ID: 962061254

View in Genome Browser
Species Human (GRCh38)
Location 3:131929940-131929962
Sequence CTGCATGTGGATCTTATACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 116}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962061254_962061259 21 Left 962061254 3:131929940-131929962 CCATGTATAAGATCCACATGCAG 0: 1
1: 0
2: 2
3: 8
4: 116
Right 962061259 3:131929984-131930006 GTGCTATTACAAATGTACTGTGG 0: 1
1: 0
2: 0
3: 11
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962061254 Original CRISPR CTGCATGTGGATCTTATACA TGG (reversed) Intronic
904285449 1:29450673-29450695 TTCCATCTGGATTTTATACATGG - Intergenic
906459122 1:46023816-46023838 CTGCTTGTTGATCTTCTTCATGG - Exonic
908834156 1:68211755-68211777 CACCATGTGGATCTTGGACATGG + Intronic
909350545 1:74647984-74648006 CTGCAGGTGGTTCTGATGCATGG - Intronic
910508168 1:87974089-87974111 CTGCAAGTCGTTCTTATGCAGGG + Intergenic
912215264 1:107603503-107603525 GTGTCTGTGTATCTTATACAGGG - Intronic
915690606 1:157685661-157685683 CTGCATGTGGAACATATCCTAGG + Intronic
915801008 1:158793772-158793794 CTGCAGCTGGATCTTACCCATGG - Intergenic
918340696 1:183565866-183565888 CTGCATGTGGCTCCTTTACATGG - Intronic
920698839 1:208202601-208202623 CTGTCTGTGGATTTTGTACATGG - Intronic
920729883 1:208473540-208473562 CTGCTAGTGGTTCTTGTACAAGG - Intergenic
922413602 1:225398900-225398922 CAGCATGTGGAAATTATACCTGG - Intronic
923698252 1:236276088-236276110 CTGCCTGTTGTTCTTAAACATGG - Intronic
924290680 1:242533717-242533739 CTGCATGTGATTCTTAGACTGGG - Intergenic
1063534024 10:6864883-6864905 CTTGATGTGGATCTTATTCTTGG - Intergenic
1065387088 10:25144331-25144353 CTGCATGTGGACCTGATAGATGG - Intergenic
1068598013 10:58924769-58924791 CTACATGTAGATTTTGTACATGG + Intergenic
1070721954 10:78763089-78763111 CTGCCTGTGCTTCCTATACAGGG + Intergenic
1071396592 10:85229675-85229697 CTGCATGTGGATTTGACATAAGG - Intergenic
1072204613 10:93192062-93192084 TTGCATGTGGGTTTTATTCATGG - Intergenic
1073274723 10:102300263-102300285 CTGGAAGTGGTTCTTATACTTGG + Intronic
1075502242 10:122985794-122985816 CTGCATTTGGATTGTCTACATGG + Intronic
1077158616 11:1102636-1102658 CTGCATGGGCATCATATGCACGG - Intergenic
1077199678 11:1299669-1299691 CAGTATGTGCATCTTGTACATGG - Intronic
1078148693 11:8740652-8740674 CTGCAGGTGAAGGTTATACAGGG + Intronic
1078329936 11:10410864-10410886 CTGCAAGTGGAGCTTGGACAAGG + Intronic
1079809928 11:24984770-24984792 CTGCATCTCGATTTTATAAAGGG - Intronic
1079870412 11:25792247-25792269 CTTCATGTTGATCTTAGACCAGG + Intergenic
1079968586 11:27008157-27008179 GTGCATGTGGTTCTTCTTCATGG - Intergenic
1080438631 11:32269731-32269753 CTGAATGAGATTCTTATACAAGG - Intergenic
1087366408 11:97225357-97225379 CTGAATGTGGGTCTCATAAAGGG + Intergenic
1088700915 11:112410819-112410841 TTGCATTTGGGTCTTATTCAGGG + Intergenic
1100690491 12:97034123-97034145 TTGCATGTGGAACTGCTACATGG + Intergenic
1101997665 12:109536472-109536494 CTTCATGTGGATTTTTGACAAGG + Exonic
1103657982 12:122489085-122489107 ATGCTTGTTGAACTTATACATGG - Intronic
1105756060 13:23465791-23465813 CAGCATGTAGATTTCATACAGGG + Intergenic
1106152695 13:27121520-27121542 CTTCATGGGGCTCTTATTCATGG - Intronic
