ID: 962061793

View in Genome Browser
Species Human (GRCh38)
Location 3:131935651-131935673
Sequence CTGTATGACCAGAAGATTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 150}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962061791_962061793 -7 Left 962061791 3:131935635-131935657 CCTTCAATGATCAAAACTGTATG 0: 1
1: 0
2: 0
3: 21
4: 184
Right 962061793 3:131935651-131935673 CTGTATGACCAGAAGATTCAGGG 0: 1
1: 0
2: 0
3: 18
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962061793 Original CRISPR CTGTATGACCAGAAGATTCA GGG Intronic
900753765 1:4418750-4418772 CTGTATTTCCAGCACATTCATGG - Intergenic
900958797 1:5906273-5906295 GTGAATGACAAGAAGTTTCAGGG - Intronic
901837989 1:11936457-11936479 CTGTATCACCAGAAGGATCCCGG + Intronic
901955102 1:12778347-12778369 CTGTATGAGCAGGAGCCTCAGGG + Intergenic
901972819 1:12921185-12921207 CTGTATGAGCAGGAGCCTCAGGG + Intronic
902012361 1:13280577-13280599 CTGTATGAGCAGGAGCCTCAGGG - Intergenic
902452801 1:16508650-16508672 CTGTCAGAACAGAAGTTTCAGGG + Intergenic
902472861 1:16661321-16661343 CTGTCAGAACAGAAGTTTCAGGG + Intergenic
902485942 1:16746122-16746144 CTGTCAGAACAGAAGTTTCAGGG - Intronic
904016763 1:27427656-27427678 CTCTATGACCAGATGATGTATGG - Intronic
904415719 1:30360043-30360065 CTGCATGACCAGAGGCTCCAGGG - Intergenic
907725907 1:57020258-57020280 CTGTATGAATAGCAGATCCAAGG + Intronic
909137519 1:71820247-71820269 TTAGATGACCAGAAGATTGAGGG + Intronic
911336624 1:96588970-96588992 CAGGATGACCTGAACATTCATGG + Intergenic
914003083 1:143709140-143709162 CTGTCAGAACAGAAGTTTCAGGG + Intergenic
914004858 1:143723554-143723576 CTGTCAGAACAGAAGTTTCAGGG + Intergenic
914094289 1:144531626-144531648 CTGTCAGAACAGAAGTTTCAGGG + Intergenic
914097214 1:144554176-144554198 CTGTCAGAACAGAAGTTTCAGGG + Intergenic
914301778 1:146383433-146383455 CTGTCAGAACAGAAGTTTCAGGG - Intergenic
914304234 1:146402262-146402284 CTGTCAGAACAGAAGTTTCAGGG - Intergenic
914515491 1:148370672-148370694 CTGTCAGAACAGAAGTTTCAGGG + Intergenic
916786866 1:168092876-168092898 CTCTATGCCCAGGAGCTTCAAGG + Intronic
917431289 1:174972252-174972274 CTGTTAGACCAGAAGCTACATGG + Intronic
919969921 1:202569053-202569075 CTGTGTGATCAGCAGATTCACGG - Intronic
920689303 1:208133802-208133824 CTGAATTACCAGAAGAATCAGGG - Intronic
1063362138 10:5467703-5467725 CTGGCTGGTCAGAAGATTCAAGG - Intergenic
1064914648 10:20442780-20442802 CAGTAAGACCAAAAGATTCAGGG + Intergenic
1066616436 10:37299829-37299851 CAGTGTGACCTGAAGATTCATGG - Intronic
1072719641 10:97772431-97772453 CAGGAGGACCAGAAGATCCAGGG - Intergenic
1074801219 10:117003661-117003683 TTGATTGACCAGAAGATCCACGG + Intronic
1076410349 10:130244765-130244787 CTGTAGCACTAGAAGATTCCTGG - Intergenic
1079106945 11:17577902-17577924 CTGAATGACAAGGAGAGTCACGG - Intronic
1079784242 11:24650997-24651019 GTGTATGACAAGAAGAAGCAGGG - Intronic
1081855115 11:46298167-46298189 CTGTATGAGCATAAGGTTCAGGG - Intronic
1082646209 11:55729799-55729821 CTGCATGACAACAAGTTTCAGGG - Intergenic
1090592117 11:128283375-128283397 CTGTATTATGAGAAGATTTAAGG - Intergenic
