ID: 962066530

View in Genome Browser
Species Human (GRCh38)
Location 3:131987270-131987292
Sequence AAGGAAAACCTCTTTGGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 188}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962066526_962066530 16 Left 962066526 3:131987231-131987253 CCAGTGGTTGCCTCTGGGAGAGT 0: 1
1: 0
2: 1
3: 26
4: 138
Right 962066530 3:131987270-131987292 AAGGAAAACCTCTTTGGTGCTGG 0: 1
1: 0
2: 3
3: 19
4: 188
962066527_962066530 6 Left 962066527 3:131987241-131987263 CCTCTGGGAGAGTATTGACTGAA 0: 1
1: 0
2: 2
3: 7
4: 108
Right 962066530 3:131987270-131987292 AAGGAAAACCTCTTTGGTGCTGG 0: 1
1: 0
2: 3
3: 19
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962066530 Original CRISPR AAGGAAAACCTCTTTGGTGC TGG Intronic
900309005 1:2024537-2024559 CAGGGAGACCTCTTTGGTGAGGG + Intronic
900375964 1:2354938-2354960 AAGGGAAATATCTTTTGTGCTGG + Intronic
901330834 1:8407101-8407123 TAGGAAACCCTCTGTGGTACAGG + Intronic
901338247 1:8470547-8470569 AAGAAATATCTCTTTGGGGCTGG - Intronic
902617139 1:17629983-17630005 AAGGGAGACCTCTTTGATGCTGG + Intronic
903314863 1:22495310-22495332 AAGAGAAATCTCTTGGGTGCTGG + Intronic
903421961 1:23224521-23224543 GAGTAAAACCCCTTTGTTGCGGG - Intergenic
903469521 1:23576182-23576204 AAGGAAAACCTCATGGCTACTGG + Intergenic
907226696 1:52954013-52954035 CAGCAAAACCTTTGTGGTGCCGG + Intronic
907343814 1:53757662-53757684 GAGGAAAACTTCTGAGGTGCTGG - Intergenic
910620530 1:89248584-89248606 AAGGAAAACCACTTCTGTGAAGG + Intergenic
910792193 1:91063271-91063293 AAGGAAAACTGCCTTGGTTCTGG + Intergenic
915636231 1:157189095-157189117 AGGGAAAGCCTCTTTGGAGAGGG + Intergenic
917052823 1:170942784-170942806 AAGGAAACTTTCTTTGGTTCTGG + Intronic
917191967 1:172427549-172427571 AATAAAAACCTGTTTGGTGTGGG - Intronic
919059910 1:192619323-192619345 ATGGAAAAACTCTTTGATGATGG - Intergenic
919712771 1:200744707-200744729 AAGGAAGACCTCTCTAGTGGAGG + Intronic
922138110 1:222852501-222852523 TAAGAAAACAACTTTGGTGCCGG - Intergenic
923338701 1:232990659-232990681 AAGGGAAACCTCTGAGGTGCTGG - Intronic
924174722 1:241378850-241378872 AAGGAAAACTTCTGTGATGATGG - Intergenic
1064280102 10:13943717-13943739 AAGGTAACACTCTTTGGTGTGGG - Intronic
1068744298 10:60512561-60512583 AAGGAAAACGATTTTGCTGCTGG + Intronic
1070157758 10:73846581-73846603 ATTAAATACCTCTTTGGTGCTGG - Intronic
1070804979 10:79265644-79265666 AAGGAAAACCTCTCTGATGTAGG + Intronic
1071340348 10:84640928-84640950 AAGGCAAACTTCTCTGGTGCTGG - Intergenic
1072349851 10:94545959-94545981 GAGGAAAACCTTTTGGGCGCGGG + Intronic
