ID: 962070598

View in Genome Browser
Species Human (GRCh38)
Location 3:132029610-132029632
Sequence CTCTTTCTTATCCAAGTGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 192}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962070598 Original CRISPR CTCTTTCTTATCCAAGTGTA GGG (reversed) Intronic
909234039 1:73129350-73129372 CTTTTTCTTTTCCAAGTCTCTGG - Intergenic
911844283 1:102730228-102730250 CTCTTTCTTACGCAAGTTTATGG - Intergenic
911929877 1:103888619-103888641 ATTTTTCTTATCCAAGAGCATGG - Intergenic
914417145 1:147494612-147494634 CTCTGTCTTATGCATGTGCATGG - Intergenic
918281968 1:183015751-183015773 CTCTTTCTTATTGATTTGTAGGG - Intergenic
919052958 1:192533888-192533910 CACTTTCTTATCTAAGTCCATGG - Intergenic
921393416 1:214641187-214641209 TTCTTTCTTCTCCAAGCTTAGGG - Exonic
924256608 1:242189570-242189592 CTCTTTCTTGTTCAATAGTATGG - Intronic
924311420 1:242747532-242747554 GTCTTTCTTATCTAAGAGAATGG + Intergenic
924411165 1:243807273-243807295 CCCTTTCCTAGCCAAGTGAAGGG + Intronic
1068513787 10:58000660-58000682 CTCTTTCTTATGCACGTGTGAGG - Intergenic
1068551831 10:58415677-58415699 CTCTTTCTTATACAATTGAGAGG - Intergenic
1070235011 10:74615137-74615159 CTCTTTCTCATACAAGGGTATGG - Intronic
1070627164 10:78059551-78059573 TTTTTTCTTATCCAAGTTCATGG + Intergenic
1071323792 10:84491641-84491663 CCCTTTCTTAGCCAAGGGAAGGG - Intronic
1071962547 10:90821315-90821337 CTCTTTCTCCCCCAAGTGCACGG - Intronic
1075894138 10:125979773-125979795 CTCTATCTGATCCAAGTATGTGG - Intronic
1078648578 11:13166063-13166085 CTCTTTCTTTTCCAATCATAGGG - Intergenic
1079585019 11:22114925-22114947 CTATTTCTTATCTCAGTGTGAGG + Intergenic
1080220462 11:29896897-29896919 CTCTTTTTTATCCTATTGTCAGG - Intergenic
1081735080 11:45397131-45397153 CTATTTCTTCTCCATCTGTATGG - Intergenic
1081970599 11:47195862-47195884 CTCTTTCTAATCCATGAGTCAGG - Intergenic
1083766779 11:64845042-64845064 CTCTCTCTTAGCCAAGGGCAAGG - Intergenic
1086077284 11:82867949-82867971 CTGTTTTTTATCCAAGAGTTTGG - Intronic
1086779732 11:90888008-90888030 CTCCCTCTGATCCAAGTTTATGG - Intergenic
1088491085 11:110388664-110388686 CTCTTTCATAGCCAAGGGAAGGG - Intergenic
1089102679 11:115976727-115976749 CTTTATCTTCTCCAGGTGTATGG + Intergenic
1090796710 11:130141700-130141722 AGCTTTCTTATCCAAAAGTACGG - Intronic
1093259879 12:16922820-16922842 GTTTTTCTTATCCAACTCTAGGG - Intergenic
1095498115 12:42806912-42806934 CTCTTTCTTGACCAAGTATTTGG + Intergenic
1096144820 12:49271267-49271289 CTCTTGCTTCTCCAAGTGATGGG - Intronic
1096915919 12:55033325-55033347 CTCTTTTTTTTCCAAGAGTGTGG - Intergenic
1098734561 12:74082479-74082501 CTCTTTGTTGTCAATGTGTAAGG - Intergenic
1100081980 12:90863586-90863608 TTTTTTCTTATTCAAGTGAATGG + Intergenic
1100178290 12:92055952-92055974 CTGTCTCTTCACCAAGTGTAGGG + Intronic
1102227066 12:111236210-111236232 CCCTTTCTTAGCCCAGTGTTTGG - Intronic
1103263090 12:119605732-119605754 CTGTTTCCTATCAAAGGGTAAGG - Intronic
