ID: 962072713

View in Genome Browser
Species Human (GRCh38)
Location 3:132048360-132048382
Sequence TGGATCATGCAGGACCTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 2, 2: 7, 3: 42, 4: 238}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962072713_962072716 1 Left 962072713 3:132048360-132048382 CCTGCAAGGTCCTGCATGATCCA 0: 1
1: 2
2: 7
3: 42
4: 238
Right 962072716 3:132048384-132048406 TCCTTTCTATTTTTCCTGCTTGG 0: 1
1: 0
2: 4
3: 111
4: 731

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962072713 Original CRISPR TGGATCATGCAGGACCTTGC AGG (reversed) Intronic
901257569 1:7843779-7843801 TGGAGCCTGCAGGACCCTGTGGG - Exonic
901386044 1:8909942-8909964 TGGATCCTATAGGACCTTGTGGG + Intergenic
902227916 1:15008319-15008341 TGGATCCTGCTGGACTCTGCAGG + Intronic
902684793 1:18069085-18069107 TGAATCATGCAGGGCCTTAGAGG - Intergenic
903416366 1:23186076-23186098 TGGAACATGCAGGAACATGCAGG + Intergenic
903690688 1:25171348-25171370 CGGACCATGCAGGATCTTGTAGG - Intergenic
904053485 1:27655362-27655384 TAGATCACGCAGGGCCTTGTAGG + Intergenic
904429062 1:30450286-30450308 TGGAGCATGCAGGAGCATGCAGG + Intergenic
905102232 1:35534453-35534475 TGAATCTTGCAGTACTTTGCTGG + Intronic
905208898 1:36359754-36359776 TGAATCATGCAAGGCCTTGGGGG - Intronic
905654396 1:39676783-39676805 CCGATCATGCAGGACCTGGAGGG + Intergenic
905926568 1:41754191-41754213 AGGGTCGTGCAGGACCTTGCAGG + Intronic
906096556 1:43228147-43228169 TGGATCACGCAGGACCTTGTGGG - Intronic
907924764 1:58944832-58944854 TAGATCATCCAGGACCTTATGGG + Intergenic
909480829 1:76127901-76127923 TGGGTCATGCAGGGCCTTAAAGG - Intronic
912210407 1:107550849-107550871 TTCATCATGCAGGGCCTTGTAGG + Intergenic
913286902 1:117234880-117234902 TAGATCATGTAGGGCCTTGTGGG + Intergenic
914963960 1:152236401-152236423 TGTATCACTCAGGGCCTTGCAGG + Intergenic
915072913 1:153287162-153287184 TGGATCATGTAGGACCTTTTAGG + Intergenic
915643338 1:157247384-157247406 TAGATGGTGCAGGGCCTTGCAGG - Intergenic
922128700 1:222755484-222755506 TGGATCATGCAGGAGGTTTCTGG - Intergenic
922359643 1:224809757-224809779 TGGAACAAGAAGTACCTTGCTGG + Intergenic
922429080 1:225529220-225529242 CAGATCATGCAGGACCTTGCAGG - Intronic
923881222 1:238105782-238105804 TGGATTAGGGAGGACCTTGAAGG + Intergenic
924279070 1:242417862-242417884 AGGCTCCTGCAGGACCTTGTAGG + Intronic
924517079 1:244775089-244775111 TGGATCATGCAGCTCCTGTCTGG + Intergenic
1062775055 10:137295-137317 TGGCCCATTCAGGACCCTGCTGG + Intronic
1064520867 10:16199257-16199279 TGGATCATTCAGGAGTTTTCTGG + Intergenic
1068934416 10:62622158-62622180 TGGATGATGCAGGACAGAGCAGG - Intronic
