ID: 962083809

View in Genome Browser
Species Human (GRCh38)
Location 3:132169311-132169333
Sequence ATGCTGCAATTCATGAATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 0, 2: 3, 3: 55, 4: 285}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962083809 Original CRISPR ATGCTGCAATTCATGAATCA AGG (reversed) Intronic
900508693 1:3045171-3045193 ATTCTGCAACCCATGGATCAAGG - Intergenic
903981503 1:27192034-27192056 AGGCTGCATTTCAGGAAGCATGG + Intergenic
904401940 1:30262515-30262537 TTTCTGCAAATCCTGAATCATGG - Intergenic
907455837 1:54574946-54574968 ATGCAGCAATTCATGGAGCTGGG + Intronic
908835094 1:68221653-68221675 AGGCTGGAATTCATAAAACATGG + Intronic
908893107 1:68867901-68867923 ATTCTGCAGCCCATGAATCAAGG - Intergenic
909968943 1:81956555-81956577 ATTCTGCAATCTATGAAGCACGG - Intronic
911419787 1:97626107-97626129 ATGCTGTATTTCAGGCATCACGG - Intronic
913344986 1:117799781-117799803 ATTCTGCAGTCCATGGATCAAGG - Intergenic
913351042 1:117859598-117859620 ATTCTGCAGCCCATGAATCAAGG + Intergenic
917271894 1:173284921-173284943 ATTCTGCAGTCCATGGATCAAGG + Intergenic
919367411 1:196680624-196680646 CTGCTGCAATTAGTGAAACAAGG + Intronic
919436142 1:197563644-197563666 ATTCTGCAACCCATGGATCAAGG + Intronic
919548821 1:198958806-198958828 ATTCTGCAGTCCATGAATCAAGG - Intergenic
919612892 1:199768127-199768149 ATTCTGTAACCCATGAATCAAGG + Intergenic
920887657 1:209947191-209947213 ATTCTGCAGCTCATGGATCAAGG + Intronic
921292112 1:213668267-213668289 ATTCTGCAGCCCATGAATCAAGG - Intergenic
921408321 1:214806748-214806770 ATTCTGCAGCTCATGGATCATGG + Intergenic
923505379 1:234600634-234600656 AGCGTGCAATTCATGCATCAAGG - Intergenic
924006898 1:239622284-239622306 ATTCTGCAGCCCATGAATCAAGG + Intronic
924380103 1:243455057-243455079 ATGCTGTAATTCATAAGACAAGG + Intronic
1063343550 10:5291499-5291521 ATGCTGCAATTCACGAGGAAAGG + Intergenic
1064001197 10:11665025-11665047 CTCCGGCAATTCATCAATCACGG - Intergenic
1065059180 10:21880486-21880508 ATTCTGCAACCCATGAATCAAGG - Intronic
1066478892 10:35775975-35775997 ATGCTGCAGCCCATGGATCAAGG - Intergenic
1067275674 10:44831380-44831402 ATTCTGCAGCCCATGAATCAAGG - Intergenic
1068357719 10:55931457-55931479 ATCCAGCAATTCATGAAAAAAGG + Intergenic
1068870044 10:61933544-61933566 ATTCTGCAGTCCATGGATCAAGG - Intronic
1068974494 10:62993988-62994010 ATGCTGGAATTCAGGACCCAGGG + Intergenic
1069196919 10:65562066-65562088 ATTCTGCAACCCATGGATCAAGG - Intergenic
1073744960 10:106457455-106457477 ATGCTTCAATATATGCATCATGG - Intergenic
1073901231 10:108223584-108223606 CTGGTGCAACTCAGGAATCATGG + Intergenic
1077837505 11:5937550-5937572 ATGCTGCTATTAACGAGTCAGGG + Intronic
1078847817 11:15137014-15137036 ATTCTGCAGCCCATGAATCAAGG - Intronic
1079288592 11:19164691-19164713 ATTTTGCAATTGAGGAATCAAGG + Intronic
1080408636 11:32002266-32002288 ATGCTGAAATCCACGAATCAAGG - Intronic
1080414450 11:32056190-32056212 ATCCTGCAATTTATAAAGCATGG + Intronic
1081186182 11:40045404-40045426 ATTCTGCAACTCATGAATCAAGG - Intergenic
1081424594 11:42911394-42911416 ATTCTGCAGTCCATGGATCAGGG + Intergenic