1104245273 12:127034191-127034213 CTTTTTATTATCCAAGTTAATGG - Intergenic
1109612653 13:64786926-64786948 CTCTTTGTCAGCCACGTGTACGG - Intergenic
1110113097 13:71775853-71775875 CTCTTTGCCAGCCAAGTGTAGGG + Intronic
1111095863 13:83515050-83515072 CTGTTTCTTATACCAGGGTAAGG - Intergenic
1111565341 13:90006951-90006973 TTATTTCTGATCCAAATGTAGGG + Intergenic
1114718661 14:24856219-24856241 CTCATCTTTATCCAAGTGTATGG + Intronic
1115021160 14:28683299-28683321 CTCTTTTTCTTCCAAGTGTCAGG + Intergenic
1115178369 14:30592069-30592091 CTCTGTCTTATCCACATGTTAGG + Intronic
1115410414 14:33067741-33067763 CTCTTTCATCTCCCAGTTTAGGG + Intronic
1115457962 14:33626814-33626836 ATCTTTCTTATCCCTTTGTATGG - Intronic
1115765797 14:36622515-36622537 TTCTTTCTTTTCAAACTGTATGG + Intergenic
1117477264 14:56108795-56108817 CTCATTATTAAACAAGTGTAGGG + Intergenic
1117716593 14:58587928-58587950 CTCTTTGTTATTCAAGTAGAAGG + Intergenic
1117837843 14:59826028-59826050 CTCTTTTTGATCCAGGTGTTGGG - Intronic
1119741011 14:77013849-77013871 CTACTTCTTATCCATGTGTAGGG + Intergenic
1120678729 14:87453497-87453519 TTCTTTCTTATCTGAGTCTATGG - Intergenic
1122002489 14:98671628-98671650 CTCTTTCTTATTACATTGTAAGG + Intergenic
1124152708 15:27196241-27196263 CTCTTCCTTATACCAGTGTTAGG + Intronic
1124415224 15:29468028-29468050 CTCTTTCTCCTGCAAGTGGATGG + Intronic
1124830680 15:33146293-33146315 CTCCTTCTTCCTCAAGTGTAGGG + Intronic
1125994211 15:44141924-44141946 TTTTGTCTTCTCCAAGTGTAAGG + Intronic
1126540457 15:49816796-49816818 TTCTCCCTTATCCATGTGTATGG + Intergenic
1126779482 15:52126717-52126739 CTATTTCTTAACCTAGTCTAAGG - Intronic
1129139626 15:73585594-73585616 CTCTTTTCTATCCAGGTGTTGGG + Intronic
1131029903 15:89177776-89177798 GTCTTTCTTATCCCAGTGACTGG - Intronic
1131475608 15:92736193-92736215 CTCTTTTTTCTCCAAGTAGAGGG - Intronic
1140254052 16:73319604-73319626 CTCTTTTTGATCAAACTGTAAGG + Intergenic
1140549524 16:75849769-75849791 CTGTTTCATTTCCTAGTGTATGG + Intergenic
1142270456 16:89086426-89086448 CTCTTGCTTATCCATGTCTCCGG + Intergenic
1143225420 17:5298234-5298256 CTTTTTATAACCCAAGTGTAGGG + Intronic
1144873699 17:18385427-18385449 CTCTTTCTTCTCTTAGTGAAGGG - Intronic
1149063168 17:52448262-52448284 CTCATTGTTATGCAAGTGCAGGG - Intergenic
1149118104 17:53123993-53124015 CTTTTTTTTTTCCAAGTGTTGGG - Intergenic
1149225553 17:54465837-54465859 CCCTTTCTTAGGCAAGTGTCAGG - Intergenic
1149329002 17:55562158-55562180 CTCTTTGTTATGCAAGTCTCTGG + Intergenic
1150156764 17:62860478-62860500 CTCCTTCCCATCCAAGTTTAGGG + Intergenic
1150232585 17:63565155-63565177 CTCTTTCTTATTGATTTGTAAGG - Intronic
1150941586 17:69699250-69699272 CTCTTTTTAATCCCAGTCTAGGG - Intergenic
1152980394 18:270908-270930 CTCGCCCTTATCCAATTGTAAGG - Intergenic
1154108457 18:11545806-11545828 CTGTTTCTGGTCCAAGTGTCTGG - Intergenic
1154954280 18:21240446-21240468 CACTGTCTTTTCCACGTGTATGG + Intergenic
1157008765 18:43620643-43620665 CTTTTACTTATCCAAGTCTGTGG - Intergenic