1072430618 10:95367849-95367871 AAGGAAAAGGTCTTCGGTGCTGG + Intronic
1074144736 10:110707134-110707156 AAGGAAAATCTATTTAGTGATGG + Intronic
1074829602 10:117239770-117239792 AAGGAAAACCACTTAGGAGGAGG - Intergenic
1074846983 10:117407049-117407071 AAGGAAATCCTCTCTGGGGTTGG + Intergenic
1077084031 11:738834-738856 CATGAAAACCTCTGTGGGGCTGG + Intergenic
1078420367 11:11206729-11206751 AAGGAAAGCCTCTTGGCTTCGGG - Intergenic
1078506288 11:11950447-11950469 AAGGAAAACCTCCCAGTTGCTGG - Exonic
1079081461 11:17416128-17416150 AAGTGAAGCCTCTTTGGTGTTGG + Intronic
1081963140 11:47152987-47153009 AAGGAAAAGCTTTGAGGTGCTGG + Intronic
1084991904 11:72933810-72933832 AAGTAAAAACTATTTAGTGCTGG + Intronic
1085015987 11:73174329-73174351 AAGGGAAGCCTCTGTGGTGGTGG + Intergenic
1087431996 11:98066584-98066606 AAGGAAAACCCCTGGGGTGATGG + Intergenic
1088280091 11:108126772-108126794 AAAGAAAACCTGTTTGTTGCCGG - Intronic
1088863681 11:113825865-113825887 AAGGAAAACCTTTTGGGTGCTGG + Intronic
1090711120 11:129386679-129386701 AAGAAAAACGTCTTTGGTGTTGG - Intronic
1092496995 12:9006302-9006324 AAGGAAGGCCTCTTTGGGGAGGG + Intronic
1093946913 12:25119953-25119975 GAGGAAAGCCTCTTTGTTGCAGG + Intronic
1094004546 12:25735034-25735056 AGAGAAAGCCTCTTTGGTGGGGG - Intergenic
1099817721 12:87669719-87669741 AAGGAAGGCCTATTTGTTGCAGG + Intergenic
1100405427 12:94268618-94268640 AAGGAATACCACTCTAGTGCAGG + Intronic
1101551182 12:105763824-105763846 AAGGAAAACAGCTTGGGTCCTGG - Intergenic
1103979295 12:124726184-124726206 AAGGAACATCTCTTTCCTGCTGG - Intergenic
1107313599 13:39106598-39106620 AAGGAAACAATCCTTGGTGCTGG + Intergenic
1112429288 13:99336406-99336428 AAGGAATACCTTTTTGGCACTGG - Intronic
1113799551 13:113079271-113079293 AAGAAAGACCTCACTGGTGCAGG + Intronic
1115050403 14:29054152-29054174 AAGGAAGACCTATTTGGTGCAGG - Intergenic
1115271207 14:31555475-31555497 AAGGAATACTTGTTTGGTACTGG + Intronic
1118737325 14:68711369-68711391 AAGGAAAACATCCTTGGTTCTGG - Intronic
1118807678 14:69251797-69251819 AAGGAAAACTTTTTTCTTGCTGG + Intergenic
1119595441 14:75928713-75928735 AAGGAAAGCCTCTTCTGTCCTGG + Intronic
1121289743 14:92764285-92764307 ATGGAGAAGCTCTTTGGTGTTGG + Intergenic
1121291450 14:92779215-92779237 ATGGAGAAGCTCTTTGGTGTTGG - Intergenic
1124223965 15:27873135-27873157 AAGGAGAATCTCTTTAGAGCAGG + Intronic
1124599498 15:31120937-31120959 AAGAAAGATCTCCTTGGTGCAGG + Intronic
1127320217 15:57836922-57836944 AAAAAAAATCTCATTGGTGCTGG + Intergenic
1128305454 15:66595278-66595300 CAGAAAAACCTTTCTGGTGCCGG + Intronic
1129626169 15:77202465-77202487 AAGAAAATCATCTTTGGGGCTGG + Intronic
