ID: 962060396

View in Genome Browser
Species Human (GRCh38)
Location 3:131920867-131920889
Sequence CAATTTGCGGAGAGGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 235}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962060396_962060403 24 Left 962060396 3:131920867-131920889 CCTTCCTCCCTCTCCGCAAATTG 0: 1
1: 0
2: 1
3: 17
4: 235
Right 962060403 3:131920914-131920936 AGACAGATTTACATGGTAAATGG 0: 1
1: 0
2: 0
3: 28
4: 334
962060396_962060401 17 Left 962060396 3:131920867-131920889 CCTTCCTCCCTCTCCGCAAATTG 0: 1
1: 0
2: 1
3: 17
4: 235
Right 962060401 3:131920907-131920929 GCCTCAAAGACAGATTTACATGG 0: 1
1: 0
2: 0
3: 13
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962060396 Original CRISPR CAATTTGCGGAGAGGGAGGA AGG (reversed) Intronic
900573525 1:3371693-3371715 CAATTAGAGGAGAGTGAGCAGGG + Intronic
900988338 1:6086189-6086211 CATTTCGAGGGGAGGGAGGAGGG - Intronic
901646688 1:10720702-10720724 CCATCTGGGGAGAGGGAGGACGG + Intronic
902793265 1:18783624-18783646 CAAAGGGTGGAGAGGGAGGAGGG + Intergenic
903450614 1:23451547-23451569 CAATTTGCCCAGAGGGAAGCTGG + Intronic
904293609 1:29503615-29503637 CAAGTTCAGGAGAGGGAGGAGGG - Intergenic
904752917 1:32752279-32752301 CATTTTGCAGGGAGGGAAGAGGG + Intronic
906096600 1:43228402-43228424 CAATTAGAGAAGATGGAGGAGGG - Intronic
906610933 1:47202003-47202025 CATTGTGGGGAGAGGGAGCATGG + Intergenic
906735343 1:48120678-48120700 GACTTTCTGGAGAGGGAGGATGG + Intergenic
907628749 1:56058612-56058634 GCATTTGGGGAGAGTGAGGAGGG + Intergenic
910372869 1:86536745-86536767 CAATTTGAAGAAAGAGAGGAAGG - Intergenic
914763380 1:150617159-150617181 CAATTTGAGGAGGTGGAGGAAGG - Intronic
922479739 1:225931237-225931259 CTACTTGGGGAGAGGGAGGTGGG + Intergenic
922639499 1:227213920-227213942 CAATTTGTTGAGAGTGAGAAAGG - Intronic
922732856 1:227960550-227960572 CAATTTGAGGAGGGGAAGGAAGG + Intergenic
922769966 1:228176404-228176426 CATTTGGGGGAGAGGGAGGTGGG + Exonic
924517741 1:244780456-244780478 AAAGTTGCTGAGAGGGAGGAGGG - Intergenic
1063332333 10:5173347-5173369 CACTTCCCAGAGAGGGAGGATGG + Intergenic
1063839910 10:10059376-10059398 CAATTAGCAGAGATGGCGGAAGG - Intergenic
1064565517 10:16635382-16635404 CAGCTAGCTGAGAGGGAGGATGG - Intronic
1067147771 10:43706130-43706152 CAAGGTGCTGATAGGGAGGATGG + Intergenic
1067983524 10:51115470-51115492 CAAATTTGGGAGAGGTAGGATGG + Intronic
1068922967 10:62504361-62504383 AATTTTGTGGAGAGGGAAGAGGG - Intronic
1070410311 10:76133544-76133566 CAATGTGTGGAGAGCGAGGAGGG + Intronic
1072240871 10:93494792-93494814 AAAATGGGGGAGAGGGAGGAGGG - Intergenic
1072771237 10:98140437-98140459 CAATAGGCAGAGAGAGAGGAGGG + Intronic