1069824091 10:71244743-71244765 TAGGACCTGCAGGACCTTGCTGG - Intronic
1069947994 10:72000643-72000665 TGGATCTTGAAGGCCCTTACAGG + Intronic
1070157251 10:73842989-73843011 GGCTTCATTCAGGACCTTGCTGG - Intronic
1070572640 10:77651548-77651570 GGGATCATGCAGCAACTTGAGGG - Intergenic
1071529012 10:86374970-86374992 TGGGTCCTGTAGGCCCTTGCAGG - Intergenic
1073118635 10:101107968-101107990 CTGGTCATGCAGGACTTTGCTGG - Intronic
1074872248 10:117586536-117586558 TGGACAATGCAGGACCTAGGGGG + Intergenic
1076297459 10:129397664-129397686 CGGATCCTGCAGGACTTTGTGGG - Intergenic
1076773243 10:132678748-132678770 TGGAATATGCAGCACCTTGAAGG + Intronic
1077720388 11:4622294-4622316 TGGATCAGACAGAACCTGGCAGG + Intergenic
1077900825 11:6486984-6487006 TGGATCATGCAGGGCCTTGTAGG - Intronic
1080504654 11:32900590-32900612 TAGATCATGCAGGGCTTTGTAGG - Intronic
1081470811 11:43368800-43368822 TAGATCTTACAGGACCTTGTAGG - Intronic
1081970120 11:47192584-47192606 TGGATTATTCAGGAGCTTTCTGG - Intergenic
1082912873 11:58396521-58396543 TGTATCAGGCAGGACCTCTCTGG + Intergenic
1083432500 11:62621639-62621661 AGGATCATGCGGGGCCTTGCAGG + Intronic
1083948746 11:65941914-65941936 TGAAACATGCAGGACCTAGTGGG + Intergenic
1087715607 11:101605310-101605332 TGGATCCCAGAGGACCTTGCTGG + Intronic
1088024123 11:105157014-105157036 TGTATCATAAAGGATCTTGCTGG - Intergenic
1088270469 11:108028924-108028946 TGGATCTTGTAGGACCCTGAAGG - Intronic
1089016676 11:115171064-115171086 TGGCTCATCCATGACCTTGTAGG - Exonic
1089206713 11:116770312-116770334 TGGACCATGCAGGATCCTGTAGG - Intronic
1089672456 11:120065914-120065936 TGGATAAAGGAGGACCCTGCAGG - Intergenic
1090279083 11:125440898-125440920 TGTTTCATCCAGGACCTTGGAGG - Intergenic
1091427790 12:406502-406524 CAGATCATACAGGACCTTGTCGG + Intronic
1092019534 12:5189354-5189376 TGGATTATGCAATACCTTGTGGG + Intergenic
1092737353 12:11595093-11595115 CCGATCATGCAGGACATTGTAGG - Intergenic
1094055506 12:26265432-26265454 TAGATCATGAAGGACCTTGCAGG + Intronic
1095667313 12:44817693-44817715 TGGATGAGGCAGGACCCTGCAGG + Intronic
1096176222 12:49521279-49521301 AAGATCATCCAGGACCTTACAGG + Intronic
1097556467 12:61145141-61145163 AGCATTATGCAGGACCTTACAGG + Intergenic
1097973400 12:65659406-65659428 TGGATCATGCAGGACCTCGCAGG - Intergenic
1098256565 12:68622419-68622441 TGGATTATGCAGTACCTTCTAGG - Intronic
1100016070 12:90012263-90012285 TAAATCATCCAGGACCTTGTTGG - Intergenic
1100080465 12:90842758-90842780 TGGATCTTGGAGGACCTCGTGGG + Intergenic
1101191575 12:102338960-102338982 TGGATCATTCACGGCCTTGCAGG - Intergenic
1102128981 12:110510131-110510153 TGAATCATGGAGGACCTTATAGG - Intronic
