ID: 962070628

View in Genome Browser
Species Human (GRCh38)
Location 3:132030085-132030107
Sequence TCCTCCTAACACTCTAATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 103}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962070623_962070628 12 Left 962070623 3:132030050-132030072 CCAAGAGACAGCAATGTAATAAG 0: 1
1: 0
2: 0
3: 12
4: 193
Right 962070628 3:132030085-132030107 TCCTCCTAACACTCTAATGGAGG 0: 1
1: 0
2: 0
3: 11
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962070628 Original CRISPR TCCTCCTAACACTCTAATGG AGG Intronic
900308995 1:2024492-2024514 TTCTCCAAACCGTCTAATGGGGG + Intronic
904484894 1:30818108-30818130 TCATAATAACACTCTAAGGGAGG + Intergenic
908674779 1:66591554-66591576 CCCCCTTCACACTCTAATGGGGG - Intronic
916620627 1:166492471-166492493 TGCTCCTAACACTTTAATATTGG + Intergenic
916755529 1:167766419-167766441 TCCTCCTAACACCCTTGTGTGGG - Intronic
922086219 1:222349614-222349636 TACTCTTAACACTGTAATTGTGG + Intergenic
923652946 1:235890637-235890659 TCCTCCAGATGCTCTAATGGGGG - Intergenic
1066061007 10:31723595-31723617 TCCTCCTCACATTCTCATGCAGG + Intergenic
1068782621 10:60937929-60937951 TCCTCATAACCCTCTGAGGGGGG + Intronic
1072353248 10:94578789-94578811 TCCTTATAAAAATCTAATGGTGG - Intronic
1073734098 10:106326406-106326428 ACCTCCTAACACTCTACTCCTGG + Intergenic
1075185047 10:120248308-120248330 TCTTCCTAATAGTCCAATGGTGG - Intergenic
1081977688 11:47246064-47246086 TCCCCCAAACACTCCACTGGGGG + Intronic
1085593405 11:77786647-77786669 TTCTCCTAAAACTATAATGGTGG + Intronic
1086062531 11:82714625-82714647 TCCTCATCACACTCAAAGGGTGG - Intergenic
1091387262 12:103290-103312 TCCTCCCATTACTCTAATAGAGG - Intronic
1091576320 12:1739725-1739747 TGCTCATAACACTCTAAAGAAGG - Intronic
1093320729 12:17710396-17710418 TCCTCCTAACAACCTAAGGTAGG + Intergenic
1099845761 12:88026009-88026031 TCTTTCTAACACTTTAATTGTGG - Intronic
1103028109 12:117590472-117590494 TCCTCCTACCAATCTTATGAGGG - Intronic
1103799942 12:123531708-123531730 ACCTCATCACATTCTAATGGGGG + Intronic
1106188126 13:27426376-27426398 TGCTCCTAGTACTCTCATGGAGG + Intronic
1107095657 13:36532168-36532190 TCCTCACAAAACTCTATTGGTGG - Intergenic
1108870766 13:54982528-54982550 TCAACCCAACACTCTAATGAGGG + Intergenic
1115348033 14:32363997-32364019 TCCTTCTTACAGTCTACTGGGGG - Intronic
1118588046 14:67375056-67375078 TAATCCTAACACGCTAGTGGAGG - Intronic
1121145725 14:91580361-91580383 TTCTTCTAACACCCTAATGATGG + Intergenic
1135865982 16:26102361-26102383 TCCTCCAAGCACTCAAAAGGTGG + Intronic
1136341362 16:29645881-29645903 ACCTCCTCACATTCTATTGGTGG - Intergenic
1139685320 16:68598838-68598860 TCCTGCTACCACTCAACTGGAGG - Intergenic
1142200266 16:88757755-88757777 TCCTCCCAACAACCTAAGGGTGG + Intronic
1142409695 16:89909697-89909719 TCCTCCAAACACCTTACTGGAGG - Intronic
1143264082 17:5622699-5622721 TCCTTCTAACACTCACATGTGGG + Intergenic