1073674387 10:105628827-105628849 CAATATGCAGAGAGGGAAGCAGG - Intergenic
1074460556 10:113633052-113633074 CAATGTGGGGAGACGGTGGAGGG - Intronic
1074595560 10:114862361-114862383 CAATTTTCTGAGAGGGAGAGGGG - Exonic
1074956012 10:118390564-118390586 CCATTTGGGGAGAAGGAAGAAGG - Intergenic
1075081210 10:119385105-119385127 CAGTTGGAGGGGAGGGAGGAGGG + Intronic
1077337121 11:2010426-2010448 CGATTGGCGTGGAGGGAGGAAGG - Intergenic
1080405293 11:31973317-31973339 CAATTTGCCTAGAGGGCCGAGGG - Intronic
1080787752 11:35491298-35491320 CAGTTTACAGAGAGGGAGGATGG - Intronic
1080828668 11:35870928-35870950 CCATTGCCTGAGAGGGAGGAGGG - Intergenic
1081340760 11:41924424-41924446 CATTGTGGGGAGAGGGAGGAAGG - Intergenic
1081365537 11:42230538-42230560 TAATTTATGGAGAGAGAGGAGGG + Intergenic
1081493176 11:43582370-43582392 CAATGAGTGGAGGGGGAGGAGGG - Intronic
1081592410 11:44433719-44433741 CAATTTGCTGAGTTGCAGGAAGG - Intergenic
1082835707 11:57648973-57648995 GAATTAGGGGAGAGGGAGGGAGG - Exonic
1083072914 11:60005175-60005197 CAATATGTGGAGAGGGAAGACGG + Intergenic
1083535546 11:63463802-63463824 CAAATGGCACAGAGGGAGGAAGG - Intronic
1083773943 11:64884045-64884067 TAATTTGGGGGGATGGAGGAGGG - Intronic
1084488211 11:69463476-69463498 AGATTTTGGGAGAGGGAGGAAGG - Intergenic
1085059976 11:73436753-73436775 CATTTTGAGGAGAGGCAGGGAGG - Intronic
1086428920 11:86716578-86716600 TAATTTGCAGTGAGGGTGGAGGG + Intergenic
1087456819 11:98396880-98396902 CAGTTTGAGGAGAGTCAGGAGGG + Intergenic
1088807085 11:113362427-113362449 CAATTTTCAGAGAGGAAGAAAGG - Exonic
1089312229 11:117566230-117566252 CAATTTATGCAGAGGGTGGAGGG - Intronic
1202820105 11_KI270721v1_random:65608-65630 CGATTGGCGTGGAGGGAGGAAGG - Intergenic
1096011359 12:48218377-48218399 AAATTTTCAGAGCGGGAGGAGGG + Intergenic
1098247183 12:68532131-68532153 CAGATTGGGGAGAGGGAGGCAGG + Intergenic
1103964930 12:124632650-124632672 CAAAGAGAGGAGAGGGAGGAAGG - Intergenic
1105583770 13:21724941-21724963 CAATTGGCGTTGAGGGAGGCAGG - Intergenic
1105825642 13:24120153-24120175 GAGTTTCCGGGGAGGGAGGAAGG - Intronic
1106294096 13:28394417-28394439 CAATATGGTGAGAGGTAGGAGGG + Intronic
1106320613 13:28634438-28634460 CAATTAGTGGAAAAGGAGGAAGG + Intergenic
1106667675 13:31869769-31869791 CAATTTGGTGATATGGAGGAAGG + Intergenic
1106703817 13:32259175-32259197 CATTTGGGGGAGAGGAAGGATGG + Intronic
1107564632 13:41589577-41589599 CTTTGTGGGGAGAGGGAGGAAGG - Intronic
1108463689 13:50693532-50693554 CAGTTTACAGAGAGGGAGGGTGG - Intronic
1110564036 13:76940185-76940207 AAATTAGAGGAGAGGGAGTAAGG - Intergenic
1112270070 13:97960316-97960338 ATATTTGTGGAGAGGGAGAATGG - Intronic