1129859440 15:78848979-78849001 AATGAAAATCTCTCTGGTGAAGG - Intronic
1130209987 15:81914132-81914154 AAGAAAAACTTCTTTGGGACTGG - Intergenic
1130366930 15:83249218-83249240 AGGGAAAACCCCTTTGGACCAGG - Intergenic
1132678554 16:1130610-1130632 CAGGAAAGCCTCCTGGGTGCTGG - Intergenic
1133386681 16:5375716-5375738 ATGGGAAACATCTTTGGTGGTGG + Intergenic
1134068799 16:11247850-11247872 AAGGGTTACCTCTTTGTTGCGGG + Intergenic
1141962924 16:87421424-87421446 AAGCAAAAGCGCTCTGGTGCTGG + Intronic
1143567004 17:7728594-7728616 AAGGAAAACAACTTTGTTGCAGG + Intronic
1144191092 17:12846905-12846927 GAGGAAAACTTTTGTGGTGCTGG + Intronic
1144294984 17:13865808-13865830 CAGGAAGTCCTCTTTGGTGGCGG - Intergenic
1146010556 17:29191164-29191186 AAGGAAAAAGTCTGTGGTGAAGG - Intergenic
1146389282 17:32406540-32406562 AAGAAAAACTTCTTTGCTACAGG + Intergenic
1148286052 17:46392885-46392907 AAGGGAAAACTCTTTGGAGAAGG - Intergenic
1148308219 17:46610475-46610497 AAGGGAAAACTCTTTGGAGAAGG - Intronic
1150024767 17:61662343-61662365 AAGGACAACCTCCTTTATGCTGG + Intergenic
1150218570 17:63483497-63483519 AACGAAACCCACTTTGATGCTGG + Intergenic
1150453453 17:65288397-65288419 AAAGAAAAACTTTTTGTTGCTGG + Intergenic
1151494000 17:74448851-74448873 TAGGAAAACCTGGTTGGTGTTGG - Intronic
1153340830 18:3973003-3973025 AAGCAAAGCCTTTTTGCTGCAGG + Intronic
1153457829 18:5298238-5298260 ATTGAAAGCCTCTTGGGTGCTGG - Intergenic
1153764984 18:8366670-8366692 AAGGATCACCCCTTTGGAGCAGG + Intronic
1154266409 18:12883307-12883329 AAGCAAAGCCTCTTTCGTTCCGG + Intronic
1160996293 19:1883589-1883611 AAGGATAACATCTTTGTTTCTGG - Intronic
1161252235 19:3286314-3286336 AAGGAAACCCTTTTTGAGGCTGG + Intronic
1161401930 19:4069826-4069848 AATGAAGACCTCCCTGGTGCAGG - Intergenic
1165597602 19:37023660-37023682 CAAGAAAACCTCTTTTGGGCTGG - Intronic
1167297086 19:48657378-48657400 AAGCAAAACAGCTTTGGTCCAGG - Intergenic
926849307 2:17177560-17177582 AATGAACCCCTCTCTGGTGCTGG + Intergenic
928269802 2:29845812-29845834 GAGGAGCACCTCTTGGGTGCTGG + Intronic
929713849 2:44291578-44291600 GAGGAAAGCCTCTTTGCTCCTGG + Intronic
931239873 2:60442529-60442551 AAAGAATTCCTTTTTGGTGCTGG - Intergenic
931437956 2:62265446-62265468 AAGGCAAACCTTTTTGGCACAGG - Intergenic
931466388 2:62491098-62491120 AAAAAAAACCTCTTCAGTGCAGG + Intergenic
934762276 2:96863288-96863310 AAGGAAAACCACCATGGTGAGGG + Intronic
937043978 2:118841452-118841474 AAGGGAACCCTCTTTGGTTTAGG + Intergenic
938163075 2:129004043-129004065 AAGGAAAACATCACTGGTGCAGG - Intergenic
940370128 2:152892063-152892085 AGGGGAAACTTCTGTGGTGCTGG + Intergenic
