ID: 962056592

View in Genome Browser
Species Human (GRCh38)
Location 3:131878533-131878555
Sequence AATCTGGATGCTGGTTTTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 243}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962056592 Original CRISPR AATCTGGATGCTGGTTTTAC AGG Intronic
901212893 1:7536514-7536536 AATTTGGATCATGATTTTACTGG + Intronic
901445815 1:9307428-9307450 AATCTGTATTCTGATTTGACGGG + Intronic
904648161 1:31984003-31984025 GATCTGGTTGATGGTTATACAGG + Intergenic
907466299 1:54639978-54640000 GATCTGGGTGCTGGTTTCATGGG + Intergenic
907851458 1:58259031-58259053 AATAATAATGCTGGTTTTACAGG + Intronic
909435519 1:75636482-75636504 AATCAGGATTTTGGGTTTACAGG - Intergenic
909969663 1:81966475-81966497 AAACTGGGTGCTGATTTTATTGG + Exonic
910227750 1:84953584-84953606 AATCTGGATGAAGGCTATACAGG + Intronic
910247153 1:85151288-85151310 AATCTGGATGCTAGATATATGGG + Intergenic
910281311 1:85504485-85504507 AATCTGAATGATGGTTTTCTTGG - Intronic
912413311 1:109492238-109492260 AAACTGGCTGCAGGCTTTACTGG - Intronic
914426468 1:147582009-147582031 GCTCTGGATGCTGGGTTTATGGG - Intronic
915733844 1:158072276-158072298 TTTCTGGATGGTGGTTTCACAGG + Intronic
917487053 1:175465004-175465026 AATCTGTATACTGGCTTTCCAGG - Intronic
917563910 1:176191516-176191538 AATTTGGATGCTGCTTTTGAAGG - Intronic
918874403 1:190020880-190020902 AATGTGGAGGTTTGTTTTACAGG - Intergenic
918991097 1:191697735-191697757 AATCTGGGTTCTGGTTTTAAAGG - Intergenic
919370472 1:196718476-196718498 AATCTGAATCCTGGATTTAGTGG + Intronic
919460735 1:197873551-197873573 AATCTAGGTGCTGGTTAAACAGG + Intergenic
924047402 1:240045952-240045974 CCTCTGGGTGCTGGTTATACAGG - Intronic
1064225798 10:13483694-13483716 AATCTGAAGGCTGGTTCTGCAGG + Intronic
1064289636 10:14021703-14021725 AATCTGGGTGGTGGTTACACAGG + Intronic
1068202789 10:53804846-53804868 AATGTGGATGCTTGTTTGGCAGG + Intronic
1068546299 10:58349735-58349757 GAGCTGGGTGCTGGTTTCACAGG - Intronic
1069643795 10:69976278-69976300 AATCTGGATGAAGGATATACAGG + Intergenic
1070737763 10:78876131-78876153 GAGCTGGATGCTGGTTTCCCAGG + Intergenic
1071931761 10:90480098-90480120 AATTTGGGTGCTGGGATTACAGG + Intergenic
1072011737 10:91307905-91307927 AATCTGGGTGTTGGTTTTACAGG - Intergenic
1074148406 10:110737486-110737508 GATCTGGATGCAGGTTTTTAGGG - Intronic
1074218496 10:111411544-111411566 AATCTGGGTGATGGGTATACGGG - Intergenic
1074873610 10:117596871-117596893 AGTCTGGATTCTGGGTTAACAGG - Intergenic
1075263353 10:120981013-120981035 CATCTGGGTGCTGGTTTCACAGG - Intergenic
1075289542 10:121216586-121216608 AGTCTGGATGCTGATATTTCTGG - Intergenic
1075425677 10:122340038-122340060 GATCTGGGTGCTGGTTATATGGG - Intergenic
1075518374 10:123128033-123128055 AATCTGGGTGCTGGTTTTATGGG + Intergenic