1146992435 17:37287069-37287091 TCCTCTGAACACTCTTTTGGAGG - Intronic
1148248361 17:46051574-46051596 TCATCCTAACACTAGAATGTAGG - Intronic
1148286551 17:46398186-46398208 TCCTCATAACACACTAAGGTAGG - Intergenic
1148308717 17:46615776-46615798 TCCTCATAACACACTAAGGTAGG - Intronic
1157328978 18:46689322-46689344 TCCTCCTTACCCTCTATTAGTGG - Intronic
1158395222 18:57074334-57074356 TTCTCCTAATACTCTAATTGGGG - Intergenic
1159393291 18:67823275-67823297 TCCGTATAACACTGTAATGGTGG - Intergenic
1160625609 18:80202358-80202380 TCCTCCTAACAAGATGATGGAGG + Intronic
1163474597 19:17517586-17517608 TCCTACTAACAATCCCATGGTGG - Intronic
1165325976 19:35115001-35115023 CCCTCCTACCACTCTTAAGGCGG - Intergenic
1168634420 19:57984478-57984500 TCTTCCACCCACTCTAATGGAGG - Intronic
926913737 2:17874450-17874472 TCCTCATAACACTCTAGTATAGG - Intergenic
929880576 2:45833532-45833554 TCCTCCCAACACTCTGAAGCAGG + Intronic
931827246 2:66014653-66014675 TCCTCCTCACCCTTTAATGAAGG + Intergenic
933537774 2:83598116-83598138 TTCTACTAATACTCTAATGGAGG - Intergenic
938214461 2:129499175-129499197 TCCACCTCACACTGTACTGGAGG + Intergenic
939490871 2:142874733-142874755 TGATCATAACACTCTAATGCTGG - Intergenic
941184819 2:162308740-162308762 TCCTCCTAATACTCATATGTTGG - Intronic
948394766 2:237636874-237636896 TCCTCCTAACACTGACATGGTGG - Intronic
1171176503 20:23053958-23053980 TCATCCTAACACTTTGAAGGAGG - Intergenic
1172686027 20:36755175-36755197 TCCTCCTAGGACTCAAAGGGAGG - Intronic
1173347287 20:42212675-42212697 TCCTCCCAACAGTCTGACGGGGG - Intronic
1173734554 20:45349992-45350014 TCCTCCTAACAGTGCATTGGTGG + Intergenic
1175741169 20:61420672-61420694 TCCTCCTAACAGTCCAAAGTTGG + Intronic
1178167446 21:29996049-29996071 TTCTCCTCTCACTCAAATGGTGG + Intergenic
1178352479 21:31882206-31882228 TCCTCTTAGCACTCTTACGGTGG + Intronic
1184365084 22:44045955-44045977 TCCTCCCAAAATTCCAATGGTGG - Intronic
950949863 3:16986744-16986766 TGCTTTTAAAACTCTAATGGAGG + Intronic
952167562 3:30767481-30767503 TCCTCCTAACACTTTATTATGGG - Intronic
953036652 3:39217386-39217408 TCCTTCTCACTCTCTATTGGTGG + Intergenic
954825842 3:53372663-53372685 TCCTCCTAACACTGGAAGGCGGG + Intergenic
956461018 3:69472761-69472783 TCCTCTTAACACTGGACTGGTGG - Intronic
957498392 3:81020960-81020982 TCTGCCTAATACTTTAATGGTGG - Intergenic
957776023 3:84757643-84757665 TCCTACAAACATTCTAATAGTGG - Intergenic
958489577 3:94754534-94754556 TCCACCTGAAACTCTAATGGAGG + Intergenic
959564260 3:107818313-107818335 TCCTCCTGAGACTCTGAAGGTGG + Intergenic
960899363 3:122539359-122539381 TCCTGCTCAAAGTCTAATGGGGG - Intronic
962070628 3:132030085-132030107 TCCTCCTAACACTCTAATGGAGG + Intronic
962892374 3:139683569-139683591 TCCTACTAAGACTCTCATAGTGG + Intergenic
963203661 3:142610681-142610703 TCATCCTATCATTCTAATGGTGG - Intronic
964255934 3:154773876-154773898 TCCATATAATACTCTAATGGTGG - Intergenic