1157955852 18:52096617-52096639 CTTTTTCTTCTCCAAGGGGAGGG + Intergenic
1158525431 18:58209082-58209104 ATCTTTCTTATCCCATTGTTAGG - Intronic
1164573523 19:29391427-29391449 CACATTCTTCTCCAAGTGCAAGG + Intergenic
1164704901 19:30312994-30313016 CTCCTTCCTATCAAAGTGAAAGG + Intronic
926770419 2:16368084-16368106 CTGTTTCTAATCAAAGTGTTGGG - Intergenic
928308749 2:30192825-30192847 CTCTTTGTAATCCTAGTCTAAGG - Intergenic
928334180 2:30381844-30381866 CCTGTTCTTATCCAAATGTAAGG + Intergenic
929602746 2:43214692-43214714 TTCTTTCTTTTCCAAGTGCTAGG + Intergenic
929923315 2:46189063-46189085 CTATTTCTTATCCTAAGGTAAGG + Intergenic
929941409 2:46336718-46336740 CTCTTTCTACTCAAAGTGTGAGG + Intronic
933288589 2:80411345-80411367 CTCTTTCTACTCCCAGAGTAGGG + Intronic
935844415 2:107149263-107149285 CTGTGTGTAATCCAAGTGTAGGG - Intergenic
937702607 2:124881254-124881276 CTCTTTCGTATCCAAAGGTTAGG - Intronic
938469525 2:131545510-131545532 CTCATTCTTAACAAAGTTTAGGG + Intergenic
939455236 2:142425955-142425977 CCCTTTCTTATCCACATGCATGG + Intergenic
941219625 2:162760037-162760059 CACTATGTTAACCAAGTGTACGG + Intronic
941430498 2:165408562-165408584 ATATTTCTTATCCAAAAGTATGG + Intergenic
942792762 2:179779665-179779687 ATGTTTCTTCTCCAAGTGTTTGG - Intronic
944676727 2:202039242-202039264 CTCTTTCATATCAAAGTTTCTGG - Intergenic
944819433 2:203415111-203415133 CTCTTTCTCACCCAAGTATATGG + Intronic
945221330 2:207487392-207487414 CTCATTCTTTTACAAGTGTACGG + Intergenic
946699322 2:222395718-222395740 TTGTTTCTTATTCAAGTGCATGG - Intergenic
946844394 2:223846340-223846362 GTATTACTTATCCAATTGTACGG - Intergenic
947029111 2:225772617-225772639 CTGTTTCATATTCAAGTGTGTGG + Intergenic
947193517 2:227537081-227537103 CTCTTTCTTAGTGAAGTGAATGG + Intronic
948564096 2:238872542-238872564 CTCTTTCTTTTCCAAGAATTGGG + Intronic
1169564762 20:6841752-6841774 TTCTTTCTGATCCAAGAGTCAGG + Intergenic
1169721820 20:8686203-8686225 TTCTTTCTCATCCAAGTTCAAGG + Intronic
1175092502 20:56516453-56516475 GTATTTGTTATTCAAGTGTAAGG - Intronic
1177951095 21:27538529-27538551 CTCCTCCTGATCCAAGTTTAGGG - Intergenic
1179379144 21:40882192-40882214 AGCTCTCTTCTCCAAGTGTATGG - Intergenic
1180580838 22:16834967-16834989 CTCTTTTTCTCCCAAGTGTATGG - Intergenic
1183442752 22:37832540-37832562 CTCTTTCTGATACGAGTGTCTGG + Intronic
949540493 3:5028100-5028122 CTCTTTCTCTTCCATGTGCACGG + Intergenic
949757396 3:7428229-7428251 TATTTTGTTATCCAAGTGTAGGG + Intronic
953670457 3:44958000-44958022 CTCTTTCATATCCTTGTGTTTGG + Intronic
955929234 3:64039134-64039156 CTCTTCTTCATCCAACTGTATGG + Intergenic
956091971 3:65677707-65677729 CTCTTTCGTATCCACGTCAAAGG + Intronic
956256283 3:67286411-67286433 TTCTTTCTTAACCAATTATATGG - Intergenic
957791528 3:84947703-84947725 CTCTATTTCATCCAAGTCTAAGG + Intergenic
958104891 3:89059082-89059104 TTCTTGCTTATCAATGTGTAGGG - Intergenic
959507441 3:107171596-107171618 CTGTAGCTTTTCCAAGTGTATGG - Intergenic