1075773899 10:124966574-124966596 TATCTTGATGCTTGTTTTAGGGG + Exonic
1075807721 10:125202145-125202167 AATGTGGCTGCTGGTATTTCTGG + Intergenic
1077617328 11:3686665-3686687 GATCGTGATGGTGGTTTTACAGG - Intronic
1077968764 11:7165436-7165458 AATGTGGATGATGGTTATATGGG + Intergenic
1078135533 11:8648878-8648900 AATCAGGATTCTGTTTTTAATGG + Intronic
1079846447 11:25476355-25476377 AATTTGGCTCATGGTTTTACAGG - Intergenic
1079878450 11:25891279-25891301 AAGCTGGAAGTTAGTTTTACAGG - Intergenic
1080075364 11:28141251-28141273 TATCTGGGTGCAGGTGTTACAGG + Intronic
1080358515 11:31483221-31483243 TATCTGGGTGCTGGTTATATGGG + Intronic
1081364899 11:42222542-42222564 AATGTGGATGATGGTTTGATGGG + Intergenic
1082101136 11:48174059-48174081 AATTTGGGTGCTGGTTATATGGG - Intergenic
1085219076 11:74858135-74858157 AAACTAGCTGCTGGTTTCACTGG - Intronic
1085358898 11:75867247-75867269 GATCTGGATGCTGGATATATGGG - Intronic
1085934898 11:81129189-81129211 AATCTAGATGGTGGTTATATGGG + Intergenic
1086325384 11:85693290-85693312 TGGCTGGATGCTGGTTTTACAGG + Intergenic
1086745215 11:90417214-90417236 AATCTGTATGCTATTTTTATAGG + Intergenic
1089250460 11:117156431-117156453 AATTTGAATGTTGGTTTTTCTGG + Intronic
1089277092 11:117344628-117344650 AAGTTGGATGCTGGTCTTGCCGG + Intronic
1090518163 11:127450637-127450659 AATCTGGATGAGGGTTTTGCTGG - Intergenic
1090752682 11:129761089-129761111 TATCTGGGTGCTGGTTTTGAGGG - Intergenic
1090930744 11:131295959-131295981 AATCTGGAGGGTGGATTTCCTGG + Intergenic
1093045582 12:14440384-14440406 AAAATGAATACTGGTTTTACCGG - Intronic
1093434817 12:19124504-19124526 AATATTGAGGCTGCTTTTACTGG + Intergenic
1094806261 12:34096128-34096150 AATCTCCATACTGGTTGTACTGG - Intergenic
1095561085 12:43566059-43566081 GATCTGGATTTTAGTTTTACAGG + Intergenic
1096209346 12:49751436-49751458 AATCTGGGTGAAGGTTGTACAGG + Intronic
1096539458 12:52296855-52296877 CATCTGCATGCTGGGCTTACAGG - Intronic
1097580459 12:61449541-61449563 AAACTTGATGCTGGTTGTAGCGG + Intergenic
1097769043 12:63559034-63559056 ATTTTGGATGATGTTTTTACAGG - Exonic
1101419697 12:104540225-104540247 AATATGGAGGCTGATTGTACAGG + Intronic
1101525543 12:105525373-105525395 GATCTGGTTGCTGGTTATGCTGG - Intergenic
1101627248 12:106457399-106457421 AGTTTGGATGGTGGTTTTATAGG - Intronic
1101981816 12:109414066-109414088 AATCTGGGTGCTGGTTGCACAGG + Intronic
1103335346 12:120185182-120185204 GATCTGGGTGCTGGTTATACTGG + Intronic
1104422226 12:128645561-128645583 AATTTGGAGGCTGGTTTTCTTGG - Intronic
1104623251 12:130333906-130333928 AATCTGGATCATGGGTTTAAAGG + Intergenic
1105296808 13:19094878-19094900 GATCTGGATACTGGTTATACCGG + Intergenic
1105465243 13:20633938-20633960 CACCTGGATGCTTCTTTTACTGG + Intronic
1106390164 13:29327498-29327520 AATATGTATGCTAGTTTTACTGG + Intronic
1108077067 13:46692259-46692281 GAACTGGAAGCTGGTTATACGGG - Intronic
