTGGTTTTCAGG - Exonic
981233527 4:142387868-142387890 GACATGACTGACCAGTTTGCTGG - Intronic
981594841 4:146408199-146408221 GAGATGGCTGTTGAGGTTTTAGG - Intronic
982681943 4:158441799-158441821 TACATGACTGTTCATTTTGCTGG + Intronic
982733690 4:158982590-158982612 GAGCAGATTGTTCAGTTTCCAGG - Intronic
984462114 4:180051684-180051706 GAAATGTCTGTTCAGTTTCTTGG - Intergenic
985949496 5:3212634-3212656 GTGCTGACTCTTCAGTTTTGGGG + Intergenic
986342599 5:6803861-6803883 CAGATGACAGTTAAGGTTTCAGG + Intergenic
986396249 5:7333521-7333543 GAAAAGACTGTTCACTTTGCAGG - Intergenic
986769677 5:10960936-10960958 GAGCTGATTGTTAAATTTTCAGG + Intergenic
987053485 5:14167858-14167880 GAAATGAATGTTCAGTATTTAGG - Intronic
987741487 5:21914622-21914644 GAGTTGATTCTGCAGTTTTCAGG + Intronic
989321546 5:40140650-40140672 GAGATGAGTTTTCAGTATTCTGG + Intergenic
989573670 5:42969407-42969429 GAGATGACTTTGTAGTTCTCAGG + Intergenic
990987396 5:61653912-61653934 AAGATGGCTGTTAAATTTTCAGG - Intronic
991401123 5:66252758-66252780 GAGAAAAGTGTTCAGTTTTAGGG + Intergenic
992064758 5:73096301-73096323 CAGATGACTGTTAACATTTCTGG - Intergenic
993939495 5:94041323-94041345 GACATGACTGACCAGTTTGCTGG - Intronic
994125550 5:96166371-96166393 GGGCTGACTGTTAAATTTTCAGG - Intergenic
995259457 5:110084870-110084892 GAGATGACTTTTCAGAATTTTGG + Intergenic
996546923 5:124689581-124689603 GAGCTGACTGTTAAGGTTTTTGG - Intronic
997100584 5:130964535-130964557 GAGAAGACTGGGCATTTTTCTGG - Intergenic
997847293 5:137298690-137298712 TTGATGACTGTTAGGTTTTCTGG + Intronic
998454771 5:142263299-142263321 GAGCTCAGTGTTAAGTTTTCAGG - Intergenic
998960207 5:147478479-147478501 AAGATGCCTGTTAAGTTTTGTGG + Intronic
1000415696 5:160981361-160981383 GACATGACTGACCAGTTTGCTGG - Intergenic
1001247474 5:170115801-170115823 CAGCTGACTGTTAACTTTTCAGG - Intergenic
1004254940 6:14054819-14054841 GAGCTGATTGTTAAATTTTCAGG - Intergenic
1005507205 6:26479924-26479946 GAGGTGATTGTTAAATTTTCAGG + Intergenic
1007003855 6:38341267-38341289 GGAATTACTGTTCAGTTTTAGGG + Intronic
1008172342 6:48223856-48223878 GACATGTCTATTCAGTATTCAGG + Intergenic
1009928342 6:70147013-70147035 GAGATGACTGATCAGCATTGAGG + Intronic
1010908118 6:81518427-81518449 GAGATGACTGTTCCGTTAAGAGG - Intronic
1011849954 6:91614340-91614362 GAGGTCACTGTTCAGTGGTCAGG + Intergenic
1012203353 6:96434045-96434067 GAGTTGACAGTTCAGGCTTCAGG + Intergenic
1012381076 6:98620257-98620279 GGGGTGACTGTTCTGTTTCCAGG + Intergenic
1013812331 6:114059072-114059094 GAGATGGTTGTTCACTATTCAGG - Intronic
1014182514 6:118400747-118400769 CAGATGAATGCACAGTTTTCAGG - Intergenic
1015577886 6:134691951-134691973 GAAATGTCTGTTCAGATTTTAGG + Intergenic
1017024686 6:150171271-150171293 GAGACCACTGTTAAATTTTCAGG - Intronic
1018071746 6:160170831-160170853 GAGATGACTGTCCGGTTTATGGG + Intergenic
1018600507 6:165533706-165533728 TAGATGACTGTTAAATCTTCAGG + Intronic
1018823492 6:167392373-167392395 AATATGAGTGTTCATTTTTCTGG - Intergenic
1019288957 7:240706-240728 GGCAAGAGTGTTCAGTTTTCTGG - Intronic
1020553409 7:9637631-9637653 GAGATGTCTTTTCATTTTTGTGG - Intergenic
1021184901 7:17552881-17552903 GAAATGTCTGTTCAGTTTTTTGG - Intergenic
1022755603 7:33285192-33285214 CAGATGTCTGTACAGTTTTCTGG + Intronic
1022803306 7:33796202-33796224 GATCTGACTGTTAAATTTTCAGG + Intergenic