1103108297 12:118251016-118251038 GGGACCATGAAGGACCTTGTGGG + Intronic
1103717391 12:122953041-122953063 TCAATCATGCAGGTCCTTGTGGG - Intronic
1104928922 12:132328333-132328355 AGGATCATGCAGGGCTTGGCAGG - Intronic
1106310082 13:28546444-28546466 TAGATCATGCAGAACCTTGTAGG + Intergenic
1106327764 13:28710379-28710401 AGGATCATCCAGGCCCTTACTGG + Intronic
1106446374 13:29835923-29835945 TAGATCATGCAGGACCCTGAAGG + Intronic
1106754938 13:32813281-32813303 TGGAAGATGCAGCTCCTTGCAGG - Intergenic
1109383520 13:61597437-61597459 GGGATCATTCAGGACCCTGTAGG + Intergenic
1110654119 13:77976501-77976523 TGGATCATTTAGGGCCTTGTAGG - Intergenic
1110840622 13:80138218-80138240 TGGAACAAGCAGGACCATGTAGG - Intergenic
1116814079 14:49567396-49567418 TTGATGGTGCAGGACCTTGAAGG - Intergenic
1117322394 14:54636373-54636395 GGAATCATGCAGGGCCTTGTAGG + Intronic
1117339942 14:54784206-54784228 TGGATCATGCGGGGCCTTATGGG + Intronic
1118221238 14:63856195-63856217 CAGATCATGCAGGGCCTTTCTGG + Intronic
1118676945 14:68196413-68196435 GGGACCATGCAGGACTTTGTAGG - Intronic
1119142670 14:72281850-72281872 TAGATCCTGCAAGTCCTTGCAGG + Intronic
1119959062 14:78834134-78834156 AGGATCAGGCAGGGTCTTGCTGG + Intronic
1122354086 14:101112983-101113005 TGGAGCATGCAGGGGCCTGCTGG + Intergenic
1123171048 14:106373316-106373338 TGAGTCATGCAGGAACTTGTAGG + Intergenic
1123198358 14:106638775-106638797 TGGGTCATGCAGGAACTTGTAGG + Intergenic
1123977639 15:25568165-25568187 TGGAGGAAGCAGGAGCTTGCAGG + Intergenic
1124862115 15:33452022-33452044 TGGAGCATGGAGGCCCTTTCCGG - Intronic
1125107933 15:35995880-35995902 TGGGTCATGTAGGATCTTTCAGG - Intergenic
1125748680 15:42014241-42014263 TGGAGCTTCCAGGACCTTCCAGG - Intronic
1126427628 15:48546587-48546609 TGGATTATGCAGGACATCTCGGG + Intronic
1127521497 15:59747147-59747169 TGGATCCCGCAGGACCTTCTGGG - Intergenic
1127952415 15:63822224-63822246 TACATCATGTAGGACTTTGCAGG + Intronic
1128368595 15:67022866-67022888 TAGATCATGCAGGACTTCACAGG + Intergenic
1129656125 15:77526825-77526847 AGGCTCATGCAGGCCCTGGCAGG - Intergenic
1131426342 15:92348179-92348201 TGGGACATGCAGGAACTTCCGGG + Intergenic
1133248299 16:4463663-4463685 GGCATCGTGCACGACCTTGCGGG + Exonic
1134306582 16:13038382-13038404 TAGATTGTGCAGGACCTTGTGGG - Intronic
1134819910 16:17238627-17238649 CTGGTCATGCAGGACCTTGTAGG - Intronic
1135589891 16:23697354-23697376 GGGCTCAGGCAGGGCCTTGCTGG + Intronic
1135781381 16:25304445-25304467 TAGATCATTTAGGGCCTTGCTGG + Intergenic
1136056730 16:27695311-27695333 CAGGTCATGCAGGGCCTTGCAGG - Intronic
1138044357 16:53705312-53705334 CAGATCATGCAGGATCTTGTAGG - Intronic