960778187 3:121286180-121286202 CCCTTTCTTTTCAAAGGGTAGGG + Intronic
960850503 3:122047947-122047969 CTTTTTCTTACCCAATTGTTTGG + Intergenic
961201178 3:125047058-125047080 CTCTTTCCTCTCCATGTTTAAGG + Intronic
961962138 3:130865797-130865819 CTCTTTTTTATCCCAGTCTTGGG + Intronic
962070598 3:132029610-132029632 CTCTTTCTTATCCAAGTGTAGGG - Intronic
962796664 3:138855560-138855582 CTCTTTCTTACCTCTGTGTATGG - Intergenic
963473097 3:145769073-145769095 CTGTACCTTATCCAAATGTAGGG + Intergenic
964589065 3:158340645-158340667 CTCTTTCTGTTCCCAGTGTCGGG + Intronic
965232599 3:166072520-166072542 CTATGGCTTTTCCAAGTGTAGGG - Intergenic
967036516 3:185652221-185652243 CTCTTTCTTGTCTAAGTGGACGG + Intronic
970020701 4:11564821-11564843 TTCTTTCTTATTGGAGTGTAAGG + Intergenic
970116231 4:12699293-12699315 CTTTTTCTTATTCAACTTTATGG + Intergenic
971271009 4:25145591-25145613 TTCTTTCTTATCAAATTTTAAGG - Intronic
972190984 4:36590287-36590309 CTTCTTCTTATCCATGAGTATGG + Intergenic
974171081 4:58268417-58268439 CTCTTTCCTATCCATTTGCAAGG - Intergenic
974842650 4:67316176-67316198 CTCTTTCTTAGCTGAGTGTTAGG + Intergenic
975360568 4:73465437-73465459 CTCTATGTTATCCAATTGTTTGG - Intergenic
976244548 4:82994190-82994212 TTCTTTATTATCCATGTGTCAGG - Intronic
977672994 4:99717058-99717080 CTCTTTCTCCTCCAAGTGCAGGG + Intergenic
977679023 4:99778522-99778544 CTTTTTCCTATCCAAGAGCATGG - Intergenic
978552265 4:109939955-109939977 CTCTCTCTTGACCAAGTGTGAGG - Intronic
979073586 4:116241859-116241881 CTCTTTCTTCCCCAAGGGCACGG + Intergenic
980460009 4:133097220-133097242 TTCTTTCTTATGAAAATGTAGGG + Intergenic
981627036 4:146769756-146769778 TTATTTCTTATGCAAGTTTAAGG + Intronic
982592015 4:157325656-157325678 GTCTTTCTTATCCCAGTTGATGG + Intronic
983810424 4:172053684-172053706 TTCTTTCTGATTGAAGTGTATGG - Intronic
985809368 5:2071669-2071691 CTCTTTCTTTTCCCAGTCTTGGG + Intergenic
986275530 5:6271954-6271976 CTCTTTCTTCTCCCAGTTTTGGG + Intergenic
988859419 5:35261849-35261871 CTCTTTCATAGCCAAGGGAAGGG - Intergenic
989521765 5:42410865-42410887 CACTTTCTGAACCAGGTGTAAGG - Intergenic
990866960 5:60390424-60390446 CTCTTACTTTTCAAAGGGTAAGG - Intronic
992699229 5:79323922-79323944 CTCCTTCTTTTCCAAGTGTGAGG - Exonic
993737274 5:91492608-91492630 CATTTTCTGATTCAAGTGTAGGG + Intergenic
997996119 5:138587824-138587846 CTCTTTCTTTTCCAAATGTTGGG + Intergenic
998014763 5:138723306-138723328 CTCTTTCTTATCCAAATGTTGGG - Intronic
998367881 5:141642815-141642837 CTCTGTCATCTCCAAGTGTGTGG - Intronic
1001424025 5:171611879-171611901 CCCTTTCTTCTCCAAGTCCAGGG - Intergenic
1005240852 6:23823840-23823862 CTCTTTCTTTTGCAAATGTCTGG + Intergenic
1007664855 6:43508193-43508215 CTCTTCCCTCTCCCAGTGTACGG + Intronic
1010183509 6:73116117-73116139 TTCTTTCTTATACAAGTTTTTGG - Intronic
1011414007 6:87097960-87097982 TTCTTTCATATCCAAATGTGTGG + Intergenic
1013993242 6:116278760-116278782 CTCTTTCTACTCCAATTATATGG - Exonic
1014583933 6:123174908-123174930 TTCTTTCTTAACCCAGTGTTAGG - Intergenic
