ID: 962073940

View in Genome Browser
Species Human (GRCh38)
Location 3:132060691-132060713
Sequence CTGCTGAGGTTGTGGAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4606
Summary {0: 1, 1: 13, 2: 302, 3: 1225, 4: 3065}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962073940_962073943 21 Left 962073940 3:132060691-132060713 CCTTTTTTCCACAACCTCAGCAG 0: 1
1: 13
2: 302
3: 1225
4: 3065
Right 962073943 3:132060735-132060757 TTAATAGCAGCCATTCTGACTGG 0: 12
1: 363
2: 1930
3: 4456
4: 6274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962073940 Original CRISPR CTGCTGAGGTTGTGGAAAAA AGG (reversed) Intronic
Too many off-targets to display for this crispr