ID: 962081586

View in Genome Browser
Species Human (GRCh38)
Location 3:132145040-132145062
Sequence CAATATGAGTGGAGGGTAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 130}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962081586 Original CRISPR CAATATGAGTGGAGGGTAGT GGG (reversed) Intronic
904801768 1:33098008-33098030 CAATGTGAGGGGGTGGTAGTGGG - Intronic
904981855 1:34510484-34510506 CAATATTAGTGGAGGTAAGGTGG + Intergenic
908149543 1:61285660-61285682 AAATAGGGGTGGAGGGTAGGGGG + Intronic
915389632 1:155530181-155530203 GAATGTGAGTAGAGGGTGGTGGG - Intronic
918304582 1:183234502-183234524 GAATAAGAGTGTAGGGTATTAGG + Intronic
921196599 1:212763174-212763196 CAAAGGGAGTGGAGAGTAGTGGG - Intronic
921774782 1:219084403-219084425 TAATATGACTGGAGTGAAGTGGG - Intergenic
921893356 1:220374614-220374636 CACTATGTGTCTAGGGTAGTAGG + Intergenic
923554557 1:234990545-234990567 CAATATGACTGGAGGAAATTTGG - Intergenic
1065592810 10:27282843-27282865 CATTATTTCTGGAGGGTAGTGGG + Intergenic
1065657555 10:27967441-27967463 CATTATTTCTGGAGGGTAGTGGG - Intronic
1069667388 10:70172009-70172031 CAGGATGAGCGGAGGGTAGAGGG - Intergenic
1078355727 11:10630134-10630156 CAATGTGACTGGAGGGAAGGTGG - Intronic
1079591477 11:22188488-22188510 CACCATGGCTGGAGGGTAGTTGG + Intergenic
1079885406 11:25982014-25982036 CAATATCAGTGAAGTGTAATAGG + Intergenic
1083136755 11:60685765-60685787 CAGTTTGAGTTGAGGGTAGGGGG - Intergenic
1086292154 11:85323964-85323986 CCATGTAAGTGGATGGTAGTGGG + Intronic
1087620666 11:100538053-100538075 CAATATGGCTGCAGGGCAGTGGG + Intergenic
1089225026 11:116911991-116912013 CCATATGAGTGGAGCGAAGTTGG + Intronic
1089445876 11:118551767-118551789 CAAGGTGAGTGGAAGGTAGCAGG - Exonic
1089869615 11:121660490-121660512 CTATGTGACTGGAAGGTAGTAGG + Intergenic
1091606956 12:1961226-1961248 AAATATTTGTAGAGGGTAGTAGG + Intronic
1093274523 12:17107622-17107644 CAATATCAGTGTACGGTAGGGGG + Intergenic
1096071391 12:48777295-48777317 GAGTATGCGTGGAGGGTGGTGGG - Intronic
1102200947 12:111057359-111057381 CTATGTGAGTGGAGTGGAGTGGG + Intronic
1102580763 12:113885741-113885763 GAATATGAGTGAAGGGTATCTGG + Intronic
1103472761 12:121194995-121195017 CAATATGAATGGAGCATAGTGGG - Intergenic
1106903033 13:34374852-34374874 AAATATGAGAGGAGGGGAATTGG + Intergenic
1108974748 13:56424777-56424799 CAATATGAGCGGGGGGTCGGAGG + Intergenic
1114678245 14:24460004-24460026 CCACATGAGTTGGGGGTAGTGGG + Intergenic
1116740955 14:48753747-48753769 AAAGATGAGTAGAGGTTAGTGGG + Intergenic
1118380708 14:65215248-65215270 CAAGAAGAGTAGAGGGGAGTTGG + Intergenic
1120529322 14:85612964-85612986 CAATATTAGGGTAGGGAAGTAGG + Intronic
1121952627 14:98184918-98184940 AAATATTGGTGGAGGGTGGTGGG - Intergenic
1121991423 14:98561607-98561629 CTGTATGTGTGGAAGGTAGTGGG + Intergenic
1122522050 14:102351639-102351661 CAATGTAATTGGAGGGTGGTTGG - Intronic
1123805247 15:23864580-23864602 AAGTGTGTGTGGAGGGTAGTGGG - Intergenic
1126320357 15:47415718-47415740 CAATATGAGTTGGGGGTGGGGGG + Intronic
1126362414 15:47860039-47860061 CAAAAGGAGTGGAGGGTCGGGGG + Intergenic
1127729833 15:61789569-61789591 GAATATGAGTAGTGGCTAGTAGG + Intergenic
1128442703 15:67727492-67727514 AAGTATAAATGGAGGGTAGTAGG - Intronic
1130659116 15:85816031-85816053 CAAAATGAGTGGCGGGCAGGAGG + Intergenic
1131977717 15:97961828-97961850 CATTTTGAGTGGAGAGAAGTGGG - Intronic