1138476063 16:57271229-57271251 TGGGGGCTGCAGGACCTTGCTGG - Intronic
1139607908 16:68033012-68033034 CTGATCATGCAGGGCCTTGTGGG + Intronic
1139739250 16:69021172-69021194 TAGATCATGAAGGGCCTTGCAGG - Intronic
1140291535 16:73663482-73663504 TGGATCATACAGGAAGTTGTTGG - Intergenic
1141300461 16:82810780-82810802 TGGACCATGCAGAGCCTTGTAGG + Intronic
1142477492 17:198047-198069 TGGTTCCTACAGGCCCTTGCAGG - Intergenic
1142619166 17:1154159-1154181 AGGATCATGAAGGACCTGGGAGG - Intronic
1143660297 17:8320564-8320586 GGGATCACGCAGGACCTGACAGG + Intronic
1144357407 17:14459395-14459417 TGCATCATTCAGGAGTTTGCTGG - Intergenic
1144779553 17:17800969-17800991 TGGATCATGTGGGACCTGCCTGG + Intronic
1146447845 17:32946976-32946998 TGAATCATGCCAGACATTGCAGG + Intergenic
1146791803 17:35755074-35755096 TAGATCATGCAGGGCCTTGTAGG + Intronic
1148218633 17:45847600-45847622 TGGTGCATACAGGAACTTGCTGG - Intergenic
1148875086 17:50682452-50682474 TCCATCATGTAGGGCCTTGCAGG - Intronic
1149448408 17:56731592-56731614 TGGATCACGAAGGGCCTTGTTGG - Intergenic
1149777373 17:59368685-59368707 TGGATCATGCAAGGCCTAGAAGG + Intronic
1150323585 17:64237327-64237349 TGGGTCATGCAGTGCCTTGAAGG + Intronic
1150337655 17:64342296-64342318 TGGAGGCTGCAGGCCCTTGCTGG - Intronic
1152717074 17:81905358-81905380 TGGGTCATGCTGGCCCTTGCTGG - Intronic
1153200602 18:2643684-2643706 AAGATCATGCAGGGCCTTGGAGG - Intergenic
1156072363 18:33228173-33228195 TAGATTATGCAGAACCTTCCAGG + Intronic
1159710446 18:71751466-71751488 TCGACCACACAGGACCTTGCAGG + Intronic
1160561898 18:79764266-79764288 TGCATCAAGCAGTACCTTGGAGG - Intergenic
1161644489 19:5444680-5444702 TAGGTCATGCAGGGCCTTGTGGG - Intergenic
1162527851 19:11217045-11217067 TGAGTCAAGCCGGACCTTGCTGG - Exonic
1162536433 19:11265230-11265252 TTGATCATGCTGGGCCTTGTGGG - Intergenic
1162555648 19:11384039-11384061 TGGAGCCTGCAGGACCATGCTGG - Intronic
1162828761 19:13270910-13270932 TAGATCATGCAGGAACTGGGAGG - Intronic
1165083999 19:33329985-33330007 TGGATCATGCTGGGCCTTGTAGG - Intergenic
1165759676 19:38313645-38313667 TGGGTCATGCAGGGCCTAGCAGG - Intronic
1166049594 19:40250107-40250129 TGGATCATACAGGACTCTGCAGG + Intronic
1166385329 19:42377378-42377400 TGGATCACCCAGGGCCTTGTGGG + Exonic
1166962769 19:46508951-46508973 AGGAACATGCAGGAACTTTCTGG + Intronic
1167160770 19:47765947-47765969 TTGATCACGCAGGACCATGGTGG - Intergenic
1167297230 19:48658469-48658491 TAGATCATGCAGGGCTTTGTGGG + Intergenic
1168511200 19:56974811-56974833 TGGATCAAGAAGGTCCTTGTAGG + Intergenic
925303064 2:2830630-2830652 TGGCTCAGGCAGGACCAGGCAGG - Intergenic
931065191 2:58578264-58578286 CAGATCATGCTGGACCTTGTGGG + Intergenic