1115465069 14:33706262-33706284 CAAGTGGTGGAGAGGGAGGATGG + Intronic
1116018287 14:39432222-39432244 CAAGTTGTGGAGAGGGGGAAAGG + Exonic
1117692120 14:58318604-58318626 CATTTTGCAGAGAGTGAGGTAGG + Exonic
1118083668 14:62390864-62390886 CTATTAGAGGAGAGAGAGGAAGG + Intergenic
1118422621 14:65623470-65623492 CACTTTGGGGAGACCGAGGAGGG + Intronic
1118853833 14:69606015-69606037 CAATCTGCAGGGAGGAAGGAAGG - Intergenic
1119530807 14:75359803-75359825 CAAATTGTGAAGAGGGAGAAGGG + Intergenic
1119532596 14:75373456-75373478 GAAGTTGGGGAGAGGGAAGAAGG + Intergenic
1119635478 14:76269852-76269874 CGCATTGTGGAGAGGGAGGAAGG - Intergenic
1122007432 14:98717004-98717026 CACTTGGCAGAGAGGGAGGCGGG + Intronic
1122102749 14:99426510-99426532 GAATGTGGGGAGAGGGCGGAAGG + Intronic
1126224373 15:46253264-46253286 CATTTTGAGGAGAGGGAAAATGG + Intergenic
1127594412 15:60464662-60464684 CAATTTGTAGAAAGTGAGGATGG + Intronic
1130322207 15:82850749-82850771 AAATCTGAGGATAGGGAGGAAGG + Intronic
1131306885 15:91252834-91252856 CAAGTTGCTCAGGGGGAGGAGGG - Intronic
1131962263 15:97802022-97802044 CACTTTGAGTAGAAGGAGGAAGG + Intergenic
1132242667 15:100270912-100270934 CAGATGGCTGAGAGGGAGGAGGG - Intronic
1134281303 16:12819504-12819526 CAACTGGCGGAAAGGGAGGAGGG + Intergenic
1135397467 16:22142111-22142133 CAATTTGCTGAGAGGTAGAAAGG - Intronic
1136162790 16:28431662-28431684 CAATTTATGGAGGAGGAGGAAGG - Intergenic
1136200176 16:28683326-28683348 CAATTTATGGAGGAGGAGGAAGG + Intergenic
1136216524 16:28797519-28797541 CAATTTATGGAGGAGGAGGAAGG + Intergenic
1137374685 16:47942373-47942395 CAATTTGGAGACAGGGAGAAGGG + Intergenic
1138423219 16:56913264-56913286 CACTTTGCCCATAGGGAGGAAGG + Exonic
1139193887 16:64896057-64896079 AAATTTGGGGTGGGGGAGGAAGG + Intergenic
1143953225 17:10649917-10649939 CGATTTGGGGATGGGGAGGAAGG - Intronic
1145287996 17:21520872-21520894 CCTATTGCTGAGAGGGAGGAGGG + Intergenic
1145389644 17:22445572-22445594 CCTATTGCTGAGAGGGAGGAGGG - Intergenic
1145774516 17:27518763-27518785 CCTTTGGTGGAGAGGGAGGAGGG - Intronic
1146234957 17:31150620-31150642 CAAAATGAGGAGAGGGAGGGTGG - Intronic
1148633222 17:49128243-49128265 CACTTTCCAGAGAGGGAGAATGG + Intergenic
1149440971 17:56673571-56673593 CAATCTGGGGAGAAGAAGGAGGG + Intergenic
1150873697 17:68944661-68944683 CACTTTGTGGAGGGAGAGGAAGG + Intronic
1152843984 17:82588109-82588131 AAATTTGGGGAGAGGCAGGGTGG - Intronic
1156001435 18:32389053-32389075 CATTTGGTGGGGAGGGAGGAGGG + Intronic
1157079110 18:44502549-44502571 GAATTTGCTAAGAGGGAAGAAGG - Intergenic
1162389149 19:10378653-10378675 CAATTTGTGGAAAGAGAGGAGGG - Intronic
1163398015 19:17075498-17075520 CCATTTGTGGAGACGCAGGAGGG + Exonic