1132378335 15:101347844-101347866 CAACAGGAGTGGAGGGCAGCAGG + Intronic
1133712862 16:8418217-8418239 CTACATGAGTGGAGGGTGGGAGG + Intergenic
1137400829 16:48153263-48153285 AAATCTCAGTGAAGGGTAGTTGG + Intronic
1138458522 16:57134560-57134582 CACTATGAGGAGAGGGTGGTTGG + Intronic
1141076760 16:81013401-81013423 CAAGAAGAGTGGAAGGAAGTGGG + Intronic
1141968032 16:87460294-87460316 CACTTTCAGTGGAGAGTAGTAGG - Intronic
1142408402 16:89903831-89903853 CCATGTGTGTGGAGGGTGGTGGG + Intronic
1144114417 17:12073307-12073329 CATTATGAGTGAAGTGTACTAGG + Intronic
1146032943 17:29381930-29381952 CAATATTAGTAGAGGGGGGTGGG + Intergenic
1146359583 17:32163015-32163037 CAAATTGAGTGGGGGATAGTGGG + Intronic
1147619225 17:41853061-41853083 CAATCTGAGGTGACGGTAGTTGG - Intergenic
1149134684 17:53350436-53350458 AAATATGAGTGGATTGTTGTAGG + Intergenic
1151014151 17:70534981-70535003 CAATATGAGTGGGAGATAATGGG + Intergenic
1151341900 17:73477056-73477078 CAATTTGGGTGGAGTGAAGTGGG - Intronic
1154398978 18:14017022-14017044 CAATAGGAGTTGAGGGTGATTGG - Intergenic
1156355556 18:36337444-36337466 CAATATGTGTGGAGGTTTTTAGG + Intronic
1157402008 18:47396475-47396497 CACTATGAGGGGAGGGAAGTAGG + Intergenic
1157968781 18:52241401-52241423 AAATATGAGTGGAAGTTACTAGG + Intergenic
1159266973 18:66093512-66093534 TTATATGAATGGAGGGTAGGAGG - Intergenic
1163136822 19:15317592-15317614 CAATGGGAGTGGGGGGTGGTGGG + Intronic
1163840904 19:19609212-19609234 CCAGATAACTGGAGGGTAGTTGG - Intronic
1165691045 19:37863454-37863476 CAATATGAATGGAGGGGACAAGG - Intergenic
928301412 2:30128727-30128749 CAATATTTGTGGAGGGCAATGGG - Intergenic
932881204 2:75503763-75503785 AAAGGTGAGTGGAGGGTAGGAGG + Intronic
932893973 2:75621107-75621129 CAATAGGAGTGAAAAGTAGTGGG - Intergenic
935878032 2:107533810-107533832 CAAGATGAGAGGAGGCAAGTCGG - Intergenic
936611082 2:114002630-114002652 CAATAGGTCTGGAGTGTAGTTGG + Intergenic
936907193 2:117550749-117550771 CAATATGGGTGGAGGGTTTTTGG - Intergenic
937537629 2:122910524-122910546 GAATATGAGTTTAGGTTAGTTGG + Intergenic
941533101 2:166693316-166693338 CAATATCAGTGGGGGGTGGGGGG + Intergenic
943902743 2:193462270-193462292 CAATCTAAGTGGAAAGTAGTAGG + Intergenic
945966392 2:216191918-216191940 CAATATAATTGGAGGGTTATGGG + Intronic
1168928795 20:1604668-1604690 CTGGATGAGTGGAGGGTGGTGGG + Intronic
1168969584 20:1921764-1921786 CTGGATGAGTGGAGGGTGGTGGG - Intronic
1170906058 20:20516064-20516086 CAATGGGAGTGGAGAGTAGCAGG - Intronic
1171256579 20:23693219-23693241 ACATATGAATGGAGGGGAGTAGG + Intergenic
1171263935 20:23755151-23755173 ACATATGAATGGAGGGGAGTAGG + Intergenic
1171273132 20:23831997-23832019 ACATATGAATGGAGGGGAGTAGG + Intergenic
1172071646 20:32261694-32261716 CAAAAGGGGTGGAGGGCAGTGGG - Intergenic
1172166677 20:32903811-32903833 CCATGGGAGTGGAGGGAAGTAGG + Intronic
1174277962 20:49417359-49417381 CCATGTGAGAGAAGGGTAGTAGG - Intronic
1177608970 21:23421196-23421218 CAATATTGATGGAGTGTAGTTGG + Intergenic
1179372550 21:40819768-40819790 CAATATGAGTGGAATGGAGCTGG - Intronic
1181018872 22:20087855-20087877 AACTTTGAGTTGAGGGTAGTGGG + Intronic
1182694011 22:32184465-32184487 CAATCTGAGTGGAGGGGTGGGGG + Intergenic
1183368296 22:37418628-37418650 CAACAGGAGAGGAGGGTAGTTGG - Intronic
954501892 3:51025338-51025360 CAAAAGGAGTGGGGAGTAGTGGG + Intronic