932235682 2:70119379-70119401 TGGGTCATGTAGGACCCTGTGGG + Intergenic
932682068 2:73834957-73834979 TGGATCATGCAGGACTTTATGGG + Intronic
932760893 2:74438589-74438611 CAGATCATGCAGGGCCTTGAAGG - Intronic
937468116 2:122152599-122152621 TGGGTCTTGTAGGACCTTGTAGG + Intergenic
939388262 2:141530918-141530940 TGGATCAGGTAGTACCTTACAGG + Intronic
939706520 2:145460276-145460298 TAAATTATGCAGGACCTTGTGGG + Intergenic
939757216 2:146129449-146129471 TGTCTCATGCAGGCTCTTGCAGG + Intergenic
940736042 2:157453633-157453655 TAGAACATGCAGGACCTTGAAGG - Intronic
942428134 2:175880757-175880779 TAGATCATGCAGGACCTTCACGG + Intergenic
942524469 2:176838666-176838688 TGGGTCATGCAGGGCCTTATAGG + Intergenic
942792732 2:179779408-179779430 TTGGTCATGCAGGCCTTTGCAGG + Intronic
942991022 2:182202809-182202831 TGGAACATGCAAGGCTTTGCTGG - Intronic
943660594 2:190555034-190555056 TGGAGCTTGCTGGAGCTTGCTGG - Intergenic
944325777 2:198401825-198401847 CAGATCATGCAGGACCTTGTAGG - Intronic
944395529 2:199262213-199262235 CAGATCATGTAGGGCCTTGCAGG + Intergenic
945957270 2:216098087-216098109 TGGATCATGGTGGCCCTTGCAGG + Intronic
946460688 2:219865894-219865916 TAGATCTTGCAGGACCTTGAAGG - Intergenic
946678386 2:222187078-222187100 TGGGTCTTGTAGGACCTTGTGGG - Intergenic
946844269 2:223845324-223845346 TGGATCACGCAGGTCCTTGGAGG + Intergenic
947940540 2:234050903-234050925 TGGATCATGCAGAGCCATGCTGG + Intronic
947992987 2:234501391-234501413 TGAATGAAGCAGGAGCTTGCAGG - Intergenic
948202820 2:236142203-236142225 CAGATCACGTAGGACCTTGCAGG - Intergenic
948523626 2:238557609-238557631 TGCAACAGGCAGGGCCTTGCAGG + Intergenic
948686132 2:239670801-239670823 TGGATTTTGCAGGGCCTTGTTGG + Intergenic
1169759813 20:9079213-9079235 TGTATCATTCAGGGCCCTGCTGG + Intronic
1171152030 20:22835697-22835719 CAGATCCTGCAGGGCCTTGCAGG + Intergenic
1171184700 20:23117004-23117026 TGACTCATGCACGACCTAGCAGG - Intergenic
1173029075 20:39337940-39337962 CAGATCATGGAGGACCTTCCAGG - Intergenic
1173338655 20:42134847-42134869 CAGATCATGCAAGACATTGCAGG - Intronic
1173377222 20:42497039-42497061 TGGGTCAGGAAGTACCTTGCTGG - Intronic
1173418770 20:42881940-42881962 TGGATCATGCAGGATCTTATAGG + Intronic
1173559552 20:43993150-43993172 CGGATCATGCAGGACTTTGCAGG + Intronic
1173598699 20:44277518-44277540 TGGATCACACAGGGCCTTACAGG + Intronic
1175011989 20:55747187-55747209 TGGATTATTCAGAACCTTGCAGG - Intergenic
1175416468 20:58804517-58804539 TGGATCACGAGGGACCCTGCAGG + Intergenic
1176958184 21:15129999-15130021 TAGATCATGCAGGATCTTGAAGG + Intergenic
1178984359 21:37290290-37290312 TGGATTTTGCAGGACGTGGCAGG - Intergenic