1023058169 7:36306179-36306201 GAGCTGATTGTTCAAGTTTCAGG + Intergenic
1024182757 7:46913310-46913332 GAGATGTCTGTTCAGATCTTTGG + Intergenic
1024953619 7:54892237-54892259 GAGCTGACTGTGCAGCTATCTGG - Intergenic
1027657657 7:80951001-80951023 GAAATGATTGTTAAATTTTCAGG + Intergenic
1027689304 7:81322353-81322375 GAACTGATTGTTCAGTTTTCAGG + Intergenic
1028564980 7:92219773-92219795 GAGATGTCTTTCCAGTTATCAGG + Intronic
1030144209 7:106336309-106336331 GACATGACTGTCCAGTTTGCTGG - Intergenic
1030906798 7:115195127-115195149 GAGCTGATTGTTAAATTTTCAGG + Intergenic
1033355890 7:140600075-140600097 GAGATGACTTTTTAGGTTTGTGG + Intronic
1034419777 7:150983603-150983625 CAGATGACTATTAAGTTTTCAGG - Intergenic
1036021256 8:4849452-4849474 GAGATTACTGTTCACTATTGTGG - Intronic
1036582257 8:10086252-10086274 AAGATGACTCTTGGGTTTTCAGG + Intronic
1037219631 8:16502044-16502066 GAGATGGCTGCTGAGTTTACAGG - Intronic
1038376518 8:27045381-27045403 GAGCCAACTGTTAAGTTTTCAGG + Intergenic
1038560543 8:28575170-28575192 GAGATGAGTGTTCAGTTGTCTGG - Intergenic
1039560495 8:38508593-38508615 GATTTGGCTGTTCAGTTTTCAGG + Intergenic
1041049455 8:53918899-53918921 GACATGTGTTTTCAGTTTTCTGG + Intronic
1043100772 8:76042263-76042285 TGGATGACTTTTTAGTTTTCTGG - Intergenic
1045428239 8:102088144-102088166 GACATGACTGACCAGTTTCCTGG - Intronic
1046762108 8:118031832-118031854 AAGATAACTGTTAAATTTTCAGG + Intronic
1047847033 8:128817652-128817674 GGAATGACTGTTCAAATTTCAGG + Intergenic
1047881700 8:129201608-129201630 GAGATGACTGTAAAGTTTTGGGG - Intergenic
1050401643 9:5262336-5262358 GACATGACTGACCAGTTTGCTGG + Intergenic
1051637400 9:19193289-19193311 GAGACGAGTGGTCAGATTTCAGG + Intergenic
1052893314 9:33723542-33723564 GAGTGGACTGTTAATTTTTCAGG + Intergenic
1052981487 9:34453162-34453184 CAGATGACTTTTCAGTTTAAGGG - Intronic
1053792159 9:41694484-41694506 GAGATGTCTTTTCAGTTGCCTGG + Intergenic
1055491803 9:76812847-76812869 GAGCTGACTGTTAAATTTTCAGG + Intronic
1055834111 9:80419041-80419063 GGGATGACTGTTCTGTGGTCAGG + Intergenic
1056535216 9:87521248-87521270 GAGACAACTGTTCATTTTTCAGG - Intronic
1056905153 9:90640782-90640804 GAGAGGACCATTCAGTTGTCTGG - Intronic
1056960100 9:91115997-91116019 GAGATGAACTTTCAGTTTTCTGG - Intergenic
1057875832 9:98753949-98753971 GAGCCGACTGTTCAGTTTATAGG - Intronic
1058216611 9:102241857-102241879 GATATTAATGTTCAGTTTTTAGG - Intergenic
1059951402 9:119466104-119466126 GAGAACACTGTTCAGTCTTCAGG - Intergenic
1060560354 9:124537572-124537594 GAGATAACAGTTCAGCCTTCGGG - Intronic
1186052113 X:5607870-5607892 GAGATGATTATTCAGATTTATGG + Intergenic
1188923004 X:36002208-36002230 GAGACCACTGGTCAGGTTTCAGG + Intergenic
1191017410 X:55824673-55824695 GGGATGACTCTTCAGTTTGTTGG + Intergenic
1192021853 X:67402472-67402494 GAGTTGATTATTCAGGTTTCAGG + Intergenic
1195928360 X:110048892-110048914 GAGATGGCTGTTCATTATTCTGG + Intronic
1196562085 X:117161679-117161701 GAGATAAGTGTTCAATTTTGGGG + Intergenic
1199077289 X:143537804-143537826 GATTTGATAGTTCAGTTTTCAGG - Intergenic
1199498768 X:148485816-148485838 GAGATGTCTGTTAAGTTCTTTGG - Intergenic
1199764959 X:150934824-150934846 GAGCTGCCTGTCCAATTTTCAGG - Intergenic
1200438832 Y:3187551-3187573 GACATGACTGACCAGTTTGCTGG + Intergenic
1201324842 Y:12745009-12745031 GAGATGGCTGGTTAGTTTACAGG + Intronic