ID: 962069213

View in Genome Browser
Species Human (GRCh38)
Location 3:132015743-132015765
Sequence GTTCCATTTGATCCCTTCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 106}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962069213_962069215 6 Left 962069213 3:132015743-132015765 CCATTGAAGGGATCAAATGGAAC 0: 1
1: 0
2: 0
3: 6
4: 106
Right 962069215 3:132015772-132015794 AGAGAAATGCCAGCCTCAGAGGG 0: 1
1: 0
2: 1
3: 34
4: 340
962069213_962069214 5 Left 962069213 3:132015743-132015765 CCATTGAAGGGATCAAATGGAAC 0: 1
1: 0
2: 0
3: 6
4: 106
Right 962069214 3:132015771-132015793 CAGAGAAATGCCAGCCTCAGAGG 0: 1
1: 0
2: 1
3: 24
4: 377

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962069213 Original CRISPR GTTCCATTTGATCCCTTCAA TGG (reversed) Intronic
903275217 1:22217299-22217321 GTATCACTTGATCCCCTCAAGGG + Intergenic
904815018 1:33189385-33189407 GTTCCATGTCCACCCTTCAATGG + Intergenic
908324008 1:63005671-63005693 TTTCCATATGATACCCTCAAAGG - Intergenic
909764269 1:79335601-79335623 TTCTCATTTGATACCTTCAATGG + Intergenic
911364388 1:96919412-96919434 GTTCCACTTGATACCTTCCTGGG + Intergenic
911763564 1:101644824-101644846 GTTGCATTTGGTACCTTCAGGGG - Intergenic
919328052 1:196134506-196134528 CTTTTATTTGAGCCCTTCAATGG + Intergenic
921526686 1:216226998-216227020 GTCTTATTTGATCCCTTGAAGGG - Intronic
922348167 1:224714446-224714468 GTTTCCTTTGCTCTCTTCAAGGG + Intronic
924123996 1:240830829-240830851 TTTCCACTTTATGCCTTCAATGG - Intronic
1064298988 10:14104907-14104929 GTGCCCTTAGATACCTTCAAGGG + Intronic
1066052740 10:31650154-31650176 ATTCCATTTGCTCCCTTGACAGG + Intergenic
1068266694 10:54658870-54658892 CTACCATTTGCTGCCTTCAAGGG + Intronic
1068358853 10:55949000-55949022 TTTCCATATTATCCCTACAAGGG - Intergenic
1075615752 10:123890081-123890103 GTTTCATTTCATCCTTTCAGTGG - Intronic
1076410149 10:130243480-130243502 GTTTGATATGATCCCATCAATGG + Intergenic
1079336789 11:19577280-19577302 GTTCTATTTGCTTCCTTCATGGG + Intronic
1079456491 11:20640827-20640849 GTTTCATTTTAACCCTTCACAGG - Intronic
1084143992 11:67254086-67254108 GTTCTACTTAACCCCTTCAAGGG + Intronic
1087814482 11:102643395-102643417 GACCCTTTTGATCCCTTGAATGG + Intergenic
1088746193 11:112806961-112806983 GTTCCCTCTTCTCCCTTCAAGGG + Intergenic
1090933773 11:131323900-131323922 CTTCCACTTGATCAGTTCAAAGG + Intergenic
1091422937 12:359440-359462 GATTCATTTGATTCATTCAAAGG + Intronic
1092412839 12:8267568-8267590 GTTCCATTGTACCCCTTGAAGGG + Intergenic
1097542879 12:60962357-60962379 GTTTAATTAGATCCCATCAATGG + Intergenic
1097751584 12:63360274-63360296 TATGCATTTTATCCCTTCAAGGG - Intergenic
1100756294 12:97754472-97754494 GCTACATTTGCTCCCTCCAAAGG - Intergenic
1104429251 12:128703446-128703468 GCTCCATCTGGTCCCTGCAAAGG + Intronic
1109774400 13:67021257-67021279 ATTCCACTTAATCTCTTCAACGG - Intronic
1110709333 13:78632862-78632884 CTTCCATTGGTTCCCTTCAGGGG - Intronic
1113145290 13:107201097-107201119 TTTCCATGTGATCCCTTCCAAGG + Intronic
1113718338 13:112531137-112531159 CTTCTATTTGATCCTTTTAAGGG + Intronic
1122567045 14:102666767-102666789 GTGCCATTTCATCCCATCCAAGG + Intronic
1127278709 15:57470374-57470396 GTTCCTTTTGAACCCATCACAGG + Intronic
1128945726 15:71819191-71819213 GTTGCATTTTCTGCCTTCAAAGG + Intergenic
1129545613 15:76391912-76391934 GTCCTATTTGATTCCATCAAAGG - Intronic
1130350139 15:83084280-83084302 GGACCATTTGTTCCCTTCAGTGG + Intergenic
1130673763 15:85934814-85934836 TTTCCATTTCATCCTTTCTAAGG + Intergenic
1133926781 16:10199580-10199602 GCTCCATTTTATCTCCTCAAAGG - Intergenic
1136943178 16:34610484-34610506 ATTCCATTCGATCCATTCAATGG + Intergenic
1136952241 16:34735748-34735770 ATTCCATTTGATTCCTTTCAAGG + Intergenic
1137090641 16:36186032-36186054 GTTCCATTTGATGATTCCAACGG + Intergenic
1137440834 16:48497434-48497456 GTTCCACTTGTTGCCATCAAAGG - Intergenic
1138582186 16:57948906-57948928 GTTGCCTTTGATGCCTTCTAGGG - Intronic
1140343570 16:74189860-74189882 ATTCCATTTGATTCCTTTAGAGG + Intergenic
1140884557 16:79231586-79231608 GTTCCATCCCATCCCTTAAAAGG + Intergenic
1148096374 17:45055094-45055116 TTTCCATGTGATGCCATCAAGGG + Intronic
1156341823 18:36216278-36216300 GTTTCATTTGATCCTTAAAATGG + Intronic
1156440017 18:37175793-37175815 GTTCCCTTTGGTACTTTCAAAGG - Intronic
1157964342 18:52191142-52191164 TTGCTATTTGATTCCTTCAATGG + Intergenic
1160327412 18:77963656-77963678 GTTCCATTTTATCCCTAAAGTGG - Intergenic
1165069190 19:33245970-33245992 GTTCCTTCAGGTCCCTTCAAGGG - Intergenic
927429343 2:23013795-23013817 TTTCCATTTTATTCCTTGAATGG - Intergenic
934253355 2:90383687-90383709 ATTCCATTTGATCGTTCCAATGG - Intergenic
935430067 2:102966346-102966368 GTGCCATTTCCTCCCTTCGAGGG - Intergenic
936082705 2:109445781-109445803 GTTCCATTTCATCCCTGAAGTGG + Intronic
939810750 2:146829104-146829126 GTTACATTAGATCCATTCAGTGG - Intergenic
942729756 2:179051435-179051457 GCTCCAATTGTTCCCTTCATGGG - Intergenic
943428471 2:187766635-187766657 TTTGCATTTGAAACCTTCAAAGG + Intergenic
943463270 2:188196309-188196331 GTATCATTTGATCCTTTAAAGGG - Intergenic
945651450 2:212565741-212565763 TTTCCATATGACCCCTACAAAGG - Intergenic
946180687 2:217947203-217947225 GTTGCGGTTGGTCCCTTCAAGGG + Intronic
948184438 2:236009016-236009038 GTTTTGTTTAATCCCTTCAAAGG + Intronic
948409354 2:237747209-237747231 ATTCCATTTGATCCCTTAACTGG + Intronic
1177753727 21:25319146-25319168 GTTCCCTGAGATCCCTTCAGAGG + Intergenic
1178270596 21:31186165-31186187 GTTTCATTTTAGCCCTTAAATGG - Intronic
954038035 3:47863670-47863692 GTTCCATTTCACCCTTGCAAGGG - Intronic
959584543 3:108013952-108013974 CTTCCATTTAAATCCTTCAATGG - Intergenic
961995604 3:131238646-131238668 GTTCCCTTTTGTCCCATCAAGGG - Intronic
962069213 3:132015743-132015765 GTTCCATTTGATCCCTTCAATGG - Intronic
963871732 3:150423076-150423098 GTTCCATTTGAACACGTTAAAGG + Exonic
966217989 3:177522041-177522063 GCTCCATAGGATCCCTTCCAGGG + Intergenic
970528567 4:16958164-16958186 GTTCCATTTAAACCTTACAAGGG + Intergenic
970598001 4:17617466-17617488 GTTCCATTTCCTCCATTCATAGG + Intronic
970912669 4:21295398-21295420 TTTCTATTTGAACCCTTCAATGG + Intronic
974073501 4:57147206-57147228 GTTACATTAGATCATTTCAAGGG + Intergenic
977288812 4:95141134-95141156 GTTACATTTGATCATTTCAGAGG + Intronic
991520767 5:67494628-67494650 GCTCCTATTGATCCCCTCAAAGG - Intergenic
992114172 5:73523459-73523481 GTTCCATTTGATGTCTTTATGGG + Intergenic
994294552 5:98075374-98075396 GTTCCATCTAATCCTTTCAAAGG + Intergenic
1000257471 5:159553718-159553740 ATTTCATATGATCCCATCAATGG - Intergenic
1001544845 5:172564692-172564714 CTTTCATTTGCTCCCCTCAATGG + Intergenic
1010528310 6:76931716-76931738 GTTTGATTTGATACCTTTAATGG + Intergenic
1012012633 6:93808402-93808424 ATTCCATTCCATTCCTTCAAGGG + Intergenic
1014151778 6:118065153-118065175 GTTCCATGTGATCACATTAATGG - Intronic
1014849639 6:126326115-126326137 TTTCCAGTTGGGCCCTTCAAGGG + Intergenic
1016083791 6:139887437-139887459 CTGCCCTTTGATCCCTTTAAGGG + Intergenic
1018579831 6:165299024-165299046 GTTCCAGGTGTTCCCTTCCAGGG - Intronic
1022612553 7:31891416-31891438 ATTCCATTTGACTCTTTCAAAGG - Intronic
1022763484 7:33382489-33382511 ATTACATTTGCTCCCTTTAAAGG - Intronic
1027893719 7:84013243-84013265 GTTCCATTTGTTTCCCTCTACGG - Intronic
1028128979 7:87147769-87147791 GCACCATTTGATTCATTCAAAGG + Intergenic
1033531820 7:142271807-142271829 GTTCCTTTTGTTTTCTTCAACGG + Intergenic
1033622781 7:143077329-143077351 GATCAATTTGTTCCCTTCAAAGG - Intergenic
1036996924 8:13668531-13668553 CTTCCATTTGCTCACTTCATAGG + Intergenic
1038810593 8:30837855-30837877 GTTTCATCTGATCACTTCAGTGG - Exonic
1039362658 8:36896660-36896682 CTTCTATTTGATCACCTCAAAGG - Intronic
1043225559 8:77724943-77724965 CTTCCATTTGTCCCCATCAACGG - Intergenic
1044241357 8:89892550-89892572 GGTCCAGATGATCCCTTCATGGG - Intergenic
1045942392 8:107754762-107754784 GTTCTGTTTGCTACCTTCAAAGG - Intergenic
1048491554 8:134898323-134898345 GTTCCATTTGCTACCAGCAATGG + Intergenic
1051800695 9:20930199-20930221 ATTCCATTAGCTCCATTCAAGGG - Intronic
1052250593 9:26393216-26393238 GTTCCATTTGATTCTTAAAAGGG + Intergenic
1055596591 9:77871592-77871614 ATCCCTTTTAATCCCTTCAAAGG + Intronic
1059358168 9:113717588-113717610 GTTTCACTTAATCCCTCCAAGGG + Intergenic
1061531908 9:131221113-131221135 GTTACGTCTGATTCCTTCAATGG - Intronic
1186353712 X:8768005-8768027 AGGCCATTTTATCCCTTCAATGG - Intergenic
1186356067 X:8791755-8791777 CAACCATTTTATCCCTTCAATGG - Intronic
1186377814 X:9025965-9025987 CAACCATTTTATCCCTTCAATGG - Intronic
1190413639 X:50161267-50161289 GCTCCATATGACCTCTTCAATGG - Intergenic
1192111923 X:68373610-68373632 GTCCCTTTTCATCCCTTCCAAGG - Intronic
1194922111 X:99779368-99779390 GTTCCATTGGTTTCCTTGAAGGG + Intergenic
1200020949 X:153207311-153207333 AGACCATTTTATCCCTTCAATGG + Intergenic