1165283769 19:34820148-34820170 CACTTTGCAGAGTGGGAAGAAGG + Intergenic
1167740276 19:51320439-51320461 CACCAGGCGGAGAGGGAGGAAGG - Intronic
1168258427 19:55179672-55179694 AAAATTGGGGAGAGGGAAGAGGG - Intronic
1168689821 19:58369515-58369537 CAATTTGAAGAGGGGCAGGACGG - Intronic
927410815 2:22824230-22824252 CAATTTGAGAAGAAGGGGGAAGG + Intergenic
928690157 2:33791191-33791213 CAATTTATGGAGATGGAGGGGGG - Intergenic
930066617 2:47332618-47332640 CATTTTGGGGAGAGGCAGGGTGG - Intergenic
931643825 2:64404195-64404217 GGATTTGTGGGGAGGGAGGAGGG - Intergenic
932425494 2:71631833-71631855 CAGTGTGCAGCGAGGGAGGAGGG - Intronic
932577015 2:72968316-72968338 CAGTTTGTGTAGAGGGTGGAAGG - Intronic
937369488 2:121287384-121287406 CAATCTGTGGAGATGGAGGGAGG + Intergenic
937803510 2:126108919-126108941 TTATTTGCTGAGAGGGAGTAAGG + Intergenic
938706835 2:133938846-133938868 AGCTTTGCGGAGAGGCAGGAGGG - Intergenic
939878818 2:147606976-147606998 GAAATTGCATAGAGGGAGGAGGG - Intergenic
942575862 2:177362859-177362881 CTATTTGCTGAGAGTGAGGCAGG - Intronic
944230793 2:197390165-197390187 TAATTTGAGGATAGAGAGGAGGG - Exonic
944571444 2:201049213-201049235 CAATTTGCTGAGAGAGATGTGGG - Intronic
944817126 2:203388921-203388943 CAATTTGCTGAGAAACAGGAAGG - Intronic
948027604 2:234790360-234790382 GAAGGTGAGGAGAGGGAGGAAGG + Intergenic
948258158 2:236583620-236583642 CAAAATGGGGAGGGGGAGGAGGG + Intergenic
948320042 2:237061699-237061721 CAAGATGGGGAGATGGAGGAAGG + Intergenic
1169348414 20:4848422-4848444 GGATTTGCGGGGTGGGAGGATGG - Intergenic
1170972268 20:21126567-21126589 CAATTTGAAGAGAGTGGGGAGGG - Intronic
1173018208 20:39245748-39245770 CAGTTTTCACAGAGGGAGGAGGG + Intergenic
1173058377 20:39637891-39637913 CCATGTGCTGAGAGGAAGGAAGG - Intergenic
1173282764 20:41643987-41644009 CCATCAGAGGAGAGGGAGGATGG + Intergenic
1173285000 20:41662331-41662353 AAATGTGTGGAGAGGGTGGATGG + Intergenic
1173749563 20:45466793-45466815 CTAGTTGCAGAGAGGGAGGATGG + Intergenic
1174107151 20:48170876-48170898 CAATTTGCTGATAGAGAAGAAGG + Intergenic
1174373361 20:50109321-50109343 CAATTTGTGGGGAGGTGGGAGGG + Intronic
1175056275 20:56201496-56201518 CATCATGGGGAGAGGGAGGAAGG + Intergenic
1178116636 21:29424542-29424564 GAACTTGGGGAGAGAGAGGAAGG - Intronic
1179399408 21:41070110-41070132 CACTCTGGGGAGAGTGAGGAGGG - Intergenic
1180576651 22:16782158-16782180 CAATTAGCAGAGAGGGTGAAGGG + Intergenic
1183559829 22:38563683-38563705 AAATTTGTGGAGATGGGGGAGGG - Intronic
1184073396 22:42161114-42161136 CAATGTGGGGGGAGGGGGGAGGG - Exonic
1185258597 22:49849551-49849573 GCCTCTGCGGAGAGGGAGGAAGG + Intergenic
949899799 3:8801976-8801998 CAATTTGCCCAAAGGAAGGAAGG + Intronic