1180910957 22:19449522-19449544 TGGCTCATGGGGGACCCTGCTGG + Intergenic
1182013033 22:27016430-27016452 TGGACTCTGCAGGACCTAGCTGG - Intergenic
1182154512 22:28056765-28056787 AGGATCATGAAGGAACTTTCTGG - Intronic
1182190381 22:28453908-28453930 TAGATCATGTATGACCTTGTAGG - Intronic
1182745745 22:32604293-32604315 TGGATCAGGCAGAGCCTTGGAGG - Intronic
1182928876 22:34154051-34154073 TGTATCATGTAGGATCTTGTGGG + Intergenic
1183007857 22:34918322-34918344 TGGCTCATCCAGGCCCTTACAGG + Intergenic
1183026611 22:35070203-35070225 TAGATCATGAAGGTCCCTGCAGG - Intronic
949451607 3:4191415-4191437 TACATCATGTAGGTCCTTGCTGG + Intronic
949478729 3:4472998-4473020 TAGATCATGGAGGACCTTCTTGG - Intergenic
950076552 3:10191458-10191480 TAGACCATGCAGGGCCTTGTAGG - Intronic
951738572 3:25895462-25895484 TGGATCATGTAGGACCTTGTAGG - Intergenic
952964586 3:38613280-38613302 TCAATCATGAAGGACCGTGCTGG + Intronic
953086329 3:39671643-39671665 GGAGTCATGCAGGACCTTGTGGG - Intergenic
953780226 3:45862437-45862459 TGCAACCTGCAGGACCATGCAGG + Intronic
953839130 3:46374691-46374713 TAGATCATGAAGAACCTTGACGG + Exonic
954615054 3:51965246-51965268 TGGATCATGAAGGTCCTTGATGG - Intronic
955117140 3:56016979-56017001 TTGATCCTGCAGCACTTTGCAGG - Intronic
955631433 3:60979594-60979616 TGGATCATGCCTGACCCTTCTGG + Intronic
956350198 3:68326541-68326563 TGGACAATGCAGGATTTTGCAGG - Intronic
958791343 3:98654711-98654733 TGCTTCATGCAGTACCTTACAGG + Intergenic
959689431 3:109182632-109182654 CAGATCATGCAGGGCCTTGAAGG - Intergenic
962072713 3:132048360-132048382 TGGATCATGCAGGACCTTGCAGG - Intronic
962436938 3:135375429-135375451 TGGATCCTGCAGAAGCTTGTGGG - Intergenic
962739379 3:138351734-138351756 TGTCCCATGCAGGAACTTGCTGG - Intronic
964466227 3:156996442-156996464 CACATCATGCAGGGCCTTGCAGG + Intronic
964763722 3:160158380-160158402 TGGATCATGCAGGGCCTTGTAGG - Intergenic
964793412 3:160473681-160473703 TGGATAATGAAGGACCTTATGGG - Intronic
966160495 3:176962491-176962513 CAGGTCATGCAGGACCTTGCAGG + Intergenic
966577592 3:181519850-181519872 TGGATCATGCAAGACTTTGTAGG - Intergenic
967382493 3:188874663-188874685 TGAATCATGTAGGATCTTGATGG + Exonic
967702578 3:192610704-192610726 CAGATCTTGCAGGGCCTTGCAGG - Intronic
974651502 4:64759310-64759332 CGGATCATTCAGGTCCTTCCTGG - Intergenic
975854451 4:78608409-78608431 CAGATCATGCAGGACCTTTTTGG + Intronic
977567982 4:98600775-98600797 TGGATCATGAAGGACCTTAATGG + Intronic
978090179 4:104706429-104706451 TGGATCATTTAGGACCTTATAGG + Intergenic
978191176 4:105914317-105914339 TGGATCATGCAGGTAATAGCTGG + Intronic