1110802843 13:79720068-79720090 AATTATGATGCTGGTTTCACAGG - Intergenic
1112007296 13:95265260-95265282 AATCTGGATGAAGGATATACAGG + Intronic
1112586988 13:100727651-100727673 AATCCGGGTGCTGGTTATACAGG - Intergenic
1112736423 13:102425278-102425300 TATCTGGGTGCTGGTTACACAGG + Intergenic
1112826937 13:103402619-103402641 AATTTGTAGGCTGGTTTTATAGG - Intergenic
1113425709 13:110206663-110206685 ACTCTGGGTCCTGGTTTTCCGGG + Exonic
1116017131 14:39420751-39420773 AATCTGGGTGATGGTATTAATGG + Intronic
1116660587 14:47705886-47705908 AATCTGGTTGTTGATTTTTCTGG - Intergenic
1118582025 14:67310522-67310544 GATTTGGATGCTAGTTATACAGG + Intronic
1119840122 14:77786173-77786195 AATCTGGATTTTAGTTTTAGCGG - Intergenic
1120242340 14:81963943-81963965 ACTCTAGATGATGGTTTTAGGGG + Intergenic
1121088652 14:91166173-91166195 GATCTGGATGCTGGTTACATGGG + Intronic
1121183787 14:91949016-91949038 GATCTGGATGCTGGTTATGTAGG + Intergenic
1121826727 14:97016325-97016347 GAGCTTGATGCTGGGTTTACAGG + Intergenic
1122067060 14:99181252-99181274 GAACTGGATTCTGGCTTTACAGG + Intronic
1123683118 15:22776877-22776899 AATATGGCTGCTGTTTTTCCAGG + Intronic
1124197477 15:27644977-27644999 AATCGAGGTCCTGGTTTTACAGG - Intergenic
1124335314 15:28851291-28851313 AATGTGGCTGCTGTTTTTCCAGG + Intergenic
1125047232 15:35256086-35256108 AAACTGGATTCAGGTTATACAGG - Intronic
1125905587 15:43389080-43389102 GATCTGGGTGCTGGTAATACAGG + Intronic
1126585111 15:50277879-50277901 AAGCTGGCAGCTGGTTTTATTGG - Exonic
1127014297 15:54666048-54666070 AACCTGCATTCTGATTTTACGGG - Intergenic
1129361283 15:75026165-75026187 AATTTGGCTTCTGGTTTTGCAGG + Intronic
1129828959 15:78654798-78654820 GAGCTGGATGCTGGTTACACAGG - Intronic
1130014792 15:80178270-80178292 GATCTGGGTGCTGGTTGCACAGG - Intronic
1130567292 15:85007442-85007464 GATCTGGGTGCTGGTTATACAGG + Intronic
1134042088 16:11076557-11076579 AATCTGGTGGCTGGGTTCACTGG - Intronic
1135073738 16:19375353-19375375 GATCCAGATGCTGGTTTTACAGG - Intergenic
1138331248 16:56217389-56217411 ATTCAGGATGCTGGTTATACGGG + Intronic
1139870458 16:70104426-70104448 GATCTGCCTGCTGGGTTTACAGG - Intergenic
1140177846 16:72682790-72682812 TTTCTGGATGCTGTTTTGACTGG - Intergenic
1140384988 16:74528123-74528145 GATCTGCCTGCTGGGTTTACAGG + Intronic
1140891056 16:79285584-79285606 ACTCTGGATGTTGCTTTTATAGG + Intergenic
1141350432 16:83289915-83289937 AATCTGGGTGCTGGCTATAGAGG - Intronic
1142576553 17:912682-912704 AATCTTCATGCTGGGATTACAGG - Intronic
1143566983 17:7728236-7728258 AATCTGGGTGGTGGTCATACAGG + Intronic
1143667470 17:8372641-8372663 AATCTGGAAGGTGCTTTTTCTGG - Intronic
1144590115 17:16516619-16516641 ATTCTGGATTCTGATTTTCCAGG + Intergenic
1144820268 17:18067990-18068012 AATCTGTGTGCTGGTTTTGTTGG + Exonic