1083071367 11:59986493-59986515 ATTCTGCAGTCCATGGATCAAGG - Intergenic
1084361947 11:68674382-68674404 ATTCTGTTATTCATGCATCACGG + Intergenic
1086121531 11:83309619-83309641 ATTCTGCAACCCATGAATCAAGG - Intergenic
1086323472 11:85674241-85674263 ATTCTGCAAGCCATGAATCAAGG - Intronic
1086775042 11:90820013-90820035 ATTCTACAGCTCATGAATCAAGG - Intergenic
1086869968 11:92025960-92025982 AGGCTCCAGTTCATGCATCAAGG + Intergenic
1090625665 11:128606293-128606315 ATGCTACCTTCCATGAATCAGGG + Intergenic
1091427010 12:399511-399533 ATTCTGCAGCTCATGGATCAAGG - Intronic
1091515467 12:1176184-1176206 ATTCTGCACCTCATGGATCAAGG - Intronic
1092582337 12:9856416-9856438 ATACTGCAAATCAAGAATTAAGG - Intronic
1093402108 12:18759094-18759116 ATTCTGCAGTCCATGAATCAAGG + Intergenic
1094205432 12:27834958-27834980 ATTCTGTAATTCATCAATCAAGG + Intergenic
1094585451 12:31773556-31773578 CAGCTGCAACTCATCAATCAGGG + Intergenic
1095123444 12:38445381-38445403 ATTATTTAATTCATGAATCATGG - Intergenic
1095273560 12:40251775-40251797 ATTTGGTAATTCATGAATCATGG + Intronic
1095390420 12:41699518-41699540 ATGCTGGAATTCATAAAAAAAGG + Intergenic
1095466815 12:42496134-42496156 ATTCTGCAGCTCATGAATCATGG - Intronic
1095605896 12:44067455-44067477 ATTCTGCAACCCATGGATCAAGG - Intronic
1095657918 12:44692462-44692484 ATTCTACAGCTCATGAATCAAGG + Intronic
1096752202 12:53767901-53767923 CTGCTGCAATGCAGCAATCATGG + Intergenic
1097453629 12:59767781-59767803 ATTCTGCAGCTCATGGATCAAGG + Intronic
1098587597 12:72172299-72172321 ATGCAGTAATTCTTGAATCAAGG - Intronic
1098844161 12:75515120-75515142 ATGCTGCAATTCAAGTACAAGGG - Intergenic
1098936798 12:76489733-76489755 ATTCTGCAGTCCATGAATCAGGG + Intronic
1099820512 12:87703364-87703386 ATTCTGCAGTCCATGGATCAAGG - Intergenic
1100676487 12:96874354-96874376 TATTTGCAATTCATGAATCAGGG + Intronic
1102700651 12:114836250-114836272 ATGCTGCATTTCATGGTTCATGG + Intergenic
1104484523 12:129138833-129138855 ATGCTGGAAACCATGAAACATGG + Intronic
1104533982 12:129600603-129600625 ATTCTGCAACCCATGGATCAAGG - Intronic
1104780750 12:131418535-131418557 ATGCTCAACATCATGAATCAGGG - Intergenic
1105546801 13:21356470-21356492 ATGCTGAAATTCATGAAAAGGGG + Intergenic
1105780199 13:23699142-23699164 ATTCTGCAGCTCATGAATCAAGG + Intergenic
1106116167 13:26819695-26819717 ATGCTTCAATATATGAATCTGGG - Intergenic
1106773951 13:32990615-32990637 ATGCTGGAATTCTGAAATCAAGG + Intergenic
1107079339 13:36357460-36357482 CTGCTGAAATTCAGGATTCAGGG + Intronic
1108969863 13:56360424-56360446 ATCCTGCAATTAATAAATCAGGG - Intergenic
1110368473 13:74714632-74714654 ATGCTGTTATTCATGACTCTAGG - Intergenic
1111345206 13:86943998-86944020 ATACTGCAAATCATCAAGCAGGG - Intergenic
1111466538 13:88619729-88619751 ATGCTTAAATTCATAAATAATGG - Intergenic
1113980909 13:114274644-114274666 ATCCTGCAGCTCATGGATCAAGG - Intergenic
1116016020 14:39408316-39408338 ATGCTGAGTTTCATTAATCATGG - Intronic
1116509248 14:45723362-45723384 ATTCTGCAGTTCATGGATCCTGG + Intergenic
1117231322 14:53722118-53722140 ATTCTGCAGTTCATAAATCAAGG + Intergenic