1092745642 12:11669711-11669733 CTGTATGAACAGAACATGAATGG - Intronic
1092988044 12:13865922-13865944 ATGTCTGACCGGAAGATCCAGGG - Exonic
1093846660 12:23980201-23980223 CAGTATGAAAAGAATATTCAAGG - Intergenic
1094180647 12:27589346-27589368 CTTTGAGACCAGAAAATTCACGG - Intronic
1101719739 12:107341089-107341111 CTCTATGAGCAGAAGAGCCAAGG + Intronic
1105245603 13:18647194-18647216 CTGCAGGCCCAGAGGATTCAGGG - Intergenic
1106761424 13:32872420-32872442 CTGCAGGCCCAGAAGATTCAGGG - Intergenic
1107212741 13:37876882-37876904 CTGTATCACCAGAATATAGAAGG - Intergenic
1108515079 13:51193717-51193739 CTGTAAGACTAGAAAATGCATGG + Intergenic
1109349782 13:61163655-61163677 ATGTATGACCAGAAATTTCAGGG + Intergenic
1109603052 13:64657989-64658011 CTGTGTGACCTCAGGATTCATGG + Intergenic
1112399013 13:99059362-99059384 CTGTATGCCCAGCTGATCCATGG - Intronic
1112539798 13:100297811-100297833 CTGTTTGAACAAAAGATTCATGG + Intronic
1112574332 13:100622039-100622061 CTGTGAGACCTGAAGATTCCAGG - Intronic
1117908521 14:60614388-60614410 CCTTATGACCAGAGCATTCATGG - Intergenic
1118939322 14:70317886-70317908 CTGTGAGGCCAGAAGATTCCTGG - Intergenic
1122648906 14:103214364-103214386 CTTTATGACCAGTTGATTGAGGG - Intergenic
1122982777 14:105199084-105199106 CTGTGTGAGCAGAAGCTTCCTGG + Intergenic
1124623340 15:31292805-31292827 CTCTCTGACCAGAAGAGCCATGG - Intergenic
1132758843 16:1499299-1499321 CTGTAAGAACAGAAGCTTCTGGG - Exonic
1134004321 16:10807761-10807783 CTGTGAGAACAGCAGATTCAGGG - Intronic
1140292141 16:73669479-73669501 CTGTGTGACCAAAAGACTCAGGG + Intergenic
1140831883 16:78759477-78759499 CTGTATGTCAAGAGGCTTCAAGG - Intronic
1144271548 17:13622179-13622201 TTCTATCACCAGAAAATTCAAGG - Intergenic
1150018824 17:61589647-61589669 CAGTATGACCAGAGCATTTAGGG + Intergenic
1150750806 17:67861011-67861033 CTGTATGTCCAGCAGACTCCTGG + Intronic
1150793389 17:68218663-68218685 CTGTATGTCCAGCAGACTCCTGG + Intergenic
1152333294 17:79685832-79685854 ATGGATGACCAGATCATTCACGG - Intergenic
1152939629 17:83161362-83161384 CTGTGTGCCCAGAAGAGGCAGGG - Intergenic
1154443343 18:14412736-14412758 CTGCAGGCCCAGAGGATTCAGGG + Intergenic
1156712274 18:39961474-39961496 CTGTGTGACCTGAAAATACAAGG - Intergenic
1157684452 18:49631182-49631204 CAGTCTGAGCAGAAGATCCAAGG - Intergenic
1159975320 18:74704194-74704216 CTGGTTTACCAGAAGATTTAGGG - Intronic
1160805264 19:989769-989791 CAGGATGACCAGAAGGTTCCCGG - Exonic
925986058 2:9216121-9216143 GTGAAGCACCAGAAGATTCATGG + Intronic
926082039 2:9995096-9995118 CTGAATGATCAGGACATTCACGG + Intronic
928489710 2:31769103-31769125 CTGGCTGACCAGAAGATTTAGGG + Intergenic
932115048 2:69038422-69038444 CTGTATGAGGAGAAGAATCCAGG + Intronic
932862151 2:75305361-75305383 GTGTAAGACCAAAAGCTTCAGGG + Intergenic
936541996 2:113359871-113359893 CTGAATGAGCGGTAGATTCAGGG - Intergenic
936806716 2:116342055-116342077 CTTTATTACAAGAAGGTTCATGG - Intergenic
941624716 2:167818701-167818723 CTGTGTGAGGAGGAGATTCAAGG - Intergenic
941959063 2:171235779-171235801 CTGTATGAGAAGAAGATGCCTGG - Intergenic
942624389 2:177883974-177883996 AGGTATGAGCAGAAGATTTAAGG - Intronic
945126369 2:206515527-206515549 CTGTAGGAGCAGAAGATTAAAGG - Intronic