1146234674 17:31147161-31147183 GATCTGGATACTGGTTACACTGG - Intronic
1148344984 17:46897273-46897295 AATCTGGGTGCTGGTGATCCTGG - Intergenic
1148911169 17:50943897-50943919 AATTTGGGTGCTGGTTGCACAGG + Intergenic
1149448231 17:56730261-56730283 AATCTGGGTGCTGGTTACAAAGG + Intergenic
1150646847 17:66983998-66984020 GATCAGGGTGCTGGTTATACGGG + Intronic
1150897227 17:69226251-69226273 AATCTGGATGGTGGATGTATAGG + Intronic
1152658927 17:81533510-81533532 AATGTGGCTGCTGGTATTCCAGG + Intronic
1156046512 18:32883528-32883550 AGTCTTTATCCTGGTTTTACAGG - Intergenic
1156788841 18:40948122-40948144 AATCTGGAGACTGGGTTTATTGG + Intergenic
1158658343 18:59361132-59361154 AATCTGGATGCTGGTTGCATGGG - Intergenic
1160205716 18:76829770-76829792 ACACTGGATGCTGGCTTGACAGG - Intronic
1162243811 19:9381885-9381907 ACTCTGGATGCCTGTTATACTGG + Exonic
1163957115 19:20653926-20653948 AATTTGTATGCTGCTGTTACAGG - Intronic
1164044206 19:21521205-21521227 AATTTGAATGCTGCTATTACAGG + Intronic
1164139667 19:22447790-22447812 AATTTGAATGCTGCTATTACAGG + Intronic
1164175920 19:22774539-22774561 AATCGGAATGCTGCTATTACAGG - Intronic
1164213589 19:23123048-23123070 AATTTGAATGCTGCTTTTACAGG + Intronic
1165745168 19:38226323-38226345 AATTTGAATGCTGGCTCTACAGG - Intronic
1166203836 19:41256059-41256081 AATCTGGGTGCTGGTTACATGGG + Intronic
925430711 2:3790522-3790544 ATGCTGGATCCTGGTTTTATTGG - Intronic
927896431 2:26785780-26785802 AATCTGGTTGCTGGTCTTTGCGG - Intronic
931451039 2:62367867-62367889 AATGTTGATGGTGGTTTTCCCGG + Intergenic
931468542 2:62514238-62514260 GATCTGGTTGCTGGTTACACAGG - Intergenic
931647533 2:64438187-64438209 AATCTGGATGTCGGTTCTCCAGG + Intergenic
931890871 2:66670719-66670741 AATCTGGAGGCTGGTTATGCAGG - Intergenic
932146555 2:69324065-69324087 AAAGTGGAGGCTGGTATTACAGG + Exonic
932386770 2:71341524-71341546 ACTCTGGGTGATGGTTTTATTGG + Intronic
933980729 2:87548690-87548712 AATGGGGATGCTGGCTTTTCTGG - Intergenic
934876147 2:97922811-97922833 AATCTGGGTGGTGGTTACACAGG + Intronic
936313098 2:111402101-111402123 AATGGGGATGCTGGCTTTTCTGG + Intergenic
937289932 2:120776060-120776082 GAACTGGATGCTGTTTTTCCAGG + Intronic
937424468 2:121787030-121787052 AATCTAGATGGTGGGTTTATAGG - Intergenic
937902390 2:127030693-127030715 AAACTGGATGCAGGTTATATGGG + Intergenic
938867429 2:135437517-135437539 AGTTTAGATGCTGGTTATACAGG + Intronic
940013917 2:149083624-149083646 AAACTGGAAGCTAGGTTTACAGG + Intronic
941989383 2:171540091-171540113 AATCTAGGTGCTGGTTTCACAGG - Intronic
943162873 2:184278156-184278178 AAAATGTATGCTAGTTTTACGGG - Intergenic
944155729 2:196605496-196605518 AATCTTGGTGCTAGTTATACAGG + Intergenic
944377568 2:199064903-199064925 TATCTGGATGGTGGTTTCATAGG + Intergenic
946557061 2:220870264-220870286 AATCTTGTTGCAGGTTTTACAGG - Intergenic