958180245 3:90050615-90050637 CTATGTGTGTGGAGGGTGGTAGG + Intergenic
958724296 3:97885717-97885739 CAATATGATTGCAGAGTTGTAGG + Intronic
961185601 3:124912438-124912460 CAAGAGGCATGGAGGGTAGTGGG + Intronic
962081586 3:132145040-132145062 CAATATGAGTGGAGGGTAGTGGG - Intronic
966321674 3:178707854-178707876 CAATATAAGTAGTGGTTAGTTGG - Intronic
969248291 4:5950371-5950393 TAATATGAGTGGAGAGAAGGGGG + Intronic
970989816 4:22199792-22199814 GAATGTGAGTGGAAGTTAGTTGG + Intergenic
975913958 4:79300388-79300410 CAATAGAAGTGCAGGGTAGGGGG - Intronic
976548607 4:86367255-86367277 CAATATGAGGGGATGGTGGAGGG + Intronic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
990842756 5:60102423-60102445 CAATATGAGTTGGGGAGAGTAGG + Intronic
991329587 5:65479576-65479598 GAATATGTGTTGGGGGTAGTGGG - Intronic
995470255 5:112494269-112494291 CAATATGATTTGTGGGTACTTGG + Intergenic
996857064 5:128020104-128020126 AAATATGAATGGAAGGCAGTAGG + Intergenic
997714874 5:136035063-136035085 TAATATGAATTGAGGGAAGTTGG + Intronic
998908788 5:146935570-146935592 CAATATGTGGGGATGGTGGTAGG + Intronic
999652525 5:153781452-153781474 AAATATGGGTGGAGGGCAGAAGG - Intronic
1003516838 6:6825071-6825093 CAATGTGAGTGGAGTCTAGCCGG + Intergenic
1006601994 6:35232412-35232434 CAATGAGAGTGGAGGGTAATTGG - Intronic
1006679703 6:35788098-35788120 CACCATGAGTGGAGGGAAGTGGG + Exonic
1007975090 6:46093578-46093600 CCATATTAGTGGTGTGTAGTGGG - Intergenic
1013965167 6:115946961-115946983 AAATATGAGTGGAGGGCATGGGG + Intronic
1017811256 6:157985469-157985491 GAACCTGACTGGAGGGTAGTTGG + Intronic
1022478012 7:30724280-30724302 GAATCTGAGTGAAGGGTAGATGG - Intronic
1023111272 7:36813383-36813405 CAGGGTGAGAGGAGGGTAGTAGG - Intergenic
1024394514 7:48850150-48850172 CAATGTGTGTGGAGGGTGTTGGG + Intergenic
1024400752 7:48922491-48922513 CAATGTGTGTGGAGGGTGTTGGG - Intergenic
1029996571 7:105013388-105013410 CAATGTGCGGGGAGGGGAGTGGG - Intergenic
1030683908 7:112463478-112463500 CAAAAGGAGTGTAGGGGAGTTGG - Intronic
1031964640 7:128018851-128018873 CAATGTTAGTTGAGGGTAGAGGG - Intronic
1038028492 8:23615078-23615100 CAATATGAGAGAAGGGCAGCAGG + Intergenic
1042938327 8:74082771-74082793 AAATATGACTGGAGGGCAGAAGG + Intergenic
1047754749 8:127909836-127909858 CAACTGGAGTGGAGGGTTGTGGG + Intergenic
1048950736 8:139494972-139494994 CAATTTGAATGGAGAGTAATAGG + Intergenic
1053478670 9:38400273-38400295 TAAAATGAGTGGAGGGGACTGGG - Intergenic
1054901566 9:70374599-70374621 CTAAATATGTGGAGGGTAGTTGG + Intergenic
1055353907 9:75417929-75417951 CACTAGGAGTGGAGGGCTGTGGG + Intergenic
1055611021 9:78024378-78024400 CAAAAAGAATGGAGGGTAATCGG - Intronic
1056495622 9:87152188-87152210 CAAGATGTGTATAGGGTAGTGGG + Intronic
1056683536 9:88740980-88741002 CAGTGTGAGTGAAGGGCAGTGGG + Intergenic
1057861032 9:98641047-98641069 CAATAGGGGTGGAGGGGAGAAGG - Intronic
1187771552 X:22704192-22704214 GGACATGAGTGGAGGGTGGTTGG - Intergenic
1188230036 X:27650834-27650856 GAATATGAGTGGTGAGAAGTGGG + Intronic
1194716838 X:97296297-97296319 CAAGATAAATGAAGGGTAGTAGG - Intronic
1196679249 X:118454000-118454022 CAATGGGAGTGGAAGGTGGTGGG + Intergenic
1197590009 X:128397061-128397083 CAAGAGGAGGGGAGGGAAGTGGG - Intergenic
1200246881 X:154531204-154531226 CAATATGCGTGGAGCGGAGGAGG + Intergenic
1201695691 Y:16822794-16822816 CAATGTGACTTGAGGGGAGTAGG - Intergenic