946267191 2:218556316-218556338 CAGTTTGGCCAGAAAATTCAGGG + Intronic
947012080 2:225577635-225577657 AGGTAAGACCAGATGATTCATGG + Intronic
1168856653 20:1013590-1013612 CTGAATGATCAGAAGTTTCAAGG - Intergenic
1169302187 20:4452679-4452701 TGGTATGTCCAGAAGATGCAGGG + Intergenic
1171131677 20:22659704-22659726 AAGTCTGACCAGAAAATTCATGG + Intergenic
1171519781 20:25766829-25766851 CTGAGTGGCCAGAAGATTCCTGG + Intronic
1171557139 20:26089664-26089686 CTGAGTGGCCAGAAGATTCCTGG - Intergenic
1172944787 20:38678789-38678811 CTGTGTGACCACAGGATACAGGG + Intergenic
1175988191 20:62774722-62774744 CTGTGTGAACAGAAGACCCAAGG + Intergenic
1176452749 21:6878472-6878494 CTGCAGGCCCAGAGGATTCAGGG - Intergenic
1176653922 21:9573114-9573136 CTGAGTGGCCAGAAGATTCCTGG + Intergenic
1176830922 21:13743521-13743543 CTGCAGGCCCAGAGGATTCAGGG - Intergenic
1177937044 21:27361941-27361963 TTGTATGACCTGAATATTAATGG + Intergenic
1178079163 21:29045245-29045267 CTGTAATACCAGAAGAATGAAGG - Intronic
1178233813 21:30819072-30819094 CTGGATGCACAGTAGATTCATGG + Intergenic
950352811 3:12373957-12373979 CTGTATGACTAAAAGAGGCAGGG + Intronic
950667442 3:14505947-14505969 CTGGATGACCAGGAGCTCCAGGG - Intronic
954394451 3:50286083-50286105 CTTTCTGACCAGAAGATGCCAGG + Intronic
954958585 3:54544360-54544382 CTGTAAGATCAGAAGATTGGAGG - Intronic
955489032 3:59464062-59464084 CAGTCTAACCAGAAGATTTAGGG - Intergenic
960736608 3:120787880-120787902 CTGTATGCCCCAATGATTCAAGG - Intergenic
962061793 3:131935651-131935673 CTGTATGACCAGAAGATTCAGGG + Intronic
963354217 3:144189809-144189831 CTGTATGACCAAAAGATGGCAGG + Intergenic
965126368 3:164635116-164635138 CTGTATGTTCAGAATATTCTTGG - Intergenic
965331203 3:167377005-167377027 CTGAATGACCAAAAGACACAAGG - Intronic
966770011 3:183495401-183495423 CTATATGAACAAAAGATTCAAGG - Intronic
972122990 4:35728934-35728956 ATGTATTACCAGAAAATTCACGG + Intergenic
981552152 4:145952888-145952910 CTATGTGACCAGAGGAGTCAGGG - Intergenic
981834052 4:149034407-149034429 CTGTATGTACAGAATATTTAGGG + Intergenic
982536853 4:156617652-156617674 CTGTGTGTCCAGAAGTTGCAGGG - Intergenic
983027042 4:162750833-162750855 CTGTATGCACAGATGTTTCATGG - Intergenic
987306439 5:16642089-16642111 CTAAAGGACCAGAAGATGCAGGG - Intergenic
990431967 5:55744750-55744772 CTGTAGCATCAGAATATTCATGG - Intronic
992727223 5:79620200-79620222 CTGTACGATCAGATGAGTCATGG + Intronic
995909009 5:117163305-117163327 CTGTAGAAGCAGAAGTTTCATGG + Intergenic
996676817 5:126185203-126185225 CAGTATGACAAAAAGATCCAAGG - Intergenic
997697967 5:135876484-135876506 CTGCATGATCAGACGGTTCAAGG + Intronic
998214310 5:140225788-140225810 CTCTATCTCCAGTAGATTCACGG - Intronic
1000597454 5:163232272-163232294 CTATAGGCCCAGAAGGTTCACGG + Intergenic
1002420256 5:179142606-179142628 CAGAATGACCAGAAGCTTAATGG + Intronic
1002892614 6:1348678-1348700 CTGAATGACCTGCAAATTCAGGG - Intergenic
1003549427 6:7089452-7089474 TTGTGTAACCAGAAAATTCAAGG - Intergenic
1003922637 6:10847385-10847407 CTGAAGGACCAGAACATTCACGG + Intronic
1005292732 6:24395383-24395405 CTGAAGGACCAGAAAAGTCATGG - Intergenic