943344497 2:186722617-186722639 AAAGAAAACTTCTCTGCTGCAGG + Intronic
945974889 2:216262672-216262694 GAGGAAAAGATCTTTGGAGCAGG + Intronic
947372398 2:229461735-229461757 AATGAAAAACTATTTGGTGATGG + Intronic
1175130851 20:56788550-56788572 AGGGAAGGCCTCTTTGGGGCAGG + Intergenic
1177137899 21:17326544-17326566 AAGGAAGAACTCTCTGTTGCAGG - Intergenic
1179332913 21:40422772-40422794 AACCAAAATCTCTTTGCTGCAGG + Intronic
1179609175 21:42538410-42538432 AAGGAAAATCTCTCTGGCGTAGG + Intronic
1179609346 21:42539823-42539845 AAGGAAAACCTCCTGGTTGCTGG - Intronic
1181538373 22:23559333-23559355 GAGGAAAAGATCTTTGGGGCTGG + Intergenic
1181623318 22:24105690-24105712 ATGGAAAGCCTCTTTGATGTAGG - Intronic
1182459072 22:30471616-30471638 CAGGTAAACCTCTCTGGTTCTGG + Intronic
949939414 3:9143323-9143345 TAGGCAACCCACTTTGGTGCTGG - Intronic
951088958 3:18549679-18549701 AAGGCATACCTCTTGGGTCCTGG + Intergenic
953082280 3:39631964-39631986 AATGAGAACCTGCTTGGTGCAGG - Intergenic
953804994 3:46061101-46061123 AAGCAAATCCTTTTTGGTGGGGG + Intergenic
955862281 3:63344406-63344428 ATAGAAAACCTCTTTGTTCCTGG - Intronic
959289868 3:104460108-104460130 AATGAATACCTCATTGGCGCTGG + Intergenic
959670157 3:108967884-108967906 AATGAAAACAACTTTGGAGCGGG + Intronic
962066530 3:131987270-131987292 AAGGAAAACCTCTTTGGTGCTGG + Intronic
963247099 3:143073631-143073653 AAGGAAAACAGCTTTGGTTAAGG + Intergenic
965291068 3:166881673-166881695 AAGGATTCCCTATTTGGTGCTGG - Intergenic
965744546 3:171910669-171910691 AAGGAAAAGCTGTGTGGTACTGG - Intronic
967504834 3:190242135-190242157 AAAGAACACCTTTTTGGTGCTGG + Intergenic
968966579 4:3772014-3772036 AAGGAAATATTCCTTGGTGCAGG + Intergenic
969295367 4:6267381-6267403 AAGGAAAGCCTTATTGGTGGTGG - Intergenic
969822643 4:9732157-9732179 AAGGAAAACCACCTTAGGGCTGG - Intergenic
969995518 4:11308372-11308394 AATTAAAACCTCTTTGCGGCTGG + Intergenic
970422850 4:15921200-15921222 AATGAAGACCTCTATGGTGAGGG - Intergenic
970523590 4:16909688-16909710 AGGGGAAACCTGTTTGGTTCTGG - Intergenic
970658192 4:18255169-18255191 AGGGAAAACTTCTATGCTGCTGG - Intergenic
972105021 4:35473494-35473516 CAGGAAAACCTCTGTGGAGATGG - Intergenic
975065587 4:70059457-70059479 AAGGATAACCTCTCTGGTATAGG + Intergenic
975108079 4:70591932-70591954 AAACAAAACCTGTTTTGTGCAGG - Intergenic
976309651 4:83598166-83598188 AAGGAATACCTCTCTGGTCATGG - Exonic
981006429 4:139879874-139879896 AATTAAAACCTCTTTCGGGCTGG + Intronic
981294242 4:143112226-143112248 AATCAAAACTTCTTTGGGGCAGG - Intergenic
981578729 4:146230977-146230999 AAAGAAAACTTCTTTGGGGGTGG - Intergenic