950453100 3:13076509-13076531 GCATTTGGGAAGAGGGAGGACGG + Intergenic
950846158 3:16017853-16017875 CAGTTTGAGGAGAGCCAGGAGGG + Intergenic
953026009 3:39145357-39145379 AAATGGGTGGAGAGGGAGGAGGG - Intronic
953873248 3:46646116-46646138 CAATCTGGGGGGAGGGAGGGAGG - Intergenic
954001951 3:47564808-47564830 TACTTTACGGAGAGGGAGGTGGG + Intronic
954483495 3:50823804-50823826 CAATTTACTGGGAGGGAGGTGGG - Intronic
956012924 3:64850730-64850752 AGAGTTGCAGAGAGGGAGGATGG + Intergenic
956040504 3:65140234-65140256 TTGTTTGTGGAGAGGGAGGAAGG + Intergenic
956122059 3:65976381-65976403 CACTGTGGGGAGACGGAGGAGGG + Intronic
959418822 3:106109505-106109527 GAATTTGGGGTGAGGGGGGAGGG - Intergenic
960361413 3:116716368-116716390 CAGTTTGGGGAGGTGGAGGAGGG + Intronic
961023223 3:123528010-123528032 GAATTTGGGGAGAGTGAGGCAGG + Intronic
961334756 3:126166208-126166230 CACTTCCCGGAGAGGGAGAATGG - Intronic
961467447 3:127090356-127090378 CAGTCTCCTGAGAGGGAGGAGGG - Intergenic
962060396 3:131920867-131920889 CAATTTGCGGAGAGGGAGGAAGG - Intronic
962384939 3:134925323-134925345 GAATGTGTGGAGAGGAAGGAGGG + Intronic
964023814 3:152047106-152047128 CCATTTGAGGAGGGTGAGGAAGG - Intergenic
964130249 3:153279009-153279031 CAGTTTCAAGAGAGGGAGGAGGG - Intergenic
966848008 3:184145386-184145408 CACCTGGGGGAGAGGGAGGACGG + Intronic
967278243 3:187797528-187797550 ATATTTGCGGAGAGGATGGATGG - Intergenic
968346882 3:198015957-198015979 CAGTTTGGGAAGAGGGAAGATGG + Intronic
969408328 4:7010419-7010441 CCATTTGCGGGGTGGGAGCAGGG + Intronic
971184951 4:24365992-24366014 CAACTTGTGGAGAGGAAGTAAGG + Intergenic
971944384 4:33255224-33255246 CACTTCCCGGAGAGGGAGAATGG + Intergenic
972217038 4:36909186-36909208 CAGTCTGAGGAGAGGCAGGAGGG - Intergenic
972921002 4:43941699-43941721 CAGTCTGCAGAGAGGCAGGAAGG - Intergenic
976546786 4:86344654-86344676 GAATATGAGGGGAGGGAGGAAGG + Intronic
976770326 4:88645362-88645384 CAATTTGCGGAAAAGCAGAAAGG + Intronic
977066504 4:92322979-92323001 CAATTAGCAGATAGGGAGAAAGG - Intronic
978441319 4:108737270-108737292 CACTTTGTGAAGAGGGTGGAGGG - Intergenic
981032163 4:140136368-140136390 TAATATGCGGTGGGGGAGGAGGG - Intronic
983421227 4:167520070-167520092 AAAGTTGAGGAGATGGAGGACGG - Intergenic
986372817 5:7097831-7097853 CAATTGGAGGAGAGAGAAGAGGG + Intergenic
987080717 5:14423078-14423100 CAAGATGCTGAGACGGAGGAAGG - Intronic
988864263 5:35317566-35317588 CAATTTGGGGTGAGGGTTGAGGG - Intergenic
990262590 5:54041148-54041170 CAATTTGATGAGACTGAGGATGG - Intronic
993714464 5:91261690-91261712 AAATTTGTGGAGAGTGAGAAGGG + Intergenic
993776395 5:92003499-92003521 CTATTTGTAGAGAGGAAGGAAGG + Intergenic