1117359598 14:54959936-54959958 ATTCAGTGATTCATGAATCAGGG - Intronic
1117662678 14:58023767-58023789 ATTCTGCAGTTCATGGATCAAGG - Intronic
1119451580 14:74716238-74716260 ATACTTCAATTCATTAAACATGG - Intronic
1120023727 14:79558410-79558432 ATTCTGCAGTTCATGGATCAAGG - Intronic
1120432025 14:84431214-84431236 ATGCTGTGATTCACGAATCTTGG - Intergenic
1120577556 14:86202173-86202195 ATTCTGCAGCTCATGGATCAAGG + Intergenic
1121766504 14:96491535-96491557 ATTCTGCAGCCCATGAATCAAGG - Intergenic
1121897330 14:97660548-97660570 ATGCTGAGATTCAGGAATCCTGG + Intergenic
1121998102 14:98621675-98621697 ATTCTGCAGCCCATGAATCAAGG + Intergenic
1122138588 14:99648751-99648773 AAACTGCTATTCATGACTCAAGG - Intronic
1124443351 15:29706328-29706350 AGGTTGCAATTCATTAATGAAGG - Intronic
1124648217 15:31455219-31455241 ATGCTTTACTTCTTGAATCATGG + Intergenic
1125366742 15:38925576-38925598 ATTCTGCAGCCCATGAATCAAGG - Intergenic
1127951469 15:63811381-63811403 ATGTTGCAATTTGTGAATCTAGG + Intronic
1131018690 15:89079554-89079576 ATGCTGCCATTCAGAAGTCATGG - Intergenic
1131530845 15:93190464-93190486 ATGCAGGAATTCATCGATCATGG - Intergenic
1135237580 16:20772433-20772455 ATGCTTCAAGTCATTGATCAAGG - Intronic
1136048556 16:27634521-27634543 TAGCTGCAATCCAGGAATCAGGG + Intronic
1136081485 16:27855120-27855142 ATGGTGGAATTGATGAATGAGGG + Intronic
1142517987 17:445574-445596 TTTTTGCAATTCATGTATCATGG - Intronic
1144165532 17:12606642-12606664 ATTCTGCAGTCCATGGATCAAGG - Intergenic
1144382414 17:14715372-14715394 ATGCTACAATAAATGTATCAGGG - Intergenic
1145127120 17:20310755-20310777 ATGCAGCAATTCCTGAGGCATGG + Intronic
1148879368 17:50713991-50714013 ATGGTGAAATGCAGGAATCAAGG + Intergenic
1149155817 17:53629142-53629164 ATGCTGCAACCCAGGAACCAAGG + Intergenic
1151198767 17:72452427-72452449 ATGCTGGACTTCAAGGATCATGG + Intergenic
1153118264 18:1687425-1687447 ATGTTGCATTCCATGACTCATGG - Intergenic
1153133094 18:1880347-1880369 ATTCTGCAGTACATGGATCAAGG - Intergenic
1153406420 18:4745698-4745720 ATTCTGCAGCTCATGAATCAAGG - Intergenic
1156102536 18:33614689-33614711 ATTCTGCAGTCCATAAATCAAGG - Intronic
1156662574 18:39363550-39363572 ATGCTACAATTTATCAATGATGG - Intergenic
1156818697 18:41343614-41343636 AGGCTGAAAGTCAGGAATCATGG + Intergenic
1158204551 18:54977799-54977821 ATTCTGCAGCTCATGGATCAAGG - Intergenic
1162622470 19:11854994-11855016 ATGCTGCCATTCATAAATGAAGG + Intronic
1164898861 19:31901053-31901075 ATGCTGCATATCATGAATTGAGG + Intergenic
1164901116 19:31924926-31924948 GTGCTGCAGCCCATGAATCAAGG - Intergenic
1166597883 19:44066631-44066653 AAGCTGGAAATCATGAATGAAGG - Exonic
925081587 2:1072644-1072666 ACTCTGCAAGTCAGGAATCAAGG + Intronic
925516475 2:4689201-4689223 ATGAATCAATTCATGAATGAAGG + Intergenic
926818459 2:16825714-16825736 ATTCTGCAGTCCATGGATCAAGG - Intergenic
927014308 2:18941395-18941417 ATTCTGCAACTCATGGATCAAGG - Intergenic
927027610 2:19085529-19085551 TTGCTTCCATTCTTGAATCATGG - Intergenic
927396528 2:22657347-22657369 ATTCTGCAGTCCATAAATCAAGG + Intergenic
