ID: 962066386

View in Genome Browser
Species Human (GRCh38)
Location 3:131985711-131985733
Sequence TGATGGGCATATGACTTAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 131}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962066386 Original CRISPR TGATGGGCATATGACTTAAT TGG (reversed) Intronic
902050251 1:13558460-13558482 CCATGGGTATATGAGTTAATTGG - Intergenic
902164206 1:14556437-14556459 TCATGTGCTTATGAATTAATGGG - Intergenic
904478028 1:30777068-30777090 TGATGGCCATATGTCCTCATGGG - Intergenic
907600021 1:55760093-55760115 TGCTGGCAATATGACTGAATAGG + Intergenic
910308387 1:85793847-85793869 TAATGGGGATATGACTTAACAGG + Intronic
915307500 1:154989035-154989057 TGTTGGGGATATGGCTCAATAGG + Intronic
916255500 1:162783411-162783433 GAATGTGCATATGACTGAATAGG + Exonic
918025091 1:180736108-180736130 TGATGGGAATGTAACATAATGGG + Intronic
918073382 1:181150433-181150455 TGATGGGCTAATGGATTAATGGG - Intergenic
919680180 1:200426343-200426365 TGATGGACATGTGACCTAAATGG - Intergenic
921618706 1:217302502-217302524 TGATGGTCATTTAACTTAGTAGG + Intergenic
923587714 1:235289760-235289782 AAATGGGCATATGACATAAAAGG + Intronic
1066721964 10:38349071-38349093 GAATGTGCATATGACTGAATAGG + Intergenic
1068708636 10:60106284-60106306 TGTTAGGCATAGGATTTAATGGG + Intronic
1068734206 10:60393489-60393511 TGTTGGGCATATGGAGTAATGGG + Intronic
1074230447 10:111528967-111528989 TGATGGGGACATGTCTTATTAGG + Intergenic
1077248721 11:1551350-1551372 GGATGGGCAGATGAATGAATGGG - Intergenic
1077248857 11:1551833-1551855 GGATGGGCAGATGAATGAATGGG - Intergenic
1081338348 11:41896195-41896217 TAATGGAAATATTACTTAATAGG - Intergenic
1082241246 11:49873449-49873471 TGCTGGGCATAAGAGTTATTTGG - Intergenic
1082608040 11:55266008-55266030 TGCTGGGCATAAGAGTTATTTGG + Intronic
1085505602 11:77056886-77056908 TGGGGGGCATATGGCTGAATTGG - Intergenic
1093430500 12:19080083-19080105 TTAGGGGGATATAACTTAATGGG + Intergenic
1095195162 12:39305757-39305779 TGATAGGCATAGGACTGATTAGG + Intronic
1095987603 12:48010070-48010092 TCATGGGCATATGAGTTATCTGG - Intergenic
1104172605 12:126296773-126296795 TGATGGGCTTATGCATTTATGGG + Intergenic
1108800239 13:54086292-54086314 TAATGAGCATATTACTCAATAGG + Intergenic
1115509176 14:34123186-34123208 TGATGGACACATGACTTCAGTGG - Intronic
1115858366 14:37656557-37656579 TGATGGGCATTTGACTTGAGAGG + Intronic
1116719664 14:48479098-48479120 TGATGGTCAATTGACTTGATGGG + Intergenic
1121940996 14:98070585-98070607 TGTTGGGCATATGACTTGCTTGG + Intergenic
1124065848 15:26342965-26342987 TGATGGGCATTTGCCTTATCTGG + Intergenic
1125780548 15:42262408-42262430 TGATGAGCAGATGAATTAATTGG - Intronic
1125893379 15:43282222-43282244 TGAGGGTCAGATGAATTAATGGG - Intronic
1126338910 15:47618137-47618159 AGATGGGGATAATACTTAATTGG + Intronic
1127669485 15:61181591-61181613 TGATGGGCATGTCACTGAAAAGG - Intronic
1128773831 15:70303589-70303611 GGATGGGCAGATGAATGAATGGG + Intergenic
1130357760 15:83149976-83149998 TCATGTGCATATGAATTACTTGG + Intronic
1131520820 15:93113528-93113550 GCTAGGGCATATGACTTAATAGG - Intergenic
1131892763 15:96991668-96991690 TGATGGGAGTATTACTTAACTGG - Intergenic
1132369291 15:101282735-101282757 TTATGTGCATGTGAATTAATGGG - Intronic
1135145810 16:19961829-19961851 TGATGGGTTAATGAATTAATGGG + Intergenic
1146396823 17:32474614-32474636 TGATGGGCATATGGGTTTAGGGG + Intronic
1149365317 17:55938063-55938085 TGATGGGCATATGGGTTATTTGG + Intergenic