948110795 2:235454038-235454060 AATATGCATGCTGGTATTGCAGG + Intergenic
948398706 2:237667107-237667129 AATCTAGATGATGGGTTGACAGG - Intronic
1169531832 20:6493356-6493378 AATCTGGATGATGGTTACATGGG - Intergenic
1169627104 20:7583196-7583218 AATCTGGATGAGGCTTTTCCAGG + Intergenic
1170172785 20:13434155-13434177 AATCTGCATGCTGGTTATAGGGG + Intronic
1172562425 20:35901031-35901053 GATCTGCATGGTGGTTATACAGG + Intronic
1174346469 20:49934030-49934052 AATGTGGATGCTGTTGTTGCTGG - Intergenic
1174845088 20:53936247-53936269 AATATGGGTGCTAGTTTTAAAGG - Intergenic
1174846270 20:53946187-53946209 GATTTGGATGGTGGTTTTAGGGG - Intronic
1179932055 21:44577365-44577387 TATCTGGCTCCTGGTTCTACAGG + Intronic
1181716104 22:24730592-24730614 TATCTGGATGATGGGTATACAGG + Intronic
1182243715 22:28937934-28937956 AAACTGGGTGCTGGGTATACAGG - Intronic
949637912 3:6004122-6004144 AATCTGGGTGCGGGGTATACTGG + Intergenic
952186676 3:30977253-30977275 GATCTGCATTCTGGTTTTATAGG - Intergenic
952329676 3:32352749-32352771 GATTTGGATGCTGGTTACACAGG + Intronic
952442795 3:33349927-33349949 GACCCGGATGGTGGTTTTACTGG + Intronic
952470577 3:33646791-33646813 GATCTGGATACTGGTTATACTGG - Intronic
952598134 3:35044062-35044084 ACTCTGCATGCTGGTCTCACAGG - Intergenic
955754086 3:62210352-62210374 AAGGTGGCTGCTGTTTTTACAGG - Intronic
957245286 3:77708770-77708792 AATCTGGGTGCTTGCTTTATTGG + Intergenic
958857552 3:99404125-99404147 TATATGGTTGCTGGTTCTACAGG + Intergenic
962056592 3:131878533-131878555 AATCTGGATGCTGGTTTTACAGG + Intronic
964026357 3:152079473-152079495 AATCTTGTTTTTGGTTTTACAGG - Intergenic
964596671 3:158440028-158440050 AATCTGGATGATGGGTTGATAGG + Intronic
964651763 3:159019414-159019436 GATCTGGATGGTGGTTACACAGG - Intronic
965735786 3:171819044-171819066 AATATGGATTCTGATTTCACAGG + Intergenic
966343168 3:178947957-178947979 AAAGTGGATTTTGGTTTTACTGG - Intergenic
966756579 3:183377121-183377143 AACCTGGATGATGGGTTGACAGG - Intronic
966951988 3:184828822-184828844 TATCTGGATTCTGGTTACACAGG - Intronic
970436177 4:16037567-16037589 AATCTGAATGCTAGTGTTTCCGG - Intronic
972593346 4:40508753-40508775 AATCTGGGTGGTGGTTCCACAGG + Intronic
973256077 4:48115129-48115151 AATCTAGATGATGGTTTGATAGG - Intronic
973972893 4:56231778-56231800 GATCTGGATGCTGGTTTACTTGG + Intronic
974338247 4:60579601-60579623 AAGCTGGTTGCTGGGTTTCCAGG - Intergenic
975865514 4:78720011-78720033 AATCTGGATGATGGGTATACAGG + Intergenic
976654945 4:87478825-87478847 AATTTAGATGCTTGTTTTGCTGG - Intronic
979070118 4:116192262-116192284 AAATTGGATGCTGGTTTTCATGG + Intergenic
980370602 4:131864533-131864555 AACCTGGATGATGGTTTGATAGG + Intergenic
982762886 4:159308488-159308510 AAACTGGATGCTTGATTCACAGG - Intronic
985109452 4:186534093-186534115 AATATGGATCCTGGTTCTCCAGG - Exonic
986393724 5:7307412-7307434 AATGTGGCTGCTGTTTTTCCAGG + Intergenic