927657392 2:24961415-24961437 ATTCTGCAACCCATGGATCAAGG + Intronic
928181564 2:29071971-29071993 ATGATGCAATTCCTGAGGCAGGG + Exonic
930507278 2:52299264-52299286 ATTCTGCAGTCCATGGATCAAGG + Intergenic
930654974 2:53998869-53998891 ATGCTGAGATTCACGAATCCAGG + Intronic
931141789 2:59467507-59467529 ACTCTGCAACTCATGGATCAAGG - Intergenic
933292423 2:80452781-80452803 ATGCTGAAATTAATGAACCTTGG + Intronic
933414293 2:81966322-81966344 ATTCTGCAACCCATGAATGAAGG + Intergenic
933616711 2:84489277-84489299 ATTCTTCAATTGTTGAATCAGGG + Intergenic
933944095 2:87269711-87269733 ATTCTGCAGCCCATGAATCAAGG - Intergenic
935036785 2:99384446-99384468 ATTCTGCAGCTCATGGATCAAGG + Intronic
935460272 2:103323122-103323144 ATCTTTCAACTCATGAATCAAGG + Intergenic
936336124 2:111591868-111591890 ATTCTGCAGCCCATGAATCAAGG + Intergenic
936920328 2:117682041-117682063 ATTCTTCATTCCATGAATCAAGG + Intergenic
937566886 2:123304116-123304138 ATTCAGCAATTCATAAATAAAGG + Intergenic
938160754 2:128982675-128982697 AGGCTGCAAGTCTTCAATCAAGG - Intergenic
938405709 2:131032063-131032085 ATGCTGCAAGACATGAGGCAGGG - Intronic
938987148 2:136588051-136588073 ATTCTGCAGCCCATGAATCAAGG - Intergenic
939497934 2:142946417-142946439 ATTCTGCAGTCCATGGATCATGG - Intronic
941056673 2:160797254-160797276 ATTCTGCAGCCCATGAATCAAGG + Intergenic
941086936 2:161128711-161128733 ATATTGCAATTGATGAATGAAGG + Intergenic
941108520 2:161391299-161391321 GTGCTGCAATTCATCAATAATGG - Intronic
942537658 2:176982395-176982417 ATCCTGCACTTCATCAGTCAGGG - Intergenic
943740753 2:191405568-191405590 ATTCTGCAGCTCATGGATCAAGG - Intronic
945513199 2:210728268-210728290 ATGCTGCTATACATGTATAATGG - Intergenic
946376733 2:219314517-219314539 ATGCTGAAATTTAAGAACCACGG + Intergenic
947252939 2:228128690-228128712 ATTCTGCAGCCCATGAATCAAGG - Intronic
1170402865 20:16006484-16006506 ATGTGGCTATTCAGGAATCAAGG - Intronic
1170805769 20:19629799-19629821 AAACTGCCATTCATTAATCATGG + Intronic
1171146056 20:22784046-22784068 ATTCTTCAATTCATGGATCAAGG + Intergenic
1172471382 20:35199409-35199431 ATTCTGCAGTCCATGGATCAAGG + Intergenic
1172545563 20:35758560-35758582 ATTCTGCAGTCCATGAATGAAGG + Intergenic
1172825135 20:37776125-37776147 ATGCTGAATTTCTTGAAACAAGG + Intronic
1173923519 20:46763562-46763584 ATGCTGGAATTCCAGCATCATGG + Intergenic
1174599103 20:51709752-51709774 ATGTCACAATTCATGAATCTGGG + Intronic
1177934670 21:27329159-27329181 ATGCTGCCATTCATGTACCTAGG - Intergenic
1179898520 21:44376907-44376929 ATGCTGCAGTTCAGGGACCAGGG + Intronic
1179898533 21:44376985-44377007 ATGCTGCAGTTCAGGGACCAGGG + Intronic
1181866893 22:25865451-25865473 GTGCTGCAAAACATGAATGAAGG - Intronic
1183268091 22:36842813-36842835 ATTCTGCAGCCCATGAATCAAGG + Intergenic
1184067177 22:42127525-42127547 GCGCTGCACCTCATGAATCACGG + Exonic
1184069902 22:42141230-42141252 GTGCTGCACCTCGTGAATCACGG + Intergenic
949411977 3:3775720-3775742 ATTCTGCAGCTCATGGATCAAGG + Intronic
950314928 3:11993208-11993230 ATTCTGCAGTCCATGGATCAAGG - Intergenic
951373391 3:21881608-21881630 ATTCTGCAACCCATGAATCAAGG + Intronic