1155903848 18:31425534-31425556 TGATGGCCATAAAACTTACTTGG + Intergenic
1159851107 18:73528179-73528201 TGATGGGCATTTGAGTTGGTAGG + Intergenic
1160322860 18:77912761-77912783 TGATGGGAATGTGTCTTAATAGG - Intergenic
1162389628 19:10381449-10381471 GGATGAGCGGATGACTTAATAGG - Intergenic
1163885119 19:19958645-19958667 TAATGGGCAAATGATATAATAGG - Intergenic
1164326992 19:24202717-24202739 TTCTTGCCATATGACTTAATGGG + Intergenic
925204984 2:1997882-1997904 TGATGGCCAAATGACATAATGGG - Intronic
925322240 2:2981921-2981943 TGATGGACATTTGGGTTAATGGG + Intergenic
925836978 2:7955764-7955786 TGATGAGCATGTTACTTGATGGG + Intergenic
927105628 2:19821221-19821243 TTATGGCCATATGACATACTTGG - Intergenic
928758338 2:34552852-34552874 TGATGGGCAGTTGAACTAATTGG - Intergenic
931339640 2:61387116-61387138 TCATAGGCATATTACTTATTTGG - Intronic
931578411 2:63745886-63745908 TGATCAGCATCTGCCTTAATGGG - Intronic
936609530 2:113988300-113988322 TGGTGGGCATGTCACTTAAGTGG - Intergenic
938594739 2:132776541-132776563 TGAGGGGCAGATGACTCACTGGG + Intronic
939136179 2:138297239-138297261 TGATGAGAATATGACGTTATTGG - Intergenic
942154076 2:173108639-173108661 TGATGGGCATAACACTTTCTTGG + Intronic
942332053 2:174836798-174836820 AGATGAGCATATGATATAATTGG + Intronic
1169592375 20:7159457-7159479 TTATGGACATATGACATAGTAGG + Intergenic
1171061353 20:21965290-21965312 TAATGGGCATATAACTTATATGG - Intergenic
1172804461 20:37601462-37601484 TGATGGGCTAATGGATTAATGGG + Intergenic
1175016142 20:55792743-55792765 TGTTGGGCAAATTACTTAACTGG - Intergenic
1177946676 21:27479332-27479354 TGTTGGGTATTGGACTTAATTGG - Intergenic
1178224840 21:30704050-30704072 TGATGGGTTAATGAATTAATAGG - Intergenic
1179468729 21:41596500-41596522 CGCTGTGCATATGACTTTATTGG + Intergenic
1182188179 22:28429596-28429618 TGATGGACATATGTCTAGATGGG - Intronic
1183029249 22:35090727-35090749 TGATGAGAAAATTACTTAATGGG - Intergenic
951927004 3:27918777-27918799 TAATGGGCAAATGAGGTAATTGG - Intergenic
953028488 3:39159660-39159682 TGATGTGCATAAGAATCAATTGG - Intergenic
954931208 3:54283594-54283616 TTCTGGGGATATGATTTAATTGG + Intronic
955465544 3:59233368-59233390 TGATGAGGATATGAAGTAATGGG - Intergenic
956753711 3:72365359-72365381 TGATGGCCACATAAGTTAATGGG - Intergenic
960434224 3:117605828-117605850 CAATGGTCATTTGACTTAATGGG + Intergenic
962066386 3:131985711-131985733 TGATGGGCATATGACTTAATTGG - Intronic
964861196 3:161203546-161203568 AAATGGGCAAAAGACTTAATAGG + Intronic
966343529 3:178952057-178952079 TAAAGGGCAAATGAATTAATTGG + Intergenic
968844043 4:3029884-3029906 TGATCTGGAAATGACTTAATTGG + Intronic
970267485 4:14305097-14305119 TGATAAGCATATGGCTAAATTGG + Intergenic
970680646 4:18503814-18503836 TGAAGGACATATGATTTAGTTGG + Intergenic
971203724 4:24540219-24540241 TGATGGAGATCTGACTGAATTGG - Exonic
972863269 4:43199014-43199036 TGATGGGGATACAACTTAAAAGG + Intergenic
973285633 4:48412993-48413015 AGATGGGCAGATCACTTAAGAGG + Intronic
973816458 4:54623834-54623856 TGATGAGTAAATGAATTAATAGG + Intergenic
976099144 4:81541973-81541995 TGATGGACATGTGACTGAATGGG + Intronic
977817079 4:101427179-101427201 AGGTGGGCATATGACAAAATTGG + Intronic
979864992 4:125743074-125743096 TGATTGCTATATGATTTAATAGG + Intergenic
980662806 4:135886538-135886560 TCATGGGCAAATAACTTATTTGG + Intergenic
988892544 5:35633962-35633984 TGATGGGCTTAAGATGTAATTGG - Intronic
989796897 5:45485283-45485305 TGATAGTCATATGCCTTAGTAGG - Intronic