983293298 4:165833667-165833689 AAAGAAAATCTCATTGCTGCAGG - Intergenic
984864085 4:184266311-184266333 GAGGAAAAACTCTATGGGGCGGG + Intergenic
985271753 4:188200047-188200069 AATGAAAACCTACTTGTTGCTGG + Intergenic
986367923 5:7053516-7053538 AAGGGAAACCTCTTTGGGTGGGG + Intergenic
993076328 5:83236470-83236492 AAGAACAGTCTCTTTGGTGCTGG + Intronic
993098338 5:83506207-83506229 AAGGAAAACCCATTTTCTGCGGG - Intronic
996331656 5:122336462-122336484 ATAGAAAACCTCTATGGTCCAGG - Intronic
997517840 5:134503451-134503473 CAGGAAAACCTCTGTGGTCTGGG + Intergenic
998793716 5:145794223-145794245 AAGGAATACCACTTGGTTGCTGG + Intronic
998826938 5:146111637-146111659 AAGGCAGACCTCTGTGGTGCTGG + Intergenic
1000278076 5:159757029-159757051 AAGGAAAATGTCTTGGGTGCTGG - Intergenic
1002332972 5:178457603-178457625 AAGGAAAACCTTTTTAATGGGGG - Intronic
1003075311 6:2978896-2978918 AAGGAAAACAAATTTGGTGTAGG - Intergenic
1003504075 6:6725485-6725507 AAGGAAGAACTCCTTCGTGCTGG + Intergenic
1004722369 6:18278157-18278179 AAGCAAAAGCTCTTAGGCGCTGG + Intergenic
1004953959 6:20706255-20706277 GAGGCAAACCTGTTTGGGGCTGG + Intronic
1006032068 6:31183636-31183658 AATGAAAAGCTCTTTGCTGTTGG + Intergenic
1006281417 6:33056919-33056941 AAGGAAAACCTGCTTGGTGCTGG - Intergenic
1006372439 6:33653697-33653719 CAGGATAATCTCTGTGGTGCAGG + Intronic
1007655523 6:43449080-43449102 AAGGAAAGCATCTTCGTTGCAGG - Intronic
1010345910 6:74810840-74810862 CAGGAAAACCTCTTTGGTTTTGG + Intergenic
1010454591 6:76040029-76040051 GAGGAAAACCGCTTTGTAGCTGG + Intronic
1011328630 6:86178784-86178806 AGGGAACACCTCTGTGCTGCTGG - Intergenic
1011350832 6:86421881-86421903 AAGAAAAACTTCTTTGGGGGAGG + Intergenic
1011636095 6:89374815-89374837 AAGAAAAACCTTTTAAGTGCTGG + Intronic
1012969283 6:105709892-105709914 AGGTAAAACCTCTATGGTGATGG - Intergenic
1013445233 6:110219432-110219454 AAGCAAAATCTCTTTGTGGCTGG + Exonic
1014317145 6:119882194-119882216 TAGGAAAACGTCTTTGCTGGAGG - Intergenic
1014367369 6:120561624-120561646 AAGGAAAATCTCTTAAGGGCAGG - Intergenic
1014829874 6:126090240-126090262 GAGTGAAGCCTCTTTGGTGCAGG + Intergenic
1015811213 6:137163783-137163805 AAGGAAAACCATTTTGGGGATGG + Intronic
1018281333 6:162188628-162188650 AAAGAAAACTTCTTTGAGGCAGG + Intronic
1018802349 6:167233823-167233845 AAGGAAAACTTGGTGGGTGCGGG - Intergenic
1021296710 7:18916948-18916970 CAGGAAAGCCTCTTAGGTTCCGG - Intronic
1023806947 7:43879054-43879076 CAGGAATACCACTATGGTGCTGG - Exonic
1026338505 7:69415147-69415169 AAGGAAGACATATTTGGAGCTGG - Intergenic
1028885011 7:95922335-95922357 AAGGCAAAACTCTTTGGAGAAGG + Intronic