1017030319 6:150215141-150215163 CTCTTTCTCATACAACTGTGGGG - Intronic
1020747075 7:12091651-12091673 CTCAGTCTTATCCAAATCTAAGG - Intergenic
1020815460 7:12900516-12900538 CTTTTTATTAGCCAATTGTAAGG + Intergenic
1021054107 7:16025843-16025865 CTCTTTATTATTCATGTGTGAGG + Intergenic
1022214291 7:28243136-28243158 GTCTTTCTTATACAATTGGAAGG + Intergenic
1028683647 7:93567993-93568015 CTCTTTATTATGATAGTGTATGG - Intronic
1028758663 7:94468459-94468481 CTCTTTCTTACCCTTGTCTAAGG - Intergenic
1028772693 7:94644653-94644675 CTCTTTCATATTCCACTGTAAGG + Intronic
1031716671 7:125116963-125116985 CTTTTTCATTTCCAAGTGGAGGG - Intergenic
1033714887 7:143990198-143990220 CTCTTTCTTATCTTAATATATGG + Intergenic
1034573095 7:151972991-151973013 CTGTGTCTTTTCCAAGTGCATGG - Intronic
1037137837 8:15484556-15484578 CTCTTTCTCATTCCGGTGTAGGG + Intronic
1037283976 8:17276119-17276141 CTCTTTCTTGTCTAAGTACATGG - Intronic
1039094522 8:33869190-33869212 CTGTTTCTTATCAATATGTATGG + Intergenic
1039666763 8:39542116-39542138 ATTCTTCTTATCCAAGAGTATGG + Intergenic
1044162324 8:88935279-88935301 CTCTTTCTTATCCCTGAGTGTGG + Intergenic
1044241341 8:89892444-89892466 CTCTTCCTCCTCCAAGTGCACGG - Intergenic
1044556820 8:93571535-93571557 CTGTTTCTTAAGCATGTGTAAGG - Intergenic
1047028973 8:120855184-120855206 GTCTCTCTTATCCAAATCTAGGG - Intergenic
1047387348 8:124422219-124422241 TTCTTTCTTATGCAAGAGTTAGG + Intergenic
1047862696 8:128986022-128986044 CGCTTTCCAATCCAAGTGCAAGG + Intergenic
1051237872 9:15020893-15020915 CTCTTTTTTATATAAGGGTATGG + Intergenic
1051876111 9:21795464-21795486 TCCTTCCTGATCCAAGTGTAGGG + Intergenic
1051969343 9:22868054-22868076 CATTTTCTTATCCAAGTACAGGG - Intergenic
1052593096 9:30524110-30524132 CTCTTCGGTATCCAACTGTATGG - Intergenic
1054737111 9:68765745-68765767 CTTTTTGTTATCTAAGTCTAAGG + Intronic
1056875562 9:90326363-90326385 TTTTTTTTTCTCCAAGTGTAAGG - Intergenic
1059737534 9:117117305-117117327 TTCTTTCTTGGACAAGTGTAGGG + Intronic
1059775158 9:117467184-117467206 CTTTTTCTTATCAATTTGTAAGG + Intergenic
1059799458 9:117735691-117735713 CTCTTTCCTTTCCAGGTGTGTGG - Intergenic
1059835730 9:118150036-118150058 CTCTTCTTTATCCAACTGTCAGG + Intergenic
1059917502 9:119119700-119119722 CTCTTTATTGTTCAAGTGAAAGG + Intergenic
1060061642 9:120466018-120466040 CTCTCTCTTTTCCAAATGTTGGG + Intronic
1203686869 Un_GL000214v1:3272-3294 CTCTTTCTAATCCATGAGCATGG + Intergenic
1203649406 Un_KI270751v1:100781-100803 CTCTTTCTAATCCATGAGCATGG - Intergenic
1194034056 X:88848833-88848855 TTATTTCTTATCGAAGTGTTGGG - Intergenic
1194867093 X:99082559-99082581 CTCTTTAATTTCAAAGTGTATGG - Intergenic
1197776990 X:130124875-130124897 CTCAATCTTATCCAAGAGGAAGG + Intergenic
1201558763 Y:15292572-15292594 CTCTTTCATTTCCAGCTGTAGGG + Intergenic
1202384397 Y:24311018-24311040 CTCCTTCATAGCTAAGTGTAAGG + Intergenic
1202486386 Y:25359104-25359126 CTCCTTCATAGCTAAGTGTAAGG - Intergenic