994687562 5:102974500-102974522 TGAAGGGAATAAGAATTAATGGG + Intronic
995226646 5:109708351-109708373 TAATGGGCAGATGAATGAATGGG + Intronic
995798305 5:115963554-115963576 TAATGGGTATATTTCTTAATGGG - Intronic
999643913 5:153699491-153699513 TAAGGGGCATTTGACTGAATTGG - Intronic
999662693 5:153882305-153882327 TAATGGGCAGATGAGTCAATAGG - Intergenic
1001801647 5:174549385-174549407 TAAAGGGCATATGACTCCATGGG + Intergenic
1011162911 6:84412085-84412107 CCATAGGCATATGAATTAATTGG - Intergenic
1012501899 6:99897495-99897517 TGACAGCCATATGACTTAAAAGG + Intergenic
1014562221 6:122905176-122905198 TAATGGGCATAGTACTCAATAGG + Intergenic
1014665708 6:124234536-124234558 TGATGGGCAATTGGCTAAATAGG - Intronic
1015147917 6:130007954-130007976 TAGTGGGCATATGATTTAAAAGG - Intergenic
1017990835 6:159488642-159488664 TGAAGGGCATATTACATATTAGG - Intergenic
1018314387 6:162542614-162542636 TGAATAGCAAATGACTTAATAGG + Intronic
1020503930 7:8959481-8959503 TGAAGAGCATAGGAATTAATAGG - Intergenic
1020527229 7:9277524-9277546 TTATGGGCAAAAGACTTATTAGG + Intergenic
1020590763 7:10133925-10133947 TGATGTGCATATGTAATAATGGG - Intergenic
1028043174 7:86084086-86084108 TGAAGGGTGTATGATTTAATAGG - Intergenic
1035109138 7:156465503-156465525 TCATGGCCAGCTGACTTAATGGG + Intergenic
1039979661 8:42397605-42397627 TTATTGTCATATGACTTAAAGGG + Intronic
1040695377 8:49991299-49991321 TGATGGGGATATGAAAAAATTGG + Intronic
1042341266 8:67682579-67682601 TGATGGGAATTTGACTTTGTTGG + Intronic
1043875086 8:85476820-85476842 TGATCAGCTAATGACTTAATGGG + Intronic
1044204823 8:89481057-89481079 TGAGGCTCATATGACTTAACAGG + Intergenic
1044746707 8:95377958-95377980 TTTTGGGCAAATCACTTAATTGG - Intergenic
1047860895 8:128965315-128965337 TGATGGGAATATGGCTTTCTGGG - Intergenic
1048037033 8:130686613-130686635 TAATGGGCACATGACTTATCCGG + Intergenic
1048177858 8:132169294-132169316 TGAGGTGCATCAGACTTAATGGG - Intronic
1048426048 8:134324415-134324437 TGAGGGGCATGTGACTGAACAGG - Intergenic
1050067454 9:1775263-1775285 TGATGGTCATATGGCTAAAATGG + Intergenic
1052017060 9:23481614-23481636 TGATGGGCATAAGTCTTAAATGG + Intergenic
1055930138 9:81551756-81551778 TTATGAGCATATGAATGAATGGG + Intergenic
1057419785 9:94901951-94901973 TAATGTGCATATGAATGAATTGG + Intronic
1058656501 9:107226695-107226717 AGATGGGCATGTGACATAAGTGG + Intergenic
1058784990 9:108378184-108378206 ACATGTGCATATGACTTATTTGG + Intergenic
1059739524 9:117136010-117136032 TGAAGGGCATATTGTTTAATGGG - Intronic
1186877006 X:13826914-13826936 TGCTGGGTAGATGAGTTAATTGG - Intronic
1187579878 X:20596290-20596312 TAATGTGCATATGACTTACCTGG + Intergenic
1187704121 X:21992754-21992776 TCATTGGCATATGATTTACTTGG - Intronic
1188530079 X:31130235-31130257 TTATGGACAAATCACTTAATGGG + Intronic
1188595241 X:31892332-31892354 TGATGGGCATAGAACTTCACCGG + Intronic
1190496925 X:51035463-51035485 TGATAGGCATAAGAATTAAAAGG - Intergenic
1191646614 X:63488429-63488451 TGAGGGGAATATGACCTAGTGGG + Intergenic
1194528601 X:95013558-95013580 TGATCCACATATGACATAATTGG - Intergenic
1194821763 X:98516332-98516354 AGATGGTCATATGAATTAAATGG - Intergenic
1194934923 X:99937393-99937415 TGGTGGGCTTATGAGCTAATGGG + Intergenic
1195930738 X:110072944-110072966 TGATGAGCATAGTACTCAATAGG + Intronic
1196512310 X:116526120-116526142 TAATGTGCATATGACTCACTTGG - Intergenic
1197255492 X:124258428-124258450 TTGTGGGCATATGATGTAATTGG + Intronic