1029141105 7:98410962-98410984 AAGAAAATCCTTTTTGGAGCTGG - Intergenic
1029555175 7:101263958-101263980 AAGAAAAAGATCTTTGGTCCAGG + Intergenic
1032147282 7:129395529-129395551 CAGGAAAACCTCTTGGGCCCAGG - Intronic
1032401892 7:131629572-131629594 ACGGAAAGCCTGTTTGGTGGAGG + Intergenic
1033024684 7:137760797-137760819 AAGGATTACCTCTTTGAAGCAGG - Intronic
1036111631 8:5909641-5909663 AAAGAAAACCCCTTTGGAGGAGG + Intergenic
1037143150 8:15540919-15540941 AAGGAAAACATATTTCCTGCAGG - Intronic
1037301661 8:17457769-17457791 AAGGAAAAGCTTTTGGGTGAAGG - Intergenic
1037635238 8:20695924-20695946 AACAAAACCCTCTTTAGTGCCGG + Intergenic
1038100165 8:24364416-24364438 TAGAAAATCCTCTTTGGGGCAGG - Intergenic
1039006653 8:33045661-33045683 AAGGAATACCTCATTAATGCTGG - Intergenic
1043628034 8:82288950-82288972 AAGGAACACTTCTATGCTGCTGG - Intergenic
1045784542 8:105904955-105904977 AAAGAAAACCACTTGGGTGAAGG + Intergenic
1051163054 9:14230456-14230478 AAGGAAGACTTCTTTGTTGAAGG + Intronic
1051744343 9:20280549-20280571 GAGGAAAACATCTCTGGTACTGG + Intergenic
1051862724 9:21644813-21644835 AAAAAAAACCTCTTTGGGGTGGG - Intergenic
1052552233 9:29966954-29966976 AAGGAGAAGCTCTGTGGAGCTGG + Intergenic
1053273748 9:36767781-36767803 AAGGAAAACCACTCTGGGACAGG - Intergenic
1053424499 9:38002333-38002355 GAGGAAAACTTCTTTGTTTCAGG - Intronic
1057861576 9:98644927-98644949 AAGGATATCCTCTTTGTAGCAGG - Intronic
1059532010 9:115043834-115043856 ACTGAAAACCTCATTGGTGTAGG + Intronic
1059827863 9:118052366-118052388 AAAAAAAACTACTTTGGTGCTGG + Intergenic
1060229361 9:121815204-121815226 AGGAATCACCTCTTTGGTGCAGG + Intergenic
1061243584 9:129389094-129389116 TAGGAAAAGATCTTTGGGGCTGG - Intergenic
1062691335 9:137843231-137843253 AAAAAAAATCTTTTTGGTGCAGG + Intronic
1187083515 X:16016958-16016980 AAGGAAAATCTATATGGTGAAGG + Intergenic
1187826542 X:23336734-23336756 AAAGAAAACCACTTTGATGCTGG - Intronic
1189310784 X:40015836-40015858 AAGGAAAATCTATTTAGTGGAGG + Intergenic
1189722248 X:43932448-43932470 AAGGAATATATCTTTGGTGGGGG - Intergenic
1193380430 X:80810243-80810265 AAACAAAACCGCTTTGGTACCGG - Intergenic
1195394564 X:104397257-104397279 GAGGCAAATCTCTTTGGGGCAGG + Intergenic
1197504436 X:127283977-127283999 AAGGAACACTTCTATGGTGCTGG + Intergenic
1198616946 X:138468726-138468748 AGGGAACACTTCTATGGTGCTGG + Intergenic
1198691726 X:139292167-139292189 GAGCAAAACCTCTTTGTGGCAGG - Intergenic
1198702850 X:139416128-139416150 AAGGAAAAACACTTTGGTTTTGG + Intergenic
1199109724 X:143916427-143916449 TAGGAAAAAATCTTTAGTGCCGG - Intergenic
1201486802 Y:14503541-14503563 ACTGAAAGCCTCTTTGGTGCAGG - Intergenic