988495838 5:31745272-31745294 TATCTGGATGGTGGTGTTATTGG - Intronic
989227306 5:39044179-39044201 GATCTGGGTGCTGGTTTCACAGG + Intronic
990209671 5:53469007-53469029 AATCTGGGTGCTGGTGCTAGAGG - Intergenic
991446992 5:66710939-66710961 AATATGGGTGCTGGTTACACGGG - Intronic
992373090 5:76165429-76165451 AATCTGGACCCTGGTTGTACTGG - Intronic
993618214 5:90137800-90137822 AATGTGGATGATGGTTTGATGGG - Intergenic
996302846 5:122008387-122008409 CTTCTTGGTGCTGGTTTTACTGG + Intronic
998397222 5:141826466-141826488 AATCTGGAGGCTGGTTCTCCTGG + Intergenic
998640703 5:144007305-144007327 AACCTGGATGCTGGATCTTCTGG - Intergenic
998649028 5:144096870-144096892 GATCTGGATGGTGGTTACACAGG - Intergenic
999010809 5:148037654-148037676 AATGAGGATGATGGTTTTTCTGG - Intronic
1000721796 5:164717403-164717425 GATCTGGATGCTAGTTACACTGG - Intergenic
1001270937 5:170311187-170311209 TATCAGGATGCTGGGCTTACAGG + Intergenic
1002664537 5:180812906-180812928 TTTCTAGCTGCTGGTTTTACAGG - Intronic
1004957987 6:20751129-20751151 TATCTAGCTGCTGGTTTTTCAGG + Intronic
1006523541 6:34586015-34586037 AATGTGGATTCTGATTTAACAGG - Intergenic
1006930564 6:37685584-37685606 AATCAGGAGGCTGCTTTTTCTGG + Intronic
1008532347 6:52474926-52474948 AACCTGGATGGTGGTTATATGGG + Intronic
1010244659 6:73652000-73652022 AATCTGGGTGCTGGTTACATGGG + Intronic
1013948999 6:115756886-115756908 TATCTGGATGTTGGTCTTCCTGG - Intergenic
1014457350 6:121651150-121651172 TTTCTGTATGCTAGTTTTACAGG - Intergenic
1014930222 6:127326526-127326548 AAACTGGATGCAGGGTGTACAGG + Intronic
1015940666 6:138448475-138448497 GAACTGGGTGCTGGTTGTACAGG - Intronic
1020206042 7:6117109-6117131 AATCTTGATGCTAGTTCCACGGG - Intronic
1021066314 7:16178160-16178182 GTTCTGGATGCTGAATTTACAGG + Intronic
1022387900 7:29918575-29918597 AATCAGGATGCTGCTTCTATGGG + Intergenic
1022928323 7:35080106-35080128 ATTTTGGATGATGTTTTTACAGG - Intergenic
1023917896 7:44604122-44604144 AATCTGGGGGCAGGTTTTATAGG - Intergenic
1024041806 7:45561700-45561722 AATTTGGCTCATGGTTTTACAGG + Intergenic
1026834927 7:73632316-73632338 TATCTGGATTCTGGTTATATGGG + Intergenic
1028846668 7:95488788-95488810 CATCTGGATGCTGGTTACATAGG - Intronic
1029014640 7:97302951-97302973 TATCTGGATGCTGGTTACATGGG - Intergenic
1029593320 7:101521708-101521730 AATGTGGGTGCTGGTTACACAGG - Intronic
1036574435 8:10013093-10013115 CATCTGAATGCTGGTTTAAATGG - Intergenic
1037343092 8:17868547-17868569 AGTCTGGCTGGTGGTTTAACAGG - Exonic
1037351761 8:17967010-17967032 TTTCTGGATGCTGATTTTGCTGG - Exonic
1037546235 8:19925612-19925634 AATCTGTGTGCTGATTTTCCTGG + Intronic
1038093014 8:24275397-24275419 AACCTAGATGATGGTTTGACAGG + Intergenic
1040816536 8:51513853-51513875 CATCTGGAAACTGGTTTTATGGG - Intronic
1041603368 8:59750334-59750356 AATCTGGGTGCTGGTTATATGGG + Intergenic