951815397 3:26748427-26748449 ATGCTGCAATTCAAGTCTGAAGG + Intergenic
952580966 3:34832868-34832890 ATTCTGTCATTCATGTATCAAGG + Intergenic
952774989 3:37036831-37036853 ATTCTGCAACCCATGGATCAAGG + Intronic
953231069 3:41065489-41065511 AGGCTGCAATTCATGCTGCAGGG + Intergenic
953436158 3:42879455-42879477 ATTCTGCAACCCATGGATCAAGG + Intronic
953654437 3:44838396-44838418 GTGCTGAAGTTCCTGAATCAGGG - Exonic
954570783 3:51639207-51639229 ATGCTGCCATTCATGTGTCATGG + Intronic
955426668 3:58798089-58798111 ATTCTGCAGCTCATGGATCAAGG + Intronic
955551955 3:60094681-60094703 ATCCTGCAAGTTAGGAATCAAGG - Intronic
957663295 3:83189633-83189655 TTTCAGCAATTCATAAATCAGGG + Intergenic
957751036 3:84416034-84416056 ATGTTGCAATCCATGAAGAATGG - Intergenic
957808771 3:85189691-85189713 ATTCTGTGAGTCATGAATCAAGG + Intronic
957941708 3:87014216-87014238 ATGCTGCAAATCCTGAAACAAGG - Intergenic
957992140 3:87639752-87639774 ATGCTGCACATCACTAATCAGGG - Intergenic
958509237 3:95023849-95023871 ATTCTGCAGTGCATGAATCAAGG + Intergenic
958933276 3:100230291-100230313 ATTCTGCAGTTCATGGATCAAGG + Intergenic
959077872 3:101769749-101769771 CTGCTTCACTTCATGAATGAGGG - Exonic
959390434 3:105765851-105765873 ATTCTGCAGCCCATGAATCAAGG + Intronic
959873596 3:111356522-111356544 ATTCTGCAGTCCATGGATCAAGG + Intronic
962083809 3:132169311-132169333 ATGCTGCAATTCATGAATCAAGG - Intronic
962381177 3:134899206-134899228 ATGATGAACTTCATGCATCAGGG - Intronic
962420015 3:135219574-135219596 ATGCTGCAAGTCTGAAATCAAGG - Intronic
962979321 3:140473566-140473588 CTGCTGCATTCCTTGAATCATGG - Intronic
964126834 3:153242435-153242457 ATTCTGCAACCCATGAATCAAGG + Intergenic
964469210 3:157034171-157034193 ATTCTGCAGCGCATGAATCAAGG + Intronic
965595574 3:170407655-170407677 ATTCTGAAGTCCATGAATCAAGG + Intergenic
965831152 3:172790690-172790712 ATTCTGCAGCCCATGAATCAAGG - Intronic
967378929 3:188835822-188835844 AGGTAGCAATTCCTGAATCAAGG + Intronic
969593019 4:8132635-8132657 ATGCTGCACATCATGAAGCACGG + Intronic
971164297 4:24166927-24166949 ATTCTGCAGCTCATGGATCAAGG + Intergenic
971609819 4:28708865-28708887 ATTCTGCAGTCCATGGATCAAGG + Intergenic
971881231 4:32376307-32376329 ATTCTGCAGTCCATGAATCAAGG - Intergenic
972560404 4:40222703-40222725 ATTCTGCAACCCATGGATCAAGG + Intronic
972618865 4:40726369-40726391 AAGTTGCAATTTATGAATAATGG - Intergenic
972711706 4:41603057-41603079 ATGCTGCAATGAAGTAATCAGGG + Intronic
972819337 4:42681741-42681763 AAGCAGCAGTTCAGGAATCAAGG - Intergenic
972841897 4:42940604-42940626 ATATTGCAATAAATGAATCAAGG + Intronic
975169724 4:71219534-71219556 ATTCTGCAGCTCATGGATCAAGG + Intronic
976991625 4:91374647-91374669 ATTCTGCAACTCATGGATCAAGG + Intronic
977567993 4:98600930-98600952 ATTCTGTAGTCCATGAATCAAGG - Intronic
977808339 4:101329947-101329969 ATTCTGCAGTCCATGGATCAAGG + Intronic
977831262 4:101596409-101596431 CTGCAGCAATTCTTGAATTATGG + Intronic
978392721 4:108243856-108243878 CTGCTACAATTCATGAATCTTGG + Intergenic
979313921 4:119237018-119237040 ATTCTGCAGCTCATGAATCAAGG - Intronic