1109863253 13:68227330-68227352 CTGCATGTGCAACCTATAAAGGG + Intergenic
1109935617 13:69280043-69280065 CTGGATGGGAATCTTATACTAGG - Intergenic
1111690751 13:91560227-91560249 CTACATGTGTATCTCCTACAAGG + Intronic
1113182633 13:107648632-107648654 CTGCATGTGGGTGTTATAGCAGG - Intronic
1119066719 14:71535550-71535572 CTGCATGTGGTTATTATCAAGGG + Intronic
1121833821 14:97074379-97074401 CAGCATGTGGAACTTTTCCAAGG - Intergenic
1124486682 15:30123462-30123484 CTACCTGTGGTTCTTAGACAGGG + Intergenic
1124541760 15:30592441-30592463 CTACCTGTGGTTCTTAGACAGGG + Intergenic
1124548416 15:30654236-30654258 CTACCTGTGGTTCTTAGACAGGG + Intronic
1124756846 15:32414856-32414878 CTACCTGTGGTTCTTAGACAGGG - Intergenic
1124826902 15:33106101-33106123 CTGGATCTGAATCTTATAAATGG + Intronic
1126616746 15:50590453-50590475 CTTAATGTGGAGATTATACATGG - Intronic
1136671932 16:31866153-31866175 CTGCATGTGAATATTACACAGGG + Intergenic
1138098432 16:54232022-54232044 CTGCATCTGGATGTTTTATAAGG + Intergenic
1142231094 16:88900643-88900665 CTGCATGTGGAGGTGGTACATGG + Intronic
1145788521 17:27609733-27609755 CTGCCTGTGGATCTCAAACTTGG - Intronic
1150657516 17:67049949-67049971 TTGGATGTTGATCTTGTACATGG - Intronic
1152141136 17:78537446-78537468 CTCCATGCGGATCTCAAACAGGG + Exonic
1160332459 18:78007009-78007031 CTGCATTTGCATGTTATCCATGG - Intergenic
1160667672 19:340639-340661 CTGCATGGGTCACTTATACATGG - Intronic
1162755753 19:12858575-12858597 CTGCTTGTTGATCTTTTTCATGG - Exonic
929633078 2:43486469-43486491 CTGTTTCTGGATCTTATCCATGG - Intronic
931174727 2:59842233-59842255 CTGCATGAGGATCTTACTCTAGG - Intergenic
931572561 2:63684181-63684203 CAGCATGTGGATCATTTTCAAGG + Intronic
933557307 2:83847156-83847178 CTGCATGTGGACATTTTCCATGG - Intergenic
936953006 2:117997216-117997238 CTGCAGGTGGATCTTCTGCAGGG - Intronic
943469649 2:188277946-188277968 CTCCACTTGGAACTTATACAGGG - Intergenic
948492966 2:238325467-238325489 CTGCATGTGGTTGGAATACAAGG + Intronic
949081145 2:242100639-242100661 CTGCAGGTGGAACTGACACATGG + Intergenic
1170883504 20:20318125-20318147 CTGCAAGTGGATCTTATGCAGGG + Intronic
1171570044 20:26240495-26240517 CATCATGTGGATCTTCTAGATGG + Intergenic
1172799427 20:37565653-37565675 CAGCGTGAGGATCTTATAAAAGG - Intergenic
1173163212 20:40667727-40667749 GTGTATGTGGATTGTATACATGG + Intergenic
1174916487 20:54659453-54659475 CTGCTTGTGTGTCCTATACAGGG - Intergenic
1177610776 21:23445131-23445153 GTGAAAGTGGATCATATACAAGG - Intergenic
1181074981 22:20369537-20369559 CTTCATCCGGATCATATACAGGG + Exonic
1181441277 22:22936307-22936329 GTGCATGTGGATGTTAGCCAGGG + Intergenic
1182511151 22:30821456-30821478 CTGGATGTGGATCTAAGAGACGG + Intronic
949258657 3:2080546-2080568 CTGCATGTGATTCTGATATAAGG + Intergenic
951464313 3:22985794-22985816 CTGCAAGTGGCTCATTTACATGG - Intergenic
953845273 3:46421793-46421815 CTGGAGGTGGATATTTTACATGG - Intergenic
955405532 3:58623425-58623447 CTGCAGGTGGAGCTTCTGCAGGG - Intronic
955820280 3:62889260-62889282 CTTCATGTAGATCTTATTCCAGG + Intergenic
957109424 3:75933720-75933742 CGTCATGTGGATCTTCTAGATGG - Intronic
962061254 3:131929940-131929962 CTGCATGTGGATCTTATACATGG - Intronic