978191179 4:105914508-105914530 TGGATCATGCAGGTAATAGCTGG - Intronic
978215018 4:106189792-106189814 AGGATCATGCAGCATCTTGTAGG - Intronic
981364273 4:143884038-143884060 TGGACCATGCAGAGTCTTGCAGG - Intronic
984823268 4:183903187-183903209 CAGATCATGCCGGAACTTGCAGG - Intronic
987246943 5:16058749-16058771 TAGATCACGTAGGACCTTGTGGG + Intergenic
992547862 5:77832732-77832754 TGGATCATGGAGGCTCTTTCAGG - Intronic
995025939 5:107422705-107422727 TCAACCATGGAGGACCTTGCTGG + Intronic
997636542 5:135411213-135411235 GGGATCATGAAGGATCTTGTTGG + Intergenic
998692627 5:144604021-144604043 CAGATCAAGTAGGACCTTGCAGG + Intergenic
999411270 5:151351936-151351958 TGGATCATGCAGGACCTTGTGGG - Intergenic
999559162 5:152781166-152781188 CAGATCATGTAGGGCCTTGCAGG - Intergenic
1000978985 5:167796312-167796334 TAGATCATGCAGCCCCTTGTAGG - Intronic
1001949086 5:175803641-175803663 TGGGTTAGGCAGGACCTTGAAGG + Intronic
1005842195 6:29750994-29751016 TGGATCATGGTGGACATTGGGGG + Intergenic
1007219930 6:40270389-40270411 GAGATCAGGCAGGGCCTTGCAGG - Intergenic
1007707614 6:43800355-43800377 GGAATCATGTAGGACCTTGAAGG - Intergenic
1007841273 6:44717867-44717889 TGGATCAAGCAAGGCCTTGCAGG - Intergenic
1007955468 6:45914191-45914213 TGGATCTTGCAGGCCCCTGTGGG + Intronic
1007974049 6:46082478-46082500 TGGATTATGCAGGGCCATGTGGG - Intergenic
1009430749 6:63563271-63563293 TGGATCACGTAGGACCTTGTAGG - Intronic
1011714137 6:90086605-90086627 TGGATCTGGCAGGACCTGCCTGG - Intronic
1012226002 6:96703921-96703943 TGGCCCATGCAGGATCTTGGAGG + Intergenic
1013037543 6:106401053-106401075 TGGATGATGTAGGAGCTTGCAGG - Intergenic
1013184885 6:107748989-107749011 TGGAGCCTGCAGGGCCTTGTCGG + Intronic
1014171415 6:118283066-118283088 TGGATTATGCCAGACCTTGCAGG - Intronic
1015228636 6:130887519-130887541 CAGATCATGCAGGGCCTTGGAGG - Intronic
1016086895 6:139925514-139925536 GGGAACATGAAGGACATTGCAGG - Intergenic
1017540621 6:155398858-155398880 AGGATCAAGCAAGACATTGCAGG + Intronic
1018331530 6:162732874-162732896 TAGATCACACAAGACCTTGCTGG - Intronic
1019269147 7:136502-136524 TGGATCATTCAAGATTTTGCTGG - Intergenic
1019375364 7:688502-688524 CAGATCACGCAGGGCCTTGCTGG - Intronic
1021153542 7:17181224-17181246 AGTATCATTCAGGACTTTGCAGG - Intergenic
1021925451 7:25529637-25529659 TGGTTCATGCTGGGCCCTGCGGG - Intergenic
1022838954 7:34144326-34144348 TGAATCACGCAGGACTTGGCAGG + Intronic
1023339244 7:39201901-39201923 TGTATCACGCATAACCTTGCAGG - Intronic
1023768337 7:43532484-43532506 TAGATCATGCCGGACTTGGCAGG - Intronic
1028292265 7:89079944-89079966 TGGATTATGGAGCACCTTGGAGG + Intronic
1029360975 7:100088604-100088626 CAGATCAGGCAGGGCCTTGCAGG + Intergenic
