ID: 962069213

View in Genome Browser
Species Human (GRCh38)
Location 3:132015743-132015765
Sequence GTTCCATTTGATCCCTTCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 106}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962069213_962069214 5 Left 962069213 3:132015743-132015765 CCATTGAAGGGATCAAATGGAAC 0: 1
1: 0
2: 0
3: 6
4: 106
Right 962069214 3:132015771-132015793 CAGAGAAATGCCAGCCTCAGAGG 0: 1
1: 0
2: 1
3: 24
4: 377
962069213_962069215 6 Left 962069213 3:132015743-132015765 CCATTGAAGGGATCAAATGGAAC 0: 1
1: 0
2: 0
3: 6
4: 106
Right 962069215 3:132015772-132015794 AGAGAAATGCCAGCCTCAGAGGG 0: 1
1: 0
2: 1
3: 34
4: 340

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962069213 Original CRISPR GTTCCATTTGATCCCTTCAA TGG (reversed) Intronic