995695341 5:114872927-114872949 CCATTTACTGAGAGGGAGAAAGG - Intergenic
996064639 5:119067436-119067458 CTATTTGGGGTGGGGGAGGAGGG + Intronic
998855176 5:146387736-146387758 CCATTTGAGGAGAAGAAGGAAGG - Intergenic
1001740066 5:174045784-174045806 CAATTTGAAGAGGAGGAGGACGG - Exonic
1004031332 6:11871978-11872000 CAATTTGTGAAAAGGAAGGAAGG - Intergenic
1004442177 6:15663849-15663871 GAATTGACGGAGAGGGAGGAAGG - Intergenic
1004943285 6:20584497-20584519 CAGTGTGGGGAGAGGAAGGAAGG + Intronic
1006194076 6:32227166-32227188 CCATTTGTGGAAAGGGAGGCTGG + Intergenic
1006388949 6:33747513-33747535 GACTTTGCAGAGAGTGAGGAGGG + Intergenic
1006822314 6:36907073-36907095 GAAGTTGGGGAGAGGGAGGAAGG - Intronic
1010318834 6:74483202-74483224 GAATATGTAGAGAGGGAGGAAGG - Intergenic
1010654488 6:78496102-78496124 CAATTTGGGGTGAGGAAGAAAGG - Intergenic
1011203751 6:84868783-84868805 CAATTAGTGAAGAGGAAGGAAGG + Intergenic
1012995998 6:105975476-105975498 CAATGGGCTGAGAGGGAGGCAGG + Intergenic
1014714082 6:124843462-124843484 CCATTTGCTGAGAGTGAGAAAGG - Intergenic
1014734716 6:125078877-125078899 CTATTTGTGGAGATGGGGGAGGG - Intronic
1015511717 6:134044238-134044260 CAATTAGTGGAGAGCGATGAGGG - Intronic
1017986024 6:159443935-159443957 GAATTAGGGGAGAAGGAGGAAGG - Intergenic
1018039794 6:159911720-159911742 TCATTTGCTGAGAGTGAGGAAGG - Exonic
1019362587 7:612594-612616 CTATTAGAGGAGAGGAAGGAAGG + Intronic
1019468810 7:1206387-1206409 ACATTCGCGGGGAGGGAGGAGGG + Intergenic
1019819782 7:3234055-3234077 CAAATTCGGGAGAGGGAGGGAGG + Intergenic
1023156123 7:37254166-37254188 CTATTTTCGGGGATGGAGGAAGG - Intronic
1023619502 7:42055467-42055489 CAGCTAGCAGAGAGGGAGGAGGG - Intronic
1023967611 7:44971028-44971050 GAGTTTGTGGAGACGGAGGAGGG - Exonic
1025187262 7:56870980-56871002 CAACTTGGTGAGAGGGAGGGTGG - Intergenic
1025257402 7:57393882-57393904 TAACTTGGGGAGAGGGATGAAGG - Intergenic
1026223194 7:68418225-68418247 GTATATGAGGAGAGGGAGGATGG - Intergenic
1029984966 7:104914590-104914612 CAATTTGCGGAGAGGGCAGAGGG + Intergenic
1030606777 7:111646159-111646181 CAATTTGAGGAGTGGAAAGATGG + Intergenic
1032587535 7:133161272-133161294 CAATTTGGGAAGAGTGATGAGGG + Intergenic
1033025075 7:137764391-137764413 GAATTTGCAGAGAGCCAGGATGG + Intronic
1039205231 8:35145542-35145564 GAAATTGGGGAGAGGGGGGAAGG - Intergenic
1040614414 8:49020078-49020100 CAATTTGTGTAGAGGCAGCAGGG - Intergenic
1042352319 8:67789809-67789831 CACTTTTCTGGGAGGGAGGAGGG + Intergenic
1042387210 8:68190592-68190614 CCACTTGTGGAGAGGTAGGAAGG + Intronic
1045334973 8:101192855-101192877 TAATTTCAGTAGAGGGAGGAGGG + Intronic
1045432338 8:102124915-102124937 AAATTTGAGGGGAGGAAGGAGGG - Intergenic