979324612 4:119364393-119364415 ATGGTGCAATTCCTGGAACAGGG + Intergenic
979895716 4:126154147-126154169 ATTCTGCAGCTCATGGATCAAGG + Intergenic
980526675 4:133997448-133997470 ATTCTGCAAATCATGGATCAAGG + Intergenic
982611769 4:157583173-157583195 ATGCTGAAAGTCAAAAATCAAGG - Intergenic
983086432 4:163450559-163450581 ATTCTGCAACCCATAAATCAAGG - Intergenic
983242451 4:165249093-165249115 ATGGTGCAATTCCTGGAACAGGG + Intronic
983310135 4:166049144-166049166 ATGCAGCTCTTCATGAATTACGG + Intronic
983316050 4:166134201-166134223 TTGCTGCAATTCCTGCAGCAAGG + Intergenic
984258516 4:177415915-177415937 ATTCTGCAGTCCATAAATCAAGG - Intergenic
984616602 4:181905382-181905404 CAGCTGGAACTCATGAATCAAGG - Intergenic
985187375 4:187332179-187332201 ATGCTGCACTTGATGTACCATGG - Intergenic
985311026 4:188599367-188599389 ATTCTGCAGTGCATGGATCAAGG - Intergenic
985516228 5:346168-346190 ATGCTGCAATTCATATATAAAGG + Intronic
986527135 5:8691643-8691665 TTGCAGAAATTCATGAATAATGG - Intergenic
987750299 5:22030330-22030352 ATTCTGCAGTCCATGCATCAAGG - Intronic
987920194 5:24270445-24270467 CTGCCGCAATTCATATATCAAGG + Intergenic
990874665 5:60470904-60470926 ATTCTGCAGTTCATAGATCAAGG + Intronic
991228706 5:64304255-64304277 ATTCTGCAGTCCATGGATCAAGG + Intronic
991391339 5:66146608-66146630 TTGCTGCAAAACATGAATGAGGG - Intronic
992510651 5:77430686-77430708 ATGCTGCAGTCCATGGGTCAAGG + Intronic
992951238 5:81859908-81859930 ATGCTCCAATTCATTCTTCAAGG + Intergenic
992983706 5:82204755-82204777 ATGATGCAATTCATAGATGAGGG + Intronic
994559165 5:101346061-101346083 ATGCTGGAATTCAGGAATCACGG + Intergenic
994563784 5:101413659-101413681 ATGCACCTATTCATGAATCAGGG + Intergenic
995620332 5:114019179-114019201 ATTCTGAAATTCATAAAGCAGGG + Intergenic
995807971 5:116075561-116075583 ATGATGCCATTCATGCAGCAGGG + Intergenic
997073512 5:130644741-130644763 ATGCTGAAATTCATGCATAAAGG + Intergenic
997566501 5:134891333-134891355 ATTCTGCAGCCCATGAATCAAGG - Intronic
998831278 5:146162292-146162314 ATTCTGCAGTCCATGAATCAAGG - Intronic
1000699971 5:164437171-164437193 TATCTGTAATTCATGAATCAGGG + Intergenic
1000710236 5:164565737-164565759 ATTCTGCAATTCATGAGCCAGGG - Intergenic
1000773100 5:165381986-165382008 ATGATGCAAGTCATAAAACATGG + Intergenic
1001915199 5:175554694-175554716 TATTTGCAATTCATGAATCAGGG - Intergenic
1002813179 6:654187-654209 ATTCCGCAGTTCATGGATCAAGG + Intronic
1003184631 6:3820397-3820419 ATGCTGCAGTTTGAGAATCAGGG - Intergenic
1003473255 6:6457346-6457368 ATTCTGCAGCTCATGTATCAAGG + Intergenic
1003598678 6:7498323-7498345 ATTCTGCAGCTCATGGATCAAGG - Intergenic
1003779901 6:9412964-9412986 CTGCTGGAATTCATGGTTCATGG + Intergenic
1004550414 6:16641680-16641702 ATTCTGCAACCCATGGATCAAGG + Intronic
1006245302 6:32729090-32729112 ATTCTGCAACTCATGGATCAAGG + Intergenic
1006998896 6:38289695-38289717 ATGCAGCAGTTCATGAACAATGG - Intronic
1008298239 6:49804337-49804359 ATTCTGCAACCCATGGATCAAGG - Intergenic
1009306722 6:62099888-62099910 ATTCTACAGTTCATGGATCAAGG + Intronic
1009427162 6:63526704-63526726 AGGCTGCATTTCTTGAATCTGGG + Intronic