1007334490 6:41142994-41143016 CTGTATGACCTGACAATTCCTGG - Intergenic
1009878348 6:69534349-69534371 CTGTAAGACAAAGAGATTCATGG + Intergenic
1010545007 6:77142631-77142653 CTTTATGATCAGAAGATTTGGGG - Intergenic
1012985802 6:105875215-105875237 CTGTATGGCCTACAGATTCATGG - Intergenic
1014196488 6:118566009-118566031 CTGTATGCAGAGAAGAGTCAAGG - Exonic
1020601286 7:10277366-10277388 CTTTATGACCAGGAGACACATGG - Intergenic
1021589924 7:22249769-22249791 CTGTATGACCCGCAGAGTTAGGG - Intronic
1025280267 7:57621780-57621802 CTGAGTGGCCAGAAGATTCCTGG + Intergenic
1025304466 7:57843721-57843743 CTGAGTGGCCAGAAGATTCCTGG - Intergenic
1026204905 7:68248566-68248588 ATGGATGCCAAGAAGATTCAAGG + Intergenic
1026537837 7:71254889-71254911 CTGTCTGAGGAGAAGATTCTGGG + Intronic
1029867864 7:103655153-103655175 CTGTATAACCTGAATATTAAAGG + Intronic
1031714201 7:125086900-125086922 CTATATGTTCAGAAGTTTCAAGG + Intergenic
1032459576 7:132100573-132100595 CTGGATGACCAGAAGTTTGAAGG + Intergenic
1035918411 8:3651017-3651039 CTGTATGATGAAAAGAGTCAAGG - Intronic
1037614052 8:20501286-20501308 CTATATGACAAGGAGATTAAAGG - Intergenic
1038376017 8:27041275-27041297 CTGTATCACCATAAGCTTGAAGG + Intergenic
1041955843 8:63557571-63557593 CTATTTGAGAAGAAGATTCAGGG - Intergenic
1044634796 8:94311569-94311591 CTGTATGTCTAGAAGTTTCCTGG + Intergenic
1045963391 8:107995761-107995783 CTGAATTATGAGAAGATTCATGG - Intronic
1047397663 8:124516974-124516996 CTGTAAGAACAGAAGTTACATGG + Intronic
1048707111 8:137166177-137166199 CTGCAGGATCAGAAGATTCAGGG - Intergenic
1050148926 9:2599679-2599701 CTGTGTTACCAGAAGCCTCATGG - Intergenic
1050676940 9:8066645-8066667 GTGTATGACCAGAAAATCCTTGG - Intergenic
1053469521 9:38336285-38336307 CTGCTTGGCCATAAGATTCAAGG - Intergenic
1054937452 9:70703444-70703466 CTGAATGAAAAGAAAATTCATGG + Intronic
1054939143 9:70721437-70721459 CTGAATGAAAAGAAAATTCATGG + Intronic
1056200758 9:84274080-84274102 CTGCATGACCAGAAGGTGGAAGG + Intergenic
1056371619 9:85960876-85960898 GCGTATGACAGGAAGATTCATGG + Intronic
1057219573 9:93248731-93248753 CTGTATGTGCAGAAGATACTAGG - Intronic
1059087123 9:111316216-111316238 CTGTATAACTAAAATATTCACGG - Intergenic
1059563820 9:115362653-115362675 CTTTATGTGCAGAAGAATCAAGG + Intronic
1203516432 Un_GL000213v1:6043-6065 CTGCAGGCCCAGAGGATTCAGGG + Intergenic
1203631642 Un_KI270750v1:76566-76588 CTGAGTGGCCAGAAGATTCCTGG + Intergenic
1186917118 X:14234811-14234833 CTGGATGATCAGAGGATTCTGGG + Intergenic
1186993809 X:15098005-15098027 ATGTATGCCCAGCAGATTCCTGG + Intergenic
1188643445 X:32535211-32535233 GTTTATGAGCAGAAGATGCACGG + Intronic
1189397951 X:40640479-40640501 ATGTATGCCCAGGAGAGTCAGGG + Intronic
1190369239 X:49725912-49725934 CAGTTTAACCAGAAGAGTCATGG - Intergenic
1192150279 X:68707831-68707853 CTGAGTGACCAGAAGGTACAAGG + Intronic
1193645446 X:84063285-84063307 CTGTATTATCATAGGATTCAAGG + Intronic
1195399642 X:104447700-104447722 CTGTTTGAGCAGAAAATTCTGGG + Intergenic
1196289690 X:113924478-113924500 CTTTATGACCAGAATATACAAGG - Intergenic
1197153257 X:123243210-123243232 CTGTATGAAGAGTAGATTTAAGG - Intronic