1045847247 8:106652237-106652259 CAATTTGCTGAGAGTGAGCTTGG + Intronic
1048317288 8:133371575-133371597 AAAGTTGGGGACAGGGAGGAGGG + Intergenic
1050866935 9:10512650-10512672 CAATTTGTTGAGAGGGAAGGAGG + Intronic
1051605508 9:18914384-18914406 GAAGTTCCGGAGAGGGAGGCAGG - Intergenic
1052995093 9:34547713-34547735 CAGTTTGGGGAGAGGCTGGAAGG - Intergenic
1053078893 9:35158013-35158035 AAAGTAGCGGGGAGGGAGGAGGG - Intergenic
1054934389 9:70671251-70671273 CAATTTGCAGTCAGGGAGTAGGG + Intronic
1055028918 9:71752447-71752469 TAATTTGCCAAGAGGAAGGAAGG + Intronic
1055299179 9:74865249-74865271 CAATTTGGAAAGAGGAAGGAAGG - Intronic
1059276728 9:113104002-113104024 CAATTTGAGGAGGCTGAGGAAGG + Intergenic
1059511871 9:114855672-114855694 CATTTTGCAGAGAAGGAAGAAGG + Intergenic
1060488696 9:124065791-124065813 CCATTTGCGGTGAGGTAGGGAGG + Intergenic
1061908024 9:133708703-133708725 CAATGTGTGGAGAGCGAGGCTGG - Intronic
1062031243 9:134362995-134363017 TAATTTGGGGAGAGTGTGGACGG + Intronic
1062038206 9:134392114-134392136 CATTTTGCAGAGGGGGAGGGTGG + Intronic
1186108411 X:6229524-6229546 CAAGTTGCGGGGGGCGAGGACGG + Intergenic
1186389147 X:9141168-9141190 CACTTTGAAAAGAGGGAGGAAGG + Intronic
1187366097 X:18666854-18666876 CCATTTGCGGGGCGGGCGGAAGG + Intronic
1187565260 X:20443323-20443345 CCATTTGCTGAGATGGAGGAGGG + Intergenic
1187752311 X:22479869-22479891 GAATTTGGGTAGAGGGAGGGAGG + Intergenic
1188000312 X:24974245-24974267 CAAGTTGGGGAGAAGCAGGAGGG + Intronic
1189110846 X:38286969-38286991 CAAGATGAGGAGAGGGAGAAGGG - Exonic
1190072724 X:47292394-47292416 CACTTCCCGGAGAGGGAGAATGG + Intergenic
1190708288 X:53048515-53048537 CAAATCGAGGAGAGGGGGGACGG + Intergenic
1190855899 X:54294643-54294665 CAGTTTGCTGAGCGGGAGCAAGG + Exonic
1192573084 X:72222123-72222145 CACTTCCCGGAGAGGGAGAATGG - Intronic
1195110142 X:101639946-101639968 GAAATTTAGGAGAGGGAGGAGGG + Intergenic
1195577558 X:106468177-106468199 GAATTTGAGGAGGAGGAGGAGGG - Intergenic
1196938612 X:120753777-120753799 TAATTTAGGGAGAGGGAGGTGGG - Intergenic
1197649781 X:129051967-129051989 CAATTTGAGGAAAGGGGTGATGG + Intergenic
1197856987 X:130924246-130924268 AAATTTGGGGGGAGGGGGGAGGG + Intergenic
1198556625 X:137800018-137800040 CAATGTCTGGAGATGGAGGAGGG - Intergenic
1199278601 X:145974162-145974184 CAATCTGAGGAGAGTCAGGAGGG - Intergenic
1199866117 X:151851799-151851821 AAATTAGTGGAGAGGGAGGGAGG - Intergenic
1200094949 X:153653997-153654019 CAATTAGCCGCAAGGGAGGATGG - Intergenic
1201436752 Y:13967302-13967324 CAATATGGGGCAAGGGAGGAAGG + Intergenic
1201632253 Y:16081521-16081543 CAATTCCTGGAGAGGGAGAATGG - Intergenic
1202237226 Y:22725349-22725371 CACTTTCCAGAGAGGGAGAATGG - Intergenic