1009431128 6:63567342-63567364 ATTCTGCAACCCATGGATCAAGG - Intronic
1009741935 6:67758007-67758029 AGGCTGCTATCCATGAATCCAGG + Intergenic
1012304606 6:97637563-97637585 ATTATGCAGCTCATGAATCAAGG + Intergenic
1012339995 6:98108827-98108849 ATTCAGCAGTCCATGAATCAAGG - Intergenic
1012691196 6:102313433-102313455 ATGCTGCTATTCCTCAATTATGG + Intergenic
1012945137 6:105457730-105457752 ATGATGATATTCATGAATCTTGG - Intergenic
1014107414 6:117582733-117582755 ATCCTTCAATTCATGGATGAAGG + Intronic
1014528222 6:122526456-122526478 ATTCTGCAACTCATAGATCAAGG - Intronic
1015259651 6:131221926-131221948 ATTCTGCAGCTCATGGATCAAGG + Intronic
1018764276 6:166919894-166919916 ATGCTGCCATTCATGATTCTGGG + Intronic
1019159607 6:170060672-170060694 ATTCTGCAGCCCATGAATCAAGG + Intergenic
1019836185 7:3386947-3386969 ATGCCTGAATTCATGATTCATGG - Intronic
1019982325 7:4630552-4630574 AAGCTGGAATTCATGGAACATGG - Intergenic
1020423928 7:8042196-8042218 ATTCTGCAGTCCGTGAATCAAGG + Intronic
1020939338 7:14510787-14510809 ATTCTGCAAGCCATGGATCAAGG - Intronic
1021871843 7:25014873-25014895 ATGTTGCAATTCATGTCTGAAGG - Intergenic
1024409059 7:49017877-49017899 ATGCTGGAATACATAAATAATGG + Intergenic
1025249403 7:57342038-57342060 ATGTTGCTCTTCAGGAATCAAGG + Intergenic
1026095578 7:67343800-67343822 ATGCATCAGTTCAGGAATCACGG - Intergenic
1026507809 7:71001040-71001062 ATCCTGCAGTTCATGGATCAAGG + Intergenic
1026855621 7:73752234-73752256 ATTCTGCTGTTCATGGATCAAGG + Intergenic
1028269923 7:88775895-88775917 ATGCAGAAATGCATGAATCAAGG - Intronic
1029868833 7:103666120-103666142 GTGGTGCAATTCATGGCTCATGG + Intronic
1031851481 7:126869530-126869552 ATTCTGCAACCCATGGATCAAGG - Intronic
1031910863 7:127515541-127515563 ATGCTGCATTTGATGAAATAGGG - Intergenic
1031954837 7:127932017-127932039 ATTCTGCAACCCATGTATCAAGG + Intronic
1032980888 7:137281359-137281381 CTGCTTCCATTCATGATTCAAGG + Intronic
1033235383 7:139634050-139634072 ATGGTGCAAATCATGGCTCATGG - Intronic
1033607613 7:142938992-142939014 ATGCTGCTCTACATGAAGCATGG - Intergenic
1035984180 8:4407723-4407745 ATGCTTACATGCATGAATCATGG - Intronic
1036039891 8:5064952-5064974 ATTCTGCAACCCATGGATCAAGG + Intergenic
1036478098 8:9112287-9112309 ATGCTGCAGCCCATGAATCAAGG - Intronic
1037263507 8:17034387-17034409 ATTCTGCAGTCCATGGATCAAGG + Intronic
1037308070 8:17526676-17526698 ATGCTGGAAACCATGGATCAGGG + Intronic
1038224702 8:25645139-25645161 CTGCTGCAATTTATTAATCAGGG + Intergenic
1040754123 8:50749903-50749925 ATTCTGCAGTCCATGAATCAAGG + Intronic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1041055488 8:53981720-53981742 ATTCTGCAGTTCATGAATCAAGG + Intronic
1041432380 8:57797458-57797480 ATTCTGCAGCTCATGGATCAAGG + Intergenic
1041779868 8:61566111-61566133 ATTCTGCAGTTCATGGATCAAGG + Intronic
1041855620 8:62450802-62450824 ATGATGAAATTCATAAATAAAGG + Intronic
1042179789 8:66075386-66075408 ATGCTGCAATTCCTATTTCAGGG + Intronic
1042661529 8:71159918-71159940 ATCCTGCAATTTCTGATTCAGGG - Intergenic
1043313216 8:78887703-78887725 ATGCTGCATTGCATGAGTCCAGG + Intergenic
1044223210 8:89694116-89694138 ATTCTGCAATCCATGGATCAAGG + Intergenic
1044807819 8:96026569-96026591 ATTCTGCAACCCATGGATCAAGG + Intergenic
1046514918 8:115246147-115246169 ATTCTGCAGCTCATGAATCAAGG + Intergenic
1046711524 8:117516769-117516791 ATGTTGCATTACATGAAACAGGG + Intergenic
1046836428 8:118806607-118806629 AGGCTGCAATCCTTGAATGATGG - Intergenic
1048045895 8:130772721-130772743 ATTCTGCAACCCATGGATCAGGG - Intergenic
1048129230 8:131675264-131675286 ATTCTGCAGTTCATGGATCAAGG - Intergenic
1048902560 8:139052985-139053007 ATTCTGCAGTCCATGGATCAAGG + Intergenic
1050917827 9:11159880-11159902 ATTCTGCATTCCATGGATCAAGG - Intergenic
1050967495 9:11824917-11824939 ATTCTGCAGTTCATGGATCAAGG + Intergenic
1051266365 9:15313100-15313122 ATTCTGCAGTCCATGAATCAAGG + Intergenic
1051817888 9:21131264-21131286 AGGCTGCAATGCCTGATTCAGGG + Intergenic
1051967869 9:22850740-22850762 ATTCTGCAGGTCATGGATCAAGG - Intergenic
1052423913 9:28278764-28278786 ATTCTGCAGCCCATGAATCAAGG + Intronic
1052431044 9:28367209-28367231 ATCATGCAAGTCATGAAACAGGG - Intronic
1052760516 9:32586236-32586258 ATTCTGCAGCTCATGGATCAAGG - Intergenic
1053450160 9:38187020-38187042 ATGCTGCACTTAATGGATCAGGG + Intergenic
1053465543 9:38305015-38305037 ATTCTGCAGCTCATGGATCAAGG - Intergenic
1054872569 9:70061870-70061892 ATGCTGCCATTCAGAACTCATGG + Intronic
1055402279 9:75936921-75936943 ATTCTGCAGTTCATGGATTAAGG - Intronic
1055882892 9:81023258-81023280 ATGCTCCATTGCATGTATCAGGG - Intergenic
1055906601 9:81301913-81301935 ATTCTGCAACCCATGGATCAAGG + Intergenic
1056318488 9:85414678-85414700 ATGCTGCTATTCAGGCTTCATGG + Intergenic
1056389591 9:86128661-86128683 TATTTGCAATTCATGAATCAGGG - Intergenic
1057370473 9:94467958-94467980 ATTCTGCAGTCCATGGATCAAGG - Intergenic
1057823572 9:98353604-98353626 ATTCTGCAGTCCATGGATCAAGG - Intronic
1058592274 9:106577639-106577661 TTGCTGGAATACATGAATCTTGG - Intergenic
1058785155 9:108379581-108379603 ATGTTGGAGTTCATGAAACATGG + Intergenic
1060423967 9:123489337-123489359 ATGCTTCCATCCATGAATCCTGG + Intronic
1060772402 9:126342172-126342194 AAGCAGCAAGTCATGAATCAAGG + Intronic
1060876498 9:127087654-127087676 ATGCTGCAGTGCATCAACCAAGG + Exonic
1187304109 X:18079532-18079554 ATGATTCAATTCATGAAGGAGGG - Intergenic
1188152017 X:26688342-26688364 ATGCAGCCATACATGAATAATGG + Intergenic
1189853825 X:45202306-45202328 ATTCAGCGATTCATGAATCAGGG + Intergenic
1191588287 X:62852463-62852485 ATTCATCAATTCAGGAATCAAGG + Intergenic
1191642255 X:63439169-63439191 ATACAGCAATTCATTAATAATGG + Intergenic
1194940294 X:100001232-100001254 ATTCTGCCATCCATGAATCAAGG + Intergenic
1196384526 X:115134775-115134797 ATTCTGCAGTGCATGGATCAAGG + Intronic
1196748797 X:119096099-119096121 GTGCTGCAATTTGTGACTCATGG + Intronic
1196916431 X:120540497-120540519 ATCCAGCAATTCTTGAACCATGG + Exonic
1199789445 X:151138483-151138505 ATTCTGCAACCCATGGATCAAGG - Intergenic
1200032280 X:153306530-153306552 ATGCTGCCATTCCAGGATCAGGG - Intergenic
1202091133 Y:21191952-21191974 ATTCTGCAATTTATAAACCAAGG - Intergenic