971627931 4:28947467-28947489 TCCTTCTAAGACTCTAATCAGGG + Intergenic
973956608 4:56069117-56069139 TCCTCCAAAGGCTCTAAGGGAGG - Intergenic
976064154 4:81164620-81164642 CACACCTAACACTCTAATGGTGG - Intronic
981298510 4:143160287-143160309 TCCTCCTAATATTCCATTGGAGG - Intergenic
984643062 4:182191450-182191472 TCTGCCTGACACTCTAAGGGAGG - Intronic
984893429 4:184514063-184514085 TCCTCCTAACACATTTAAGGGGG + Intergenic
986139718 5:5018145-5018167 TCCTCCTAGCACTCAGAAGGGGG + Intergenic
987649726 5:20725317-20725339 ACCTGTTAACACTCTGATGGTGG + Intergenic
988592418 5:32560575-32560597 TCCTCCTTAAGCTCTAATGTGGG + Intronic
989457014 5:41655849-41655871 TTCTCATAACACTCTTATGAGGG - Intergenic
990376103 5:55172892-55172914 TCTCCCTAACTCTCTAATGCGGG - Intronic
999594437 5:153186722-153186744 TGGTCCTTACATTCTAATGGGGG - Intergenic
1000459803 5:161500425-161500447 TCCTGGTAACAATCAAATGGAGG - Intronic
1007589504 6:43012982-43013004 TCATCTTCACTCTCTAATGGTGG + Exonic
1012703697 6:102495387-102495409 ACCTCCTGAGATTCTAATGGAGG - Intergenic
1014847483 6:126296473-126296495 TCCTTCTAACAACCTAATGGAGG - Intergenic
1016642407 6:146364297-146364319 TCCTCCTCACACTGTCGTGGAGG - Intronic
1021267462 7:18542369-18542391 TCCTCCTAACAGTCATATGAAGG - Intronic
1023735066 7:43228055-43228077 TCCTCCTAACACTTTAATTTTGG - Intronic
1024905050 7:54368221-54368243 TACAGCTAACAATCTAATGGAGG + Intergenic
1026425933 7:70293720-70293742 TCATCCAGACACTCTAATAGCGG - Intronic
1028891459 7:95992522-95992544 TCCTCATAACCCTCTAAGGTAGG - Intronic
1028936972 7:96475813-96475835 TTCTGCTAACTTTCTAATGGTGG - Intergenic
1028965163 7:96793959-96793981 TCCTCCTTTCACTCTAAGGTTGG - Intergenic
1032432074 7:131870503-131870525 GGCTCCTAAGACACTAATGGAGG + Intergenic
1035698302 8:1618071-1618093 TCTACTTAACATTCTAATGGAGG + Intronic
1038244667 8:25844429-25844451 TCCTCCTATAGCTCTGATGGTGG - Exonic
1044995562 8:97835013-97835035 TCCCTCTGAGACTCTAATGGGGG + Intronic
1046184112 8:110690574-110690596 CCCTGCTAACACTGTACTGGGGG - Intergenic
1049390858 8:142369963-142369985 TCCTCCTAACACCATCATGTTGG - Intronic
1051003021 9:12308084-12308106 TCCTAATAACACACAAATGGTGG - Intergenic
1051540953 9:18216971-18216993 AACTCCCAACAATCTAATGGAGG - Intergenic
1053620792 9:39813446-39813468 TACTCCTAATACTGTAATGATGG - Intergenic
1054263371 9:62893996-62894018 TACTCCTAATACTGTAATGATGG + Intergenic
1060261903 9:122083145-122083167 TCCTCTTTACACCCTCATGGTGG + Intronic
1187023044 X:15404763-15404785 TCCTACCAACACCCTAATGGGGG - Intronic
1189143563 X:38632657-38632679 TCTTCCTGACAGTATAATGGTGG - Intronic
1194420982 X:93672727-93672749 TCTTCCTCACCCTCTAAGGGAGG + Exonic
1198704102 X:139428613-139428635 CCATCCTAAAACTCAAATGGAGG - Intergenic
1199444608 X:147907805-147907827 TTCTGCTGACACTGTAATGGTGG + Intergenic
1199741016 X:150736322-150736344 TCCTCCGAACACTCTAGGGGAGG - Intronic