1042963228 8:74324248-74324270 AATGTGAATGTTGGTTTGACAGG + Intronic
1043434573 8:80225930-80225952 AATCTGGGTGCTGGTTATGTGGG + Intronic
1044233260 8:89803494-89803516 AATCTAGATGATGGTTTGATAGG - Intergenic
1047159010 8:122355533-122355555 ATTCTGTCTGTTGGTTTTACAGG - Intergenic
1047372439 8:124267087-124267109 AATCTGGAGGCTGGGTCTGCAGG - Intergenic
1047887563 8:129268799-129268821 GATATGGATGCTGGTTATACAGG - Intergenic
1048208051 8:132431382-132431404 AATCTGGATGGGCGTTTTACTGG - Intronic
1048482423 8:134811581-134811603 ACTCTGGATGCTGTGTTTGCTGG - Intergenic
1051095141 9:13457583-13457605 AATCTGAAAGATGGTTTTAAAGG + Intergenic
1052471658 9:28904289-28904311 TATCTTGATTCTGGTTTTAGAGG - Intergenic
1052894238 9:33732359-33732381 TATCTGGGTGCTGGTTTTGAGGG - Intergenic
1053753260 9:41276957-41276979 AATCTTGCTGCTTGTTTTATTGG + Intergenic
1054258790 9:62841323-62841345 AATCTTGCTGCTTGTTTTATTGG + Intergenic
1054332991 9:63778720-63778742 AATCTTGCTGCTTGTTTTATTGG - Intergenic
1056134833 9:83621897-83621919 AATCTGGATGGGGGCTGTACAGG - Intergenic
1056334224 9:85550306-85550328 AGTCTGAATGCTGGTTTTAGTGG - Intronic
1058814022 9:108667346-108667368 AATCCGGATGATGCTTCTACGGG + Intergenic
1058858777 9:109093591-109093613 AAAATGGATGCTTCTTTTACAGG - Exonic
1059593473 9:115690629-115690651 AAACTGGAGGCTGTGTTTACCGG - Intergenic
1059853938 9:118374233-118374255 AGTCTCGATGCTGTTTTTAGAGG + Intergenic
1060035676 9:120253601-120253623 AATTTGGGTGATGGTTTTGCAGG - Intergenic
1061187889 9:129065678-129065700 AACCTGGGTGCTGGTTATACAGG - Intronic
1062528111 9:136986438-136986460 AATCTGGGTGATGGGTCTACGGG + Intergenic
1187978733 X:24731873-24731895 AAACTGGATGATGGCTATACAGG + Intronic
1190158334 X:48011642-48011664 AATCTAGATGCAGGTATTAAAGG - Intronic
1190174105 X:48134524-48134546 AATCTAGATGCAGGTATTAAAGG - Intergenic
1191115981 X:56853174-56853196 AATCTGGATGATGGGTTGATCGG + Intergenic
1192659454 X:73027016-73027038 AATCTGTATGCTATTTTTATGGG + Intergenic
1192740915 X:73892159-73892181 AATAAGGATGCTGGGTTTAATGG - Intergenic
1193409869 X:81149515-81149537 AATGTAGATGATGGTTTGACGGG + Intronic
1193689297 X:84621042-84621064 TATCTGGGTGCTGGTTTTGTGGG + Intergenic
1194651591 X:96521706-96521728 ACTCTTGATGATGGTTTAACTGG - Intergenic
1196046126 X:111258268-111258290 ATTCTGGCTGCTGGTTTTCTGGG - Intronic
1197610682 X:128634883-128634905 AATCTGGAGGCTGTTTTACCAGG - Intergenic
1199503313 X:148533760-148533782 AATCTAGAAATTGGTTTTACTGG + Intronic
1199887094 X:152031027-152031049 ATCATGGAAGCTGGTTTTACCGG + Intergenic
1200299696 X:154960759-154960781 AATCTTGAAGCTGGTTCTTCTGG - Intronic
1200806871 Y:7442684-7442706 AATCTGCCTGCTGGCTTTATAGG - Intergenic
1200900938 Y:8431230-8431252 CACCTGGATGCTGGTTTCAGTGG + Intergenic