963555647 3:146783987-146784009 ATACATGGAGATCTTATACAAGG - Intergenic
963562481 3:146883364-146883386 CTGCATATGGATATTACAAAGGG - Intergenic
976735983 4:88310098-88310120 CAGCATGTGGATCATTTGCAAGG - Intergenic
980267917 4:130543817-130543839 CTGAATGTAGTTGTTATACATGG + Intergenic
981516806 4:145619096-145619118 TTTCATGTGGATCTTAAAAAGGG + Exonic
981766769 4:148259817-148259839 CTCCAGGTGGTTTTTATACAAGG + Intronic
986076273 5:4340936-4340958 CTGCCTGTGGATTTTACTCAGGG - Intergenic
990006600 5:50952054-50952076 CTGCATGTGAACCTTATGTATGG + Intergenic
991589000 5:68229534-68229556 CTGCATGTGGTTCCTAGACCTGG - Intronic
993392760 5:87341292-87341314 CTTCATGTGGATCTTCTTCCCGG - Exonic
994162360 5:96570981-96571003 CTGCATGATGATATTACACAAGG + Intronic
1000593171 5:163183145-163183167 CTGCATGGGTATGTTTTACATGG + Intergenic
1000986840 5:167869736-167869758 CTGCATGTGCAGCTTTTAGAGGG - Intronic
1005565312 6:27086888-27086910 CTGAATGTTGAGCTTATTCAAGG - Intergenic
1008245940 6:49173010-49173032 ATGCATGTGGATATTATTTATGG + Intergenic
1012032611 6:94091489-94091511 TTACATGTGGATCTTTTTCAAGG + Intergenic
1012388567 6:98710049-98710071 CTCCATGTGGATGTACTACATGG + Intergenic
1012909762 6:105105396-105105418 CTGGATGTGAATGTTATACTTGG - Intronic
1020315748 7:6904272-6904294 TTGTATGTGGATCTTTTTCATGG - Intergenic
1021712912 7:23434272-23434294 GTGGATGTGGTTCTTAGACAAGG + Intronic
1022265463 7:28749369-28749391 CTGCATGTGGCTGATTTACAAGG + Intronic
1022546572 7:31194543-31194565 CTCCCTGTTTATCTTATACAGGG - Intergenic
1024489042 7:49956583-49956605 CATCATATAGATCTTATACATGG - Intronic
1026579694 7:71604669-71604691 TTCCCTGTGGCTCTTATACAGGG + Intronic
1032167898 7:129559961-129559983 CTGCCTGTGGACCTAAGACATGG + Intergenic
1035279877 7:157771105-157771127 CTGCATGTGGAGCCTCCACAAGG - Intronic
1035539054 8:417445-417467 CTGCAGGTGGAACTGACACATGG + Intronic
1036040655 8:5076616-5076638 CTGTATATGCATCTCATACATGG - Intergenic
1039974860 8:42353981-42354003 CTACATGTGCATCTCATACAGGG + Intronic
1040731749 8:50456162-50456184 CTGGATGTATAGCTTATACAGGG - Intronic
1044965193 8:97567735-97567757 CTCCAGGTGGTTCTGATACAGGG - Intergenic
1045600609 8:103711565-103711587 CTGCATATTTAGCTTATACACGG - Intronic
1046539108 8:115556101-115556123 CTACATGTGGATCTCAAACAGGG + Intronic
1049993624 9:1013289-1013311 CTGACTATGGATCTCATACAGGG - Intergenic
1050394805 9:5184866-5184888 CTGCATTTTTATCTTCTACAAGG + Intronic
1051711725 9:19937187-19937209 CATCTTGTGGATATTATACATGG - Intergenic
1056054086 9:82802539-82802561 CTGCCTGTGGATCTTAAAAAGGG - Intergenic
1058015392 9:100026292-100026314 CTGCATGTGGTCTTGATACAGGG - Intronic
1187402332 X:18972704-18972726 CTGCATATAGATCTTATATATGG + Intronic
1190086702 X:47401357-47401379 CTGCCTGTGGATCTTATATAAGG + Intronic
1191217031 X:57943454-57943476 CGGCATATGGATTTTATATATGG + Intergenic
1194585575 X:95729993-95730015 CTGCATTTGCACCTTATAAATGG + Intergenic
1195593840 X:106665221-106665243 CTTTAAGTGTATCTTATACAAGG + Intronic
1199408084 X:147485875-147485897 GTCCATGTGGATCATACACAGGG + Intergenic
1199471348 X:148199195-148199217 CTGCCTGTAGATACTATACAAGG - Intergenic