1030487526 7:110189091-110189113 CAGATCATGCAGGACTTTGTAGG + Intergenic
1031584522 7:123518464-123518486 TAGATCATTTAGGACCTTGAAGG - Intronic
1032140644 7:129326854-129326876 TGGATCATGTAGGACCCTGAGGG + Intronic
1032576593 7:133061082-133061104 TGGATTGTACAGGACCTTGCTGG + Intronic
1032686089 7:134235208-134235230 AAGATCATGGAGGACTTTGCAGG - Intronic
1033566843 7:142587014-142587036 TGGATCATTTAAGACCTTGATGG + Intergenic
1036094810 8:5711874-5711896 AGGATCATGCAGTCCCTTGAGGG - Intergenic
1037995163 8:23346967-23346989 AGGAAGATGCAGGAACTTGCTGG - Intronic
1041712367 8:60906175-60906197 TGGATCATGGCGGACGTTGAGGG - Intergenic
1044934473 8:97279448-97279470 CAGATCATACAGGGCCTTGCAGG - Intergenic
1046212683 8:111099063-111099085 AAGATCCTGCATGACCTTGCCGG - Intergenic
1046770998 8:118116409-118116431 AAAATCCTGCAGGACCTTGCAGG - Intergenic
1047986768 8:130243523-130243545 TGGGTCACGTAGGGCCTTGCAGG - Intronic
1048266101 8:132988455-132988477 TGGATACTGCAGATCCTTGCAGG + Intronic
1048568826 8:135632750-135632772 TGGACCATGCAGGGTCATGCAGG - Intronic
1048624912 8:136174523-136174545 TAGGTCATCCAGGACTTTGCAGG + Intergenic
1049743377 8:144251750-144251772 TGGGTCCTGCAGGACTTTCCAGG + Intronic
1052132222 9:24862166-24862188 TGGAGAATACAGGAGCTTGCAGG - Intergenic
1052972247 9:34384017-34384039 TGGATCATGGAGGGCCTTGTAGG - Intronic
1054809750 9:69425433-69425455 TGGATGCTTCAGGAGCTTGCTGG + Intergenic
1055424835 9:76183710-76183732 TTGATCCAGCAGGCCCTTGCAGG + Intronic
1058935682 9:109767465-109767487 TGAATCCTGCAGGATCTTGCTGG + Intronic
1060422999 9:123482907-123482929 TGGATCATGCAGGTCTTTTTAGG + Intronic
1185541011 X:902970-902992 TGGATCATGCTGGAGCTTCTGGG + Intergenic
1187248494 X:17575270-17575292 CAGGTCATGCAGGGCCTTGCAGG - Intronic
1188232150 X:27677663-27677685 CAGGTCATGCAGGACCTTGCAGG + Intronic
1188458027 X:30389444-30389466 AAGATCATGCAAGGCCTTGCAGG + Intergenic
1189901003 X:45706248-45706270 TGGATCATGTAGAGCCTTGTTGG - Intergenic
1190336825 X:49267645-49267667 TAGACCACGCAGGACCTTGTAGG + Intergenic
1193624707 X:83803842-83803864 TAGATCATGTAGGGCCTTGTAGG + Intergenic
1195166413 X:102224847-102224869 TGGATCAGGTGGTACCTTGCGGG + Intronic
1195192447 X:102462241-102462263 TGGATCAGGTGGTACCTTGCGGG - Intronic
1196416303 X:115475412-115475434 TGGATGATGCAGGAGATTGAGGG - Intergenic
1198973749 X:142311392-142311414 TGTATCATGCAGCACATTTCTGG + Intergenic
1199479308 X:148280439-148280461 TGAATTATGCAGAGCCTTGCAGG - Intergenic
1199546433 X:149011362-149011384 TGTGTGATGCAGGACCATGCAGG + Intergenic
1201279060 Y:12325258-12325280 TGGCTGATGCAGGACTTGGCAGG - Intergenic