ID: 962086170

View in Genome Browser
Species Human (GRCh38)
Location 3:132194169-132194191
Sequence CAGACTCTAGTGACTAGATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 95}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962086169_962086170 -7 Left 962086169 3:132194153-132194175 CCAGTGCAGGGCAAAGCAGACTC 0: 1
1: 0
2: 0
3: 15
4: 163
Right 962086170 3:132194169-132194191 CAGACTCTAGTGACTAGATAAGG 0: 1
1: 0
2: 0
3: 5
4: 95
962086168_962086170 -6 Left 962086168 3:132194152-132194174 CCCAGTGCAGGGCAAAGCAGACT 0: 1
1: 0
2: 0
3: 17
4: 184
Right 962086170 3:132194169-132194191 CAGACTCTAGTGACTAGATAAGG 0: 1
1: 0
2: 0
3: 5
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962086170 Original CRISPR CAGACTCTAGTGACTAGATA AGG Intronic
903727600 1:25462463-25462485 CAGACACTAGGGACTTGAAAAGG - Intronic
904786201 1:32984909-32984931 CTGACTCTGGTTACTAGCTAGGG + Intergenic
907572155 1:55493186-55493208 CAGACTCTAGGGACTCTAAAGGG - Intergenic
918816917 1:189198060-189198082 TAGACTCTAGAAACTAGAAAAGG - Intergenic
920808676 1:209260366-209260388 CAGCTTCTAAGGACTAGATAAGG - Intergenic
1068836622 10:61562014-61562036 ATGACTCTTGTGACTAAATAGGG + Intergenic
1070525973 10:77296299-77296321 CAGTCTCTAGAGGCTAGAAAAGG + Intronic
1073723794 10:106206498-106206520 CAGAAACTAGTGACTAGTGAAGG + Intergenic
1075898148 10:126016262-126016284 CAGACTTGATTGACTAGATCTGG + Exonic
1078601464 11:12735239-12735261 CAGAATCTACTGGCTAGCTAAGG - Intronic
1079470385 11:20772529-20772551 CTGACTTTAATGTCTAGATATGG + Intronic
1089184892 11:116608140-116608162 CAGACTCTAGTGACAGAGTAAGG + Intergenic
1096170734 12:49467523-49467545 CAGACTCTAGAGATTAGGGAAGG + Intronic
1102327225 12:111997147-111997169 CAAACACTAGTGACAAGAAATGG - Intronic
1106155796 13:27154804-27154826 CAGACCCTTGTGATTACATAGGG - Intronic
1107219668 13:37967454-37967476 CAGCCTCTAGAAACTAGAAAAGG - Intergenic
1109030986 13:57187223-57187245 CACCCTCTATTGACTAAATAAGG + Intergenic
1110675139 13:78233630-78233652 CAGACTCTGGGGACTAAAAAAGG - Intergenic
1114694764 14:24616355-24616377 AAAACACTAGTGATTAGATAAGG + Intergenic
1119780387 14:77273100-77273122 CTGACTCTACTTACTAGCTAGGG - Intergenic
1119944576 14:78679220-78679242 CAAACTCTAGAGAGAAGATAAGG - Intronic
1121699943 14:95944884-95944906 AAGGCTCTAGTTACTAAATAAGG + Intergenic
1125004478 15:34801484-34801506 CTGAATCTAGTGACCAGCTAAGG + Intergenic
1125972299 15:43921750-43921772 CAGACTCTAGGGGCTTGAAAGGG + Intronic
1127972867 15:63975510-63975532 CTGACTCTATTTACTAGCTATGG - Intronic
1131354349 15:91731758-91731780 CAGCTTCTAGTGACTATATATGG + Intergenic
1131523937 15:93137731-93137753 CAAACTCTGTTGACTAGATTAGG - Intergenic
1135785004 16:25340713-25340735 CAGACACTGGGGACTTGATATGG - Intergenic
1141403747 16:83773643-83773665 CAGACTCTAGAGCCCTGATATGG - Intronic
1141442543 16:84038913-84038935 CAGGCTCTAGGGATTAGATGTGG - Intronic
1145757720 17:27404883-27404905 CAGAGTCTATTGACTTGACAAGG - Intergenic
1147396459 17:40146971-40146993 CATTCTCTAGTGACTACAGACGG - Intronic
1148318172 17:46722709-46722731 GTTACACTAGTGACTAGATAAGG + Intronic
1153261525 18:3228849-3228871 CAGACACAAATGACTACATATGG - Intergenic
1167170616 19:47828957-47828979 CAAACTATAGAGACAAGATATGG + Intronic
925506983 2:4577413-4577435 CAGACACTGGTGACTTGATCTGG + Intergenic
928265723 2:29809992-29810014 CTGAGTCTAATGACTATATATGG + Intronic
931793443 2:65686773-65686795 CAGACTCTAGAATCTAGAGATGG - Intergenic
938396249 2:130950519-130950541 CAGTCTCTAGTTACTAGTAAAGG + Intronic
939423723 2:142007457-142007479 AAAATTCTAATGACTAGATAAGG - Intronic
940699067 2:157019329-157019351 AAGACGTTAGTGACTACATAGGG + Intergenic
941031186 2:160513321-160513343 GAGTTTCTCGTGACTAGATAAGG - Intergenic
944083546 2:195817915-195817937 TAGACTCTATTTACTATATATGG + Intronic
944997136 2:205306154-205306176 CAGCCTCTAGAAACTAGAAAGGG + Intronic
945670968 2:212802366-212802388 CATACTCTCGTAACTAGAGAAGG - Intergenic
945933974 2:215884341-215884363 CAAACTCTAGTCACTCCATAAGG - Intergenic
946891950 2:224285935-224285957 CAGAGTCAATAGACTAGATAAGG + Intergenic
1178960582 21:37061076-37061098 CAAACTCTCCTGACTAGAAAAGG + Intronic
1185132767 22:49049242-49049264 CATATTCTAGAGACTAGAGATGG + Intergenic
954735004 3:52699991-52700013 GACACTCTAGTGACTAGAGCAGG + Intronic
954757273 3:52847953-52847975 CAGACTCTAGAGGCTGGAAAGGG + Intronic
955742528 3:62107186-62107208 CTGATTCTAGTGACAAGATTTGG - Intronic
962086170 3:132194169-132194191 CAGACTCTAGTGACTAGATAAGG + Intronic
962979324 3:140473586-140473608 CAGCCTCTAGAAACTGGATAGGG + Intronic
963107409 3:141659196-141659218 CAGACTCCTGTGATTAGACAGGG + Intergenic
966655487 3:182353025-182353047 CAGATTCTAGTGACTGGTGAGGG + Intergenic
967688181 3:192441762-192441784 CAGAATCTTGTGAGCAGATACGG + Intronic
977170838 4:93760338-93760360 AAGACACTAGTAACTACATAAGG + Intronic
978240600 4:106511387-106511409 CAGGCTCTATTGTCTAGAAAAGG + Intergenic
978301639 4:107275435-107275457 CAAACTCTACTAACTAGACATGG - Intronic
978389100 4:108205915-108205937 CAGCCTCTAGAGACTGGACAAGG - Intergenic
980180004 4:129391752-129391774 TAGACTCTTGTGACAAGATTGGG + Intergenic
982244588 4:153338343-153338365 CAGAAGCTAGTGAATAGAGAGGG - Exonic
988148712 5:27347296-27347318 CTGACTCTTGTGAGTTGATATGG + Intergenic
989328172 5:40224385-40224407 CACACTCTACTCACTACATAGGG + Intergenic
990650641 5:57895555-57895577 CAGACTCTAGTGTATAGACTTGG - Intergenic
993831988 5:92771303-92771325 CAGACTCTAGAAGCTAGAAAAGG - Intergenic
994097502 5:95860204-95860226 AAGCCTCTGGGGACTAGATAAGG + Intergenic
998532682 5:142900289-142900311 CAGTCTCTAGTGACTCCATGGGG + Intronic
1000482668 5:161798755-161798777 AATAGTCTAGTTACTAGATAAGG - Intergenic
1003771571 6:9308532-9308554 AGGACTCTAGTTATTAGATAAGG - Intergenic
1003804597 6:9713034-9713056 CAGACTCTAGAGGCTGGAAAAGG + Intronic
1007417336 6:41699434-41699456 CAGTCTCTCCTTACTAGATAGGG + Intronic
1010536375 6:77036650-77036672 CAGACTCTAGAAACTAGAAAAGG + Intergenic
1011793656 6:90928309-90928331 CAGACTACAGTGATTAGATGAGG + Intergenic
1012810357 6:103949005-103949027 CAGACTTTAGGGACAAGTTAAGG - Intergenic
1012810430 6:103949679-103949701 CAGACTGGATTGACTAGCTAAGG - Intergenic
1014232037 6:118914664-118914686 CAGAATCTAGTGATTACATGTGG + Intronic
1014887232 6:126796688-126796710 AAGATTCTAGTGAATTGATAGGG + Intergenic
1020558186 7:9694971-9694993 CAGAATCTTGAGACTAGATCAGG + Intergenic
1024703472 7:51930000-51930022 CAGTCTCTAGAAACTAGAAAAGG - Intergenic
1024832873 7:53482235-53482257 CAGACTCTAGAGGCTGGAAAAGG - Intergenic
1028117802 7:87021088-87021110 CAGAATAAAGTGACTAGCTAAGG + Intronic
1028202186 7:87974833-87974855 CAGCCTCTAGAAACTAGAAAAGG - Intronic
1028747579 7:94345330-94345352 CAGACACTAATGACTAAAAAAGG + Intergenic
1039185828 8:34915341-34915363 CATACTCTAGTGAAAAGAAAAGG + Intergenic
1040549103 8:48424698-48424720 CTGACTCTAGTGTCTAGCTGAGG + Intergenic
1045796913 8:106057199-106057221 CAAACTAAAGTGACTACATAAGG + Intergenic
1047611715 8:126527308-126527330 CAGACTCTGGTGTGTAGATTGGG + Intergenic
1048284389 8:133130525-133130547 CAGCCTCTAGTGACTGGGAATGG + Intronic
1051390090 9:16554718-16554740 CAGAATCCAGTGACCAGATCGGG + Intronic
1053592787 9:39531470-39531492 CTCACTCTAGGGACTTGATATGG + Intergenic
1053850523 9:42286183-42286205 CTCACTCTAGGGACTTGATATGG + Intergenic
1054573516 9:66833809-66833831 CTCACTCTAGGGACTTGATATGG - Intergenic
1059477712 9:114561204-114561226 CAGACTCAACTGATTAGACAAGG - Intergenic
1186071638 X:5827211-5827233 CAGGTTCTAGTGACTAGATGTGG + Intergenic
1190581254 X:51894446-51894468 CGGAGTCTAGTCACTAAATAGGG - Intronic
1192710616 X:73581007-73581029 CAGATTCTAGTGACCAGAAAAGG + Intronic
1193775079 X:85631355-85631377 CAGAATTTAGTGACTAAATATGG - Intergenic
1196166892 X:112545449-112545471 CATACTCCTGTGGCTAGATAAGG + Intergenic
1201687216 Y:16718759-16718781 CAGACTCAAATGTCTACATATGG + Intergenic