ID: 962069213 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:132015743-132015765 |
Sequence | GTTCCATTTGATCCCTTCAA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 113 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 6, 4: 106} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
962069213_962069214 | 5 | Left | 962069213 | 3:132015743-132015765 | CCATTGAAGGGATCAAATGGAAC | 0: 1 1: 0 2: 0 3: 6 4: 106 |
||
Right | 962069214 | 3:132015771-132015793 | CAGAGAAATGCCAGCCTCAGAGG | 0: 1 1: 0 2: 1 3: 24 4: 377 |
||||
962069213_962069215 | 6 | Left | 962069213 | 3:132015743-132015765 | CCATTGAAGGGATCAAATGGAAC | 0: 1 1: 0 2: 0 3: 6 4: 106 |
||
Right | 962069215 | 3:132015772-132015794 | AGAGAAATGCCAGCCTCAGAGGG | 0: 1 1: 0 2: 1 3: 34 4: 340 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
962069213 | Original CRISPR | GTTCCATTTGATCCCTTCAA TGG (